This Article Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zhang, W. Articles by Deisseroth, A. Search for Related Content PubMed PubMed Citation Articles by Zhang, W. Articles by Deisseroth, A.

Inactive p53 Mutants May Enhance the Transcriptional Activity of Wild-Type p53¹

Department of Hematology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 [W. Z., A. D.], and Department of Cell Biology and Neuroscience, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas 75235-9039 [J. W. S.]

The p53 mutants 248Trp, 175His, and 281Gly fail to activate transcription mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTT-GCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

¹ This work was supported by grants to A. D. from the American Cancer Society; the National Cancer Institute (PO1 CA55164); AASTROM Biosciences, Inc.; Genta, Inc.; Ingenex, Inc.; the Wiley Foundation; the Bush Fund for Leukemia Research; and the Anderson Chair for Cancer Treatment and Research and by Grants NIH AG07992 and CA50195 to J. W. S.

² To whom requests for reprints should be addressed, at Department of Hematology, Box 24, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX 77030.

Received 8/ 5/93. Accepted 9/ 2/93.

This article has been cited by other articles:

				J. A. Cerrato, W.K. A. Yung, and T.-J. Liu Introduction of mutant p53 into a wild-type p53-expressing glioma cell line confers sensitivity to Ad-p53-induced apoptosis Neuro-oncol, April 1, 2001; 3(2): 113 - 122. [Abstract] [PDF]

				S. P. Mathupala, C. Heese, and P. L. Pedersen Glucose Catabolism in Cancer Cells. THE TYPE II HEXOKINASE PROMOTER CONTAINS FUNCTIONALLY ACTIVE RESPONSE ELEMENTS FOR THE TUMOR SUPPRESSOR p53 J. Biol. Chem., September 5, 1997; 272(36): 22776 - 22780. [Abstract] [Full Text] [PDF]