| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Section of Immunopathogenesis, Institute of Immunological Science, Hokkaido University, Sapporo, 0600815, Japan [Y. U. K., H. H., K. T., S. C., M. M., T. U.]; Institute of Genetics, Forschungszentrum Karlsruhe, D-76021 Karlsruhe, Germany [J. S., P. H.]; Research Institute for Wakan-Yaku (Traditional Sino-Japanese Medicines), Toyama Medical and Pharmaceutical University, 9300194 Toyama, Japan [H. F., I. S.]; Department of Immunology, Juntendo University School of Medicine, 1138421 Tokyo, Japan [H. Y., K. O.]; and Division of Experimental Oncology, Department of Oncology, The London Regional Cancer Centre, Ontario, N6A 4L6, Canada [A. F. C.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
vß3,
vß1, and
vß5 integrins on the cell surface (7
, 8)
. The binding of integrins to OPN through the interaction with the RGD sequence results in distinct functional consequences. For example, in vascular smooth muscle cells,
vß3,
vß1 and
vß5 integrins mediate cell adhesion, whereas only the
vß3 integrin supports cell migration (9)
. The functional diversity of OPN can be also explained by the interaction of OPN with a cellular receptor(s) other than an
v-containing integrin. For example, the
9ß1 tenascin receptor is involved in the binding of human melanoma cells to the thrombin-cleaved amino-terminal half of human OPN (10)
. Additionally, we have previously shown that both human and murine OPN have domains that do not contain the RGD sequence, but which can be bound by cell surface receptors (11)
. Furthermore, it was recently demonstrated that OPN can interact with CD44 in an RGD-independent manner (12)
. CD44 has been implicated in a wide variety of cellular processes, including cell-cell and cell-matrix interactions, cell migration, metastasis, lymphocyte homing, and T cell activation (13, 14, 15) . CD44 is encoded by a total of 20 exons, 7 of which form the invariant extracellular domain of the standard form (CD44s). The variant exons (v1-v10) are alternatively spliced within this invariant extracellular domain (16) . The up-regulation of CD44 variant expression is associated with tumor progression in several tumor types (17) . Functional differences between the isoforms are emerging. For example, certain CD44 variants have been shown to up-regulate binding to hyaluronic acid and other glycosaminoglycans, and to promote CD44 oligomerization (18, 19, 20) . In addition to binding to glycosaminoglycans, CD44 has been shown to bind to a range of other ligands (17) . With regard to OPN binding, transfection of CD44v7-v10 into CD44-negative fibroblasts conferred on the transfected cells the ability to bind to OPN and HA, and this binding was clearly inhibited by exogenous OPN or HA (12) . The transfected fibroblasts bound to OPN in an RGD-independent manner. Furthermore, OPN was able to induce chemotaxis in the transfected cells. This chemotaxis was inhibited by antibodies against OPN and CD44, suggesting that OPN is involved in CD44-mediated cell migration (12) . However, the potential of different isoforms of CD44 to bind to OPN and induce chemotaxis has not been investigated.
Integrins compose one of the major families of adhesion receptors and the heterodimeric association of different
and ß subunits results in the formation of more than 20 integrin receptors. The different subunit combinations have remarkably different properties, being involved in processes as diverse as tissue development, angiogenesis, inflammation and the regulation of apoptosis (21)
. Furthermore, changes in integrin subunit composition are critically involved in tumorigenesis and metastasis (22
, 23) . Integrin activity is regulated by intracellular signaling, which can convert low affinity forms into high affinity forms. On the other hand, binding of integrin to ligand can result in signal transduction, which regulates other molecules including cytoskeletal organization (24
, 25)
.
We have previously reported that murine B16-F10 melanoma cells bound to OPN through interaction of the RGD tripeptide sequence within the OPN protein via
v-containing integrin, as did L929 fibroblasts. In contrast, OPN domains lacking the RGD sequence were shown to be involved in the binding of OPN with murine B16-BL6 melanoma cells (11)
. However, the cellular receptors for the non-RGD-containing domains of OPN were not identified. In this study, we show that B16-BL6 but not B16-F10 or L929 cells express CD44 variants, and that CD44 variants but not CD44s can bind to OPN in an RGD-independent manner. Furthermore, the RGD-independent OPN binding by CD44 variants also requires ß1-containing integrins. The binding of CD44 variants to non-RGD-containing domains of OPN induces cell spreading and chemotactic behavior, a functional consequence that is not observed with the non-OPN binding CD44s.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines.
The rat pancreatic carcinoma cell line BSp73AS clone 10AS (designated as AS) and derivatives of this cell line that have been transfected with pSVneo (designated as ASneo) or pSVneo together with rat CD44v47 (designated as ASv4-v7), rat CD44v110 (designated as ASv1-v10), or CD44s (designated as ASCD44N) have previously been described (30, 31, 32)
. The rat BDX2 fibrosarcoma cell line and its derivatives transfected with either pRS-Vneo alone (BDX2neo) or with pRSVneo together with rat CD44v47, CD44v6,7, CD44v6, or CD44v7 (designated as BDX2CD44v47, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7, respectively) have been described previously (18
, 20)
. AS and AS-derived transfectants were maintained in RPMI 1640, whereas BDX2 and its transfectants were maintained in DMEM containing 10% FCS in the presence or absence of 300 µg/ml G418. It should be noted that the CD44v47 expression plasmid used to make some of these cell lines lacks exon 15, which encodes the 5G8 epitope and is present in CD44s. All other expression constructs include exon 15. Murine malignant melanoma cells, B16-BL6 and B16-F10 cells, originally provided by Dr. I. J. Fidler (M. D. Anderson Cancer Center, Houston, TX), were maintained in the Institute of Immunological Science (Hokkaido, Japan; Ref. 33
). The murine fibroblastic cell line L929 was also used in this study (11)
. These murine cell lines were maintained in DMEM containing 10% FCS.
Construction of the GST-OPN Fusion Plasmid.
Oligonucleotides used in this study were synthesized based on the published murine OPN cDNA sequence (34)
; primer 1 (5'AAAGGATCCCCCTCCCGGTGAAAGTGACT 3') contains a BamHI restriction site and also encodes the first six amino acids of mature OPN. Primer 2 [5'TTTCCCGGGTCAGCCGTTGGGGACG (original T was replaced by G to create a SalI site because no amino acid substitution occurred as a result of this change) TCGACTGTAGG 3'] is complementary to the cDNA sequence encoding the eight amino acids before R128G129D130 and contains a stop codon with SmaI restriction site. Primer 3 (5'AAAGGATCCGCTTGGCTTATGGACTGAGG3') contains a BamHI restriction site and encodes the sequence of the six amino acids starting from L132. Primer 4 (5'TTTCCCGGGTTAGTTGACCTCAGAAGATGA3') is complementary to the cDNA sequence of the last six amino acids of mature OPN and contains a stop codon with SmaI restriction site. PCR reactions were conducted using full-length murine OPN cDNA as a template using an appropriate combination of the above two primers. PCR products were purified and cloned into pCRII vector as described previously (35)
. The OPN cDNA cloned by PCR was completely sequenced and inserted into the pGEX-3X vector in the same reading frame as the carrier gene (glutathione S-Transferase, EC 2.5.1.18; Ref. 36
) and transformed in Escherichia coli DH5
cells. Thus, three murine GST-OPN fusion proteins were produced: GST fused to full-length murine OPN(r-mOPN; L1-N278), the N-terminal half of mOPN lacking R128G129D130 (r-mN-half OPN; L1-G127), and the COOH-terminal half of mOPN lacking R128G129D130 (r-mC-half OPN; L132-N278). To make mutated OPN in which the RGD sequence is replaced with AAA (designated as AAA-OPN), we further synthesized primer 5, which is complementary to the cDNA sequence of the 14 amino acid (T121VDVPNGAAASLAY134) and which was engineered to contain a SalI restriction enzyme site: 5'ACAGTCGAC#GTCCCCAACGGCGCAGCTGCTAGCTTGGCATAT3' (the original T was substituted by C# to create a SalI site because no amino acid substitution occurred as a result of this change). A PCR reaction was conducted using the full-length mouse OPN cDNA as a template and was directed by primers 4 and 5. The PCR product was sequenced and digested with SalI and SmaI enzymes. The cDNA of mutated OPN (D123-N278) thus obtained was ligated with the r-mN-half OPN/pGEX-3X plasmid cleaved with SalI/SmaI restriction enzymes. Two additional mutated GST-OPN fusion plasmids [mutation of RGD to RGE (Arg-Gly-Glu) by a single base change, GAT (Asp) to GAG (Glu), designated as RGE-OPN, and deletion of the RGD sequence, designated as
RGD] were constructed as described previously (37)
.
Protein Purification.
The various recombinant GST-OPN fusion proteins were prepared in E. coli as described previously, and GST fusion proteins were purified on glutathione-Sepharose columns as described (11
, 36)
. The purity of the proteins was analyzed by SDS-PAGE and then stained with coomassie brilliant blue (Fig. 1)
.
|
Flow Cytometry.
Cells were incubated with a saturating amount of mAb for 30 min at 4°C. Cells were washed with PBS, then incubated with phycoerythrin-labeled antimouse k chain or FITC-labeled murine antirat k chain monoclonal antibody for 30 min at 4°C. After washing, cells were analyzed by using a fluorescence-activated cell sorter (Becton Dickinson, Mountain View, CA).
Cell Spreading Studies.
Cell spreading assays were performed as described by Guan and Hynes (38)
. Briefly, plates were precoated with GST, GST-OPN, GST-N-half OPN, or GST-C-half OPN overnight at 4°C and then blocked with PBS containing 1% BSA. Cells (5 x 104) suspended in DMEM containing 0.25% BSA were added to each well at a volume of 200 µl/well. After incubation for 90 min at 37°C, all wells were washed twice with PBS, and photographs were taken. The photomicrographs are representatives of several independent experiments (magnification, x120).
Chemotactic Migration Assay.
The chemotactic migration of transfectants was measured by using ChemoTx 1018 (Neuroprobe, Gaithersburg, MD) with polyvinylpyrrolidon-free polycarbonate filters (8.0-µm pore size). Log-phase cell cultures of transfectants were harvested with 1 mM EDTA in PBS, washed three times with serum-free DMEM, and resuspended to a final concentration of 2 x 106/ml in DMEM containing 0.1% BSA. Cell suspensions (25 µl) were added to the upper surface of the plate, and various concentrations of OPN proteins were added to the lower compartment. ChemoTx plates were incubated at 37°C in a 5% CO2 atmosphere. After a 12-h incubation, the filters were fixed with methanol, and stained with H&E. The cells on the upper surface of the filters were removed by wiping them with a cotton swab. The cells that had migrated to the lower surface were manually counted under a microscope, at a magnification of x400. To distinguish chemotactic activity from chemokinetic activity, checkerboard assays were also performed as described previously (39)
. All samples were tested in six replicates, and data were expressed as the mean of the migrating cell number ± SD. A two-tailed Students t test was used to determine the significance of differences between experimental groups.
| RESULTS |
|---|
|
|
|---|
|
|
|
v integrin receptors are able to bind to the RGD sequence within OPN. To exclude the involvement of
v integrin in the binding to OPN to the surface of the BDX2 transfectants, we examined the ability of these transfectants to bind to OPN in the presence of exogenous GRGDS synthetic peptides. As shown in Fig. 5
|
|
9ß1 (10)
. To exclude the possibility that this integrin may be responsible for the CD44v-mediated, RGD-independent OPN binding, we included saturating amounts of anti-ß1 as well as anti-ß3 monoclonal antibodies in OPN cell binding assays. Surprisingly, the anti-ß1 integrin monoclonal antibody almost completely inhibited the binding of BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells to both the amino- and COOH-terminal halves of OPN (Fig. 7)
|
|
|
|
| DISCUSSION |
|---|
|
|
|---|
At first sight, the binding of CD44 variants to OPN is not limited to sequences encoded by individual CD44v exons or a group of exons. For example, both the BDX2CD44v6 and BDX2CD44v7 were able to bind to OPN. However, the BDX2CD44v7 cells express some CD44v6 endogenously (Fig. 4)
. This presumably explains the stimulatory effect of the 1.1AMSL (anti-CD44v6) antibody on OPN binding observed with BDX2CD44v7 cells in Fig. 8
. Thus, we cannot at present definitely determine the relative contributions of CD44v6 and CD44v7 to the binding of OPN by BDX2CD44v7 cells. Assuming that CD44v7 can bind to OPN, these data would suggest that the incorporation of variant exons may change the secondary structure of the CD44 protein to reveal OPN binding sites.
A major finding of this study is that CD44-mediated OPN binding requires the ß1 integrin subunit. OPN must contain multiple CD44/ß1 binding sites, as both the amino- and COOH-terminal portions of OPN lacking an RGD sequence were bound by CD44 variants in a ß1-dependent manner. It is known that the
9ß1 tenascin receptor is involved in the binding of human melanoma cells to the amino-terminal, but not the COOH-terminal half of human OPN (10)
. It will, therefore, be important to determine what kind of integrin
chain heterodimerizes with ß1 in the CD44v transfectants used in this study. One possibility is that the transfectants express both
9ß1 integrin, which mediates cell binding to the amino-terminal half of OPN, and an integrin consisting of an undetermined
chain together with ß1, which mediates binding to the COOH-terminal half of OPN. Alternatively, another
subunit may participate with ß1 in the binding to the amino-terminal half of OPN.
How might CD44 variants and ß1-containing integrins cooperate to bind to OPN? Two hypotheses are plausible. In the first, either CD44 variants or ß1-containing integrins bind directly to OPN, whereas the non-OPN-binding partner regulates OPN binding via intracellular signaling. Thus, in the scenario that ß1-containing integrins regulate CD44v-mediated OPN binding, anti-ß1 antibodies would cause transduction of intracellular signals by cross-coupling ß1, which would down-regulate CD44-mediated OPN binding. In the opposite case where CD44 regulates OPN binding by ß1, signal transduction via CD44 would activate preexisting ß1 to bind OPN, because expression of CD44 variants, per se, does not result in the up-regulation of ß1 (data not shown), nor does the potentially signal-transducing cross-coupling of CD44 by anti-CD44 antibodies (data not shown). The alternative hypothesis to explain the effects of ectopic CD44 variant expression and anti-CD44 and anti-ß1 antibodies on OPN binding is that CD44 variants and ß1-containing integrins bind cooperatively to OPN. Thus, transfection of cells expressing ß1-containing integrin endogenously with CD44 variants would permit a ternary complex to form between CD44v, ß1-containing integrin and OPN. The anti-CD44 antibodies would stimulate clustering of CD44 and thereby potentiate the formation of the ternary complex, whereas the anti-ß1 antibody would inhibit OPN binding by sterically hindering the formation of the ternary complex. Support for this latter hypothesis comes from the observation that the clustering of CD44 promote its binding to HA (2 , 19 , 41) .
The striking consequence of CD44 variant-mediated OPN binding is to increase cell motility and to promote chemotactic behavior (Fig. 9)
. Both OPN and CD44 variant expression is associated with tumorigeneis and metastatic progression, and these OPN-mediated events are likely to contribute to the function of CD44 variants during tumor progression and metastasis. Thus, OPN binding via CD44 variants and ß1-containing integrins would serve to promote metastasis by increasing the motility of the tumor cells, permitting them to migrate away from the primary tumor and to colonize distant sites. Furthermore, changes in the subunit composition of the integrin family of cell surface adhesion molecules during tumor progression play an important role in the metastatic cascade, as these changes alter the range of ligands bound by the integrin heterodimers (22
, 23)
. The involvement of ß1-containing integrins in the OPN-induced enhancement of motility, we report here, adds a new dimension to how these subunit changes can promote metastatic spread. Moreover, OPN binding resulted in cell spreading, which requires reorganization of cytoskeleton, and the ß1-containing integrin involvement in OPN binding may also contribute to the cytoskeletal changes necessary for the cell spreading we observed, as ß1-containing integrins are known to regulate cytoskeletal components (24
, 25) .
We note with interest that the disruption of CD44 variant/ß1-containing integrin binding to OPN is likely to interfere with the metastatic spread of tumors and, therefore, constitutes a novel target for therapeutic intervention. In conclusion, our finding that CD44 variants and ß1-containing integrins cooperate to bind to OPN and thereby promote cell motility functionally connects three molecules that have been implicated in tumor metastasis, and provides a fascinating insight into how they function to permit the spread of tumors.
| FOOTNOTES |
|---|
1 Supported in part by a Grant-in-Aid from Sagawa Cancer Research Foundation; the Ministry of Education, Science, and Culture of Japan Grant 10557024 (to T. U.); and by Grant 8426 from the National Cancer Institute of Canada (to A. F. C). J. P. S. was supported by a European Union Marie Curie Fellowship. ![]()
2 To whom requests for reprints should be addressed, at Institute of Immunological Science, Hokkaido University, Kita-15, Nishi-7, Kita-ku, Sapporo, 0600815, Japan. Phone and Fax: 85-11-736-9836; E-mail: toshi{at}imm.hokudai.ac.jp ![]()
3 The abbreviations used are: OPN, osteopontin; CD44s, standard form of CD44; CD44v, variant form of CD44; GST, glutathione S-transferase, EC2.5.1.18; GRGDS, glycine-arginine-glycine-aspartic acid-cysteine; GRGES, glycine-arginine-glycine-glutamine-cysteine; HA, hyaluronic acid; RGD, arginine-glycine-aspartic acid; VN, vitronectin; PE, phycoerythrin. ![]()
Received 6/23/98. Accepted 10/28/98.
| REFERENCES |
|---|
|
|
|---|
vß3,
vß1 and
vß5. J. Biol. Chem., 270: 2632-2638, 1995.
vß3 in smooth muscle migration to osteopontin in vitro. J. Clin. Invest., 95: 713-724, 1995.
9ß1 integrin. J. Biol. Chem., 271: 28485-28491, 1996.
v integrins. J. Cell. Biochem., 62: 123-131, 1996.[Medline]
6 and
v integrins in metastasis. Curr. Top. Microbiol. Immunol., 213: 195-203, 1996.
4ß7. Cell, 60: 53-61, 1990.[Medline]
This article has been cited by other articles:
![]() |
L. Schack, R. Stapulionis, B. Christensen, E. Kofod-Olsen, U. B. Skov Sorensen, T. Vorup-Jensen, E. S. Sorensen, and P. Hollsberg Osteopontin Enhances Phagocytosis through a Novel Osteopontin Receptor, the {alpha}X{beta}2 Integrin J. Immunol., June 1, 2009; 182(11): 6943 - 6950. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-H. Yang, J. Fan, Y. Xu, S.-J. Qiu, X.-R. Yang, G.-M. Shi, B. Wu, Z. Dai, Y.-K. Liu, Z.-Y. Tang, et al. Osteopontin Combined with CD44, a Novel Prognostic Biomarker for Patients with Hepatocellular Carcinoma Undergoing Curative Resection Oncologist, November 1, 2008; 13(11): 1155 - 1165. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Mack, M. W. Redman, K. Chansky, S. K. Williamson, N. C. Farneth, P. N. Lara Jr, W. A. Franklin, Q.-T. Le, J. J. Crowley, and D. R. Gandara Lower Osteopontin Plasma Levels Are Associated With Superior Outcomes in Advanced Non-Small-Cell Lung Cancer Patients Receiving Platinum-Based Chemotherapy: SWOG Study S0003 J. Clin. Oncol., October 10, 2008; 26(29): 4771 - 4776. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ono, K. Nakashima, S. R. Rittling, E. Schipani, T. Hayata, K. Soma, D. T. Denhardt, H. M. Kronenberg, Y. Ezura, and M. Noda Osteopontin Negatively Regulates Parathyroid Hormone Receptor Signaling in Osteoblasts J. Biol. Chem., July 11, 2008; 283(28): 19400 - 19409. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-A. Kang, Y. Zhou, T. L. Weis, H. Liu, J. Ulaszek, N. Satgurunathan, L. Zhou, K. van Besien, J. Crispino, A. Verma, et al. Osteopontin Regulates Actin Cytoskeleton and Contributes to Cell Proliferation in Primary Erythroblasts J. Biol. Chem., March 14, 2008; 283(11): 6997 - 7006. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Vachon, R. Martin, V. Kwok, V. Cherepanov, C.-W. Chow, C. M. Doerschuk, J. Plumb, S. Grinstein, and G. P. Downey CD44-mediated phagocytosis induces inside-out activation of complement receptor-3 in murine macrophages Blood, December 15, 2007; 110(13): 4492 - 4502. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pacheco-Rodriguez, W. K. Steagall, D. M. Crooks, L. A. Stevens, H. Hashimoto, S. Li, J.-a. Wang, T. N. Darling, and J. Moss TSC2 Loss in Lymphangioleiomyomatosis Cells Correlated with Expression of CD44v6, a Molecular Determinant of Metastasis Cancer Res., November 1, 2007; 67(21): 10573 - 10581. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Leali, E. Moroni, F. Bussolino, and M. Presta Osteopontin Overexpression Inhibits in Vitro Re-endothelialization via Integrin Engagement J. Biol. Chem., July 6, 2007; 282(27): 19676 - 19684. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Christensen, C. C. Kazanecki, T. E. Petersen, S. R. Rittling, D. T. Denhardt, and E. S. Sorensen Cell Type-specific Post-translational Modifications of Mouse Osteopontin Are Associated with Different Adhesive Properties J. Biol. Chem., July 6, 2007; 282(27): 19463 - 19472. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Zoller, P. Gupta, R. Marhaba, M. Vitacolonna, and P. Freyschmidt-Paul Anti-CD44-mediated blockade of leukocyte migration in skin-associated immune diseases J. Leukoc. Biol., July 1, 2007; 82(1): 57 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Rodrigues, J. A. Teixeira, F. L. Schmitt, M. Paulsson, and H. Lindmark-Mansson The Role of Osteopontin in Tumor Progression and Metastasis in Breast Cancer Cancer Epidemiol. Biomarkers Prev., June 1, 2007; 16(6): 1087 - 1097. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Burdo, M. R. Wood, and H. S. Fox Osteopontin prevents monocyte recirculation and apoptosis J. Leukoc. Biol., June 1, 2007; 81(6): 1504 - 1511. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W Erikson, A. L Way, D. A Chapman, and G. J Killian Detection of osteopontin on Holstein bull spermatozoa, in cauda epididymal fluid and testis homogenates, and its potential role in bovine fertilization Reproduction, May 1, 2007; 133(5): 909 - 917. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Lee, M.-J. Wang, P.-R. Sudhir, G.-D. Chen, C.-W. Chi, and J.-Y. Chen Osteopontin Promotes Integrin Activation through Outside-In and Inside-Out Mechanisms: OPN-CD44V Interaction Enhances Survival in Gastrointestinal Cancer Cells Cancer Res., March 1, 2007; 67(5): 2089 - 2097. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Wai, Z. Mi, C. Gao, H. Guo, C. Marroquin, and P. C. Kuo Ets-1 and Runx2 Regulate Transcription of a Metastatic Gene, Osteopontin, in Murine Colorectal Cancer Cells J. Biol. Chem., July 14, 2006; 281(28): 18973 - 18982. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Allan, R. George, S. A. Vantyghem, M. W. Lee, N. C. Hodgson, C. J. Engel, R. L. Holliday, D. P. Girvan, L. A. Scott, C. O. Postenka, et al. Role of the Integrin-Binding Protein Osteopontin in Lymphatic Metastasis of Breast Cancer Am. J. Pathol., July 1, 2006; 169(1): 233 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Sodek, A. P. Batista Da Silva, and R. Zohar Osteopontin and Mucosal Protection Journal of Dental Research, May 1, 2006; 85(5): 404 - 415. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Cheng and P. A. Sharp Regulation of CD44 Alternative Splicing by SRm160 and Its Potential Role in Tumor Cell Invasion Mol. Cell. Biol., January 1, 2006; 26(1): 362 - 370. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Celetti, D. Testa, S. Staibano, F. Merolla, V. Guarino, M. D. Castellone, R. Iovine, G. Mansueto, P. Somma, G. De Rosa, et al. Overexpression of the Cytokine Osteopontin Identifies Aggressive Laryngeal Squamous Cell Carcinomas and Enhances Carcinoma Cell Proliferation and Invasiveness Clin. Cancer Res., November 15, 2005; 11(22): 8019 - 8027. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Nilsson, H. M. Johnston, G. A. Whitty, B. Williams, R. J. Webb, D. T. Denhardt, I. Bertoncello, L. J. Bendall, P. J. Simmons, and D. N. Haylock Osteopontin, a key component of the hematopoietic stem cell niche and regulator of primitive hematopoietic progenitor cells Blood, August 15, 2005; 106(4): 1232 - 1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Wai, Z. Mi, H. Guo, S. Sarraf-Yazdi, C. Gao, J. Wei, C. E. Marroquin, B. Clary, and P. C. Kuo Osteopontin silencing by small interfering RNA suppresses in vitro and in vivo CT26 murine colon adenocarcinoma metastasis Carcinogenesis, April 1, 2005; 26(4): 741 - 751. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawamura, K. Iyonaga, H. Ichiyasu, J. Nagano, M. Suga, and Y. Sasaki Differentiation, Maturation, and Survival of Dendritic Cells by Osteopontin Regulation Clin. Vaccine Immunol., January 1, 2005; 12(1): 206 - 212. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iwata, N. Awaya, L. Graf, C. Kahl, and B. Torok-Storb Human marrow stromal cells activate monocytes to secrete osteopontin, which down-regulates Notch1 gene expression in CD34+ cells Blood, June 15, 2004; 103(12): 4496 - 4502. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chiocchetti, M. Indelicato, T. Bensi, R. Mesturini, M. Giordano, S. Sametti, L. Castelli, F. Bottarel, M. C. Mazzarino, L. Garbarini, et al. High levels of osteopontin associated with polymorphisms in its gene are a risk factor for development of autoimmunity/lymphoproliferation Blood, February 15, 2004; 103(4): 1376 - 1382. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Coppola, M. Szabo, D. Boulware, P. Muraca, M. Alsarraj, A. F. Chambers, and T. J. Yeatman Correlation of Osteopontin Protein Expression and Pathological Stage across a Wide Variety of Tumor Histologies Clin. Cancer Res., January 1, 2004; 10(1): 184 - 190. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gao, H. Guo, L. Downey, C. Marroquin, J. Wei, and P. C. Kuo Osteopontin-dependent CD44v6 expression and cell adhesion in HepG2 cells Carcinogenesis, December 1, 2003; 24(12): 1871 - 1878. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-L. Chang, M. Cao, and P. Hicks Osteopontin induction is required for tumor promoter-induced transformation of preneoplastic mouse cells Carcinogenesis, November 1, 2003; 24(11): 1749 - 1758. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Johnson, R. C. Burghardt, F. W. Bazer, and T. E. Spencer Osteopontin: Roles in Implantation and Placentation Biol Reprod, November 1, 2003; 69(5): 1458 - 1471. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Furger, A. L. Allan, S. M. Wilson, C. Hota, S. A. Vantyghem, C. O. Postenka, W. Al-Katib, A. F. Chambers, and A. B. Tuck {beta}3 Integrin Expression Increases Breast Carcinoma Cell Responsiveness to the Malignancy-Enhancing Effects of Osteopontin Mol. Cancer Res., September 1, 2003; 1(11): 810 - 819. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Chellaiah, R. S. Biswas, S. R. Rittling, D. T. Denhardt, and K. A. Hruska Rho-dependent Rho Kinase Activation Increases CD44 Surface Expression and Bone Resorption in Osteoclasts J. Biol. Chem., August 1, 2003; 278(31): 29086 - 29097. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Verhulst, M. Asselman, V. P. Persy, M. S.J. Schepers, M. F. Helbert, C. F. Verkoelen, and M. E. De Broe Crystal Retention Capacity of Cells in the Human Nephron: Involvement of CD44 and Its Ligands Hyaluronic Acid and Osteopontin in the Transition of a Crystal Binding- into a Nonadherent Epithelium J. Am. Soc. Nephrol., January 1, 2003; 14(1): 107 - 115. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Orian-Rousseau, L. Chen, J. P. Sleeman, P. Herrlich, and H. Ponta CD44 is required for two consecutive steps in HGF/c-Met signaling Genes & Dev., December 1, 2002; 16(23): 3074 - 3086. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Weber, S. Zawaideh, S. Hikita, V. A. Kumar, H. Cantor, and S. Ashkar Phosphorylation-dependent interaction of osteopontin with its receptors regulates macrophage migration and activation J. Leukoc. Biol., October 1, 2002; 72(4): 752 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Weber Meeting Report: The Next Interleukin? Sci. Signal., August 27, 2002; 2002 (147): pe37 - pe37. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Rittling, Y. Chen, F. Feng, and Y. Wu Tumor-derived Osteopontin Is Soluble, Not Matrix Associated J. Biol. Chem., March 8, 2002; 277(11): 9175 - 9182. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koguchi, K. Kawakami, S. Kon, T. Segawa, M. Maeda, T. Uede, and A. Saito Penicillium marneffei Causes Osteopontin-Mediated Production of Interleukin-12 by Peripheral Blood Mononuclear Cells Infect. Immun., March 1, 2002; 70(3): 1042 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.M. Weiss, A.C. Renkl, C.S. Maier, M. Kimmig, L. Liaw, T. Ahrens, S. Kon, M. Maeda, H. Hotta, T. Uede, et al. Osteopontin Is Involved in the Initiation of Cutaneous Contact Hypersensitivity by Inducing Langerhans and Dendritic Cell Migration to Lymph Nodes J. Exp. Med., October 29, 2001; 194(9): 1219 - 1230. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Medico, A. Gentile, C. L. Celso, T. A. Williams, G. Gambarotta, L. Trusolino, and P. M. Comoglio Osteopontin Is an Autocrine Mediator of Hepatocyte Growth Factor-induced Invasive Growth Cancer Res., August 1, 2001; 61(15): 5861 - 5868. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Takahashi, K. Takahashi, T. Okazaki, K. Maeda, H. Ienaga, M. Maeda, S. Kon, T. Uede, and Y. Fukuchi Role of Osteopontin in the Pathogenesis of Bleomycin-Induced Pulmonary Fibrosis Am. J. Respir. Cell Mol. Biol., March 1, 2001; 24(3): 264 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Sherman, T. A. Rizvi, S. Karyala, and N. Ratner CD44 Enhances Neuregulin Signaling by Schwann Cells J. Cell Biol., September 5, 2000; 150(5): 1071 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Lin, C.-J. Huang, J.-R. Chao, S.-T. Chen, S.-F. Lee, J. J.-Y. Yen, and H.-F. Yang-Yen Coupling of Osteopontin and Its Cell Surface Receptor CD44 to the Cell Survival Response Elicited by Interleukin-3 or Granulocyte-Macrophage Colony-Stimulating Factor Mol. Cell. Biol., April 15, 2000; 20(8): 2734 - 2742. [Abstract] [Full Text] |
||||
![]() |
L Hebbard, A Steffen, V Zawadzki, C Fieber, N Howells, J Moll, H Ponta, M Hofmann, and J Sleeman CD44 expression and regulation during mammary gland development and function J. Cell Sci., January 7, 2000; 113(14): 2619 - 2630. [Abstract] [PDF] |
||||
![]() |
J. Sodek, B. Ganss, and M.D. McKee Osteopontin Critical Reviews in Oral Biology & Medicine, January 1, 2000; 11(3): 279 - 303. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.-Q. Zheng, A. S. Woodard, G. Tallini, and L. R. Languino Substrate Specificity of alpha vbeta 3 Integrin-mediated Cell Migration and Phosphatidylinositol 3-Kinase/AKT Pathway Activation J. Biol. Chem., August 4, 2000; 275(32): 24565 - 24574. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |