Cancer Research Cell Death Mechanisms and Cancer Therapy  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 219-226, January 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katagiri, Y. U.
Right arrow Articles by Uede, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katagiri, Y. U.
Right arrow Articles by Uede, T.
[Cancer Research 59, 219-226, January 1, 1999]
© 1999 American Association for Cancer Research


Tumor Biology

CD44 Variants but not CD44s Cooperate with ß1-containing Integrins to Permit Cells to Bind to Osteopontin Independently of Arginine-glycine-aspartic Acid, thereby Stimulating Cell Motility and Chemotaxis1

Yohko U. Katagiri, Jonathan Sleeman, Hideki Fujii, Peter Herrlich, Hiroshi Hotta, Kumiko Tanaka, Shunsuke Chikuma, Hideo Yagita, Ko Okumura, Masaaki Murakami, Ikuo Saiki, Ann F. Chambers and Toshimitsu Uede2

Section of Immunopathogenesis, Institute of Immunological Science, Hokkaido University, Sapporo, 0600815, Japan [Y. U. K., H. H., K. T., S. C., M. M., T. U.]; Institute of Genetics, Forschungszentrum Karlsruhe, D-76021 Karlsruhe, Germany [J. S., P. H.]; Research Institute for Wakan-Yaku (Traditional Sino-Japanese Medicines), Toyama Medical and Pharmaceutical University, 9300194 Toyama, Japan [H. F., I. S.]; Department of Immunology, Juntendo University School of Medicine, 1138421 Tokyo, Japan [H. Y., K. O.]; and Division of Experimental Oncology, Department of Oncology, The London Regional Cancer Centre, Ontario, N6A 4L6, Canada [A. F. C.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The expression of osteopontin (OPN), CD44 variants, and integrins has been correlated with tumorigenesis and metastasis. Here we show that these proteins cooperate to enhance cell motility. First, we demonstrate that several different CD44 variants bind to OPN in an arginine-glycine-aspartic acid-independent manner, but that the standard form of CD44 does not. These CD44 variants bind to both the amino- and COOH-terminal portions of OPN independently of the arginine-glycine-aspartic acid sequence, suggesting that multiple domains on OPN can be bound by the CD44 variants. Antibodies directed against the integrin ß1 subunit are able to inhibit this binding. The binding of CD44 variants to OPN is significantly augmented by both anti-CD44s and anti-CD44v antibodies. This augmentation by anti-CD44 antibodies is OPN specific and, again, can be blocked by anti-ß1 antibodies. Finally, we show that OPN binding by CD44 variants/ß1-containing integrins promotes cell spreading, motility, and chemotactic behavior.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OPN3 is a highly acidic calcium-binding glycosylated phosphoprotein secreted by many cell types, including osteoblasts, osteocytes, kidney tubules, metrial gland cells of the decidium and placenta, macrophages, activated T cells, and vascular smooth muscle cells (1) . OPN has been shown to support various functions including macrophage chemotaxis, cell attachment, and cell migration (1, 2, 3) . Recently, much interest has focused on the association of OPN with tumorigenesis and metastasis (4, 5, 6) . OPN contains an RGD tripeptide sequence that can be bound by {alpha}vß3, {alpha}vß1, and {alpha}vß5 integrins on the cell surface (7 , 8) . The binding of integrins to OPN through the interaction with the RGD sequence results in distinct functional consequences. For example, in vascular smooth muscle cells, {alpha}vß3, {alpha}vß1 and {alpha}vß5 integrins mediate cell adhesion, whereas only the {alpha}vß3 integrin supports cell migration (9) . The functional diversity of OPN can be also explained by the interaction of OPN with a cellular receptor(s) other than an {alpha}v-containing integrin. For example, the {alpha}9ß1 tenascin receptor is involved in the binding of human melanoma cells to the thrombin-cleaved amino-terminal half of human OPN (10) . Additionally, we have previously shown that both human and murine OPN have domains that do not contain the RGD sequence, but which can be bound by cell surface receptors (11) . Furthermore, it was recently demonstrated that OPN can interact with CD44 in an RGD-independent manner (12) .

CD44 has been implicated in a wide variety of cellular processes, including cell-cell and cell-matrix interactions, cell migration, metastasis, lymphocyte homing, and T cell activation (13, 14, 15) . CD44 is encoded by a total of 20 exons, 7 of which form the invariant extracellular domain of the standard form (CD44s). The variant exons (v1-v10) are alternatively spliced within this invariant extracellular domain (16) . The up-regulation of CD44 variant expression is associated with tumor progression in several tumor types (17) . Functional differences between the isoforms are emerging. For example, certain CD44 variants have been shown to up-regulate binding to hyaluronic acid and other glycosaminoglycans, and to promote CD44 oligomerization (18, 19, 20) . In addition to binding to glycosaminoglycans, CD44 has been shown to bind to a range of other ligands (17) . With regard to OPN binding, transfection of CD44v7-v10 into CD44-negative fibroblasts conferred on the transfected cells the ability to bind to OPN and HA, and this binding was clearly inhibited by exogenous OPN or HA (12) . The transfected fibroblasts bound to OPN in an RGD-independent manner. Furthermore, OPN was able to induce chemotaxis in the transfected cells. This chemotaxis was inhibited by antibodies against OPN and CD44, suggesting that OPN is involved in CD44-mediated cell migration (12) . However, the potential of different isoforms of CD44 to bind to OPN and induce chemotaxis has not been investigated.

Integrins compose one of the major families of adhesion receptors and the heterodimeric association of different {alpha} and ß subunits results in the formation of more than 20 integrin receptors. The different subunit combinations have remarkably different properties, being involved in processes as diverse as tissue development, angiogenesis, inflammation and the regulation of apoptosis (21) . Furthermore, changes in integrin subunit composition are critically involved in tumorigenesis and metastasis (22 , 23) . Integrin activity is regulated by intracellular signaling, which can convert low affinity forms into high affinity forms. On the other hand, binding of integrin to ligand can result in signal transduction, which regulates other molecules including cytoskeletal organization (24 , 25) .

We have previously reported that murine B16-F10 melanoma cells bound to OPN through interaction of the RGD tripeptide sequence within the OPN protein via {alpha}v-containing integrin, as did L929 fibroblasts. In contrast, OPN domains lacking the RGD sequence were shown to be involved in the binding of OPN with murine B16-BL6 melanoma cells (11) . However, the cellular receptors for the non-RGD-containing domains of OPN were not identified. In this study, we show that B16-BL6 but not B16-F10 or L929 cells express CD44 variants, and that CD44 variants but not CD44s can bind to OPN in an RGD-independent manner. Furthermore, the RGD-independent OPN binding by CD44 variants also requires ß1-containing integrins. The binding of CD44 variants to non-RGD-containing domains of OPN induces cell spreading and chemotactic behavior, a functional consequence that is not observed with the non-OPN binding CD44s.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Reagents.
Antibodies were prepared from culture supernatants from 1.1ASML and 5G8 hybridoma cells, which recognize an epitope encoded by rat CD44v6 and the peptide DGDSSMDPRG encoded by rat CD44 exon 15, respectively (18 , 26) . A monoclonal antibody that recognizes murine CD44v6 (9A4) was developed as described previously (27) and was used in this study. A monoclonal antibody that recognizes murine CD44s (IM7) was purchased from PharMingen (San Diego, CA). The synthetic peptides GRGDS and GRGES were purchased from Iwaki Glass Inc. (Tokyo, Japan). HMß1, which recognizes mouse and rat ß1 integrin (28) , and HMß3, which recognizes rat and mouse ß3 (29) , were used in this study. Human VN was purchased from Iwaki Glass Inc. Mouse antirat MHC class I monoclonal antibody (R4–8B1) was purchased from Seikagaku Kogyo (Tokyo, Japan).

Cell Lines.
The rat pancreatic carcinoma cell line BSp73AS clone 10AS (designated as AS) and derivatives of this cell line that have been transfected with pSVneo (designated as ASneo) or pSVneo together with rat CD44v4–7 (designated as ASv4-v7), rat CD44v1–10 (designated as ASv1-v10), or CD44s (designated as ASCD44N) have previously been described (30, 31, 32) . The rat BDX2 fibrosarcoma cell line and its derivatives transfected with either pRS-Vneo alone (BDX2neo) or with pRSVneo together with rat CD44v4–7, CD44v6,7, CD44v6, or CD44v7 (designated as BDX2CD44v4–7, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7, respectively) have been described previously (18 , 20) . AS and AS-derived transfectants were maintained in RPMI 1640, whereas BDX2 and its transfectants were maintained in DMEM containing 10% FCS in the presence or absence of 300 µg/ml G418. It should be noted that the CD44v4–7 expression plasmid used to make some of these cell lines lacks exon 15, which encodes the 5G8 epitope and is present in CD44s. All other expression constructs include exon 15. Murine malignant melanoma cells, B16-BL6 and B16-F10 cells, originally provided by Dr. I. J. Fidler (M. D. Anderson Cancer Center, Houston, TX), were maintained in the Institute of Immunological Science (Hokkaido, Japan; Ref. 33 ). The murine fibroblastic cell line L929 was also used in this study (11) . These murine cell lines were maintained in DMEM containing 10% FCS.

Construction of the GST-OPN Fusion Plasmid.
Oligonucleotides used in this study were synthesized based on the published murine OPN cDNA sequence (34) ; primer 1 (5'AAAGGATCCCCCTCCCGGTGAAAGTGACT 3') contains a BamHI restriction site and also encodes the first six amino acids of mature OPN. Primer 2 [5'TTTCCCGGGTCAGCCGTTGGGGACG (original T was replaced by G to create a SalI site because no amino acid substitution occurred as a result of this change) TCGACTGTAGG 3'] is complementary to the cDNA sequence encoding the eight amino acids before R128G129D130 and contains a stop codon with SmaI restriction site. Primer 3 (5'AAAGGATCCGCTTGGCTTATGGACTGAGG3') contains a BamHI restriction site and encodes the sequence of the six amino acids starting from L132. Primer 4 (5'TTTCCCGGGTTAGTTGACCTCAGAAGATGA3') is complementary to the cDNA sequence of the last six amino acids of mature OPN and contains a stop codon with SmaI restriction site. PCR reactions were conducted using full-length murine OPN cDNA as a template using an appropriate combination of the above two primers. PCR products were purified and cloned into pCRII vector as described previously (35) . The OPN cDNA cloned by PCR was completely sequenced and inserted into the pGEX-3X vector in the same reading frame as the carrier gene (glutathione S-Transferase, EC 2.5.1.18; Ref. 36 ) and transformed in Escherichia coli DH5{alpha} cells. Thus, three murine GST-OPN fusion proteins were produced: GST fused to full-length murine OPN(r-mOPN; L1-N278), the N-terminal half of mOPN lacking R128G129D130 (r-mN-half OPN; L1-G127), and the COOH-terminal half of mOPN lacking R128G129D130 (r-mC-half OPN; L132-N278). To make mutated OPN in which the RGD sequence is replaced with AAA (designated as AAA-OPN), we further synthesized primer 5, which is complementary to the cDNA sequence of the 14 amino acid (T121VDVPNGAAASLAY134) and which was engineered to contain a SalI restriction enzyme site: 5'ACAGTCGAC#GTCCCCAACGGCGCAGCTGCTAGCTTGGCATAT3' (the original T was substituted by C# to create a SalI site because no amino acid substitution occurred as a result of this change). A PCR reaction was conducted using the full-length mouse OPN cDNA as a template and was directed by primers 4 and 5. The PCR product was sequenced and digested with SalI and SmaI enzymes. The cDNA of mutated OPN (D123-N278) thus obtained was ligated with the r-mN-half OPN/pGEX-3X plasmid cleaved with SalI/SmaI restriction enzymes. Two additional mutated GST-OPN fusion plasmids [mutation of RGD to RGE (Arg-Gly-Glu) by a single base change, GAT (Asp) to GAG (Glu), designated as RGE-OPN, and deletion of the RGD sequence, designated as {Delta}RGD] were constructed as described previously (37) .

Protein Purification.
The various recombinant GST-OPN fusion proteins were prepared in E. coli as described previously, and GST fusion proteins were purified on glutathione-Sepharose columns as described (11 , 36) . The purity of the proteins was analyzed by SDS-PAGE and then stained with coomassie brilliant blue (Fig. 1)Citation .



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. SDS-PAGE analysis of purified OPN. Purified OPN was electrophoresed on SDS-polyacrylamide gels (4–20%) under reducing conditions. The gels were then stained with coomassie brilliant blue. Lane 1, molecular markers; Lane 2, wild-type GST-OPN; Lane 3, GST-N-half OPN; Lane 4, GST-C-half OPN; Lane 5, GST-{Delta}RGD-OPN; Lane 6, GST-RGE-OPN; Lane 7, GST-AAA-OPN; Lane 8, GST.

 
Cell Binding Assay.
The 96-well plates were precoated with various concentrations of GST, the different GST-OPN fusion proteins, or VN overnight at 4°C, followed by treatment with 0.5% BSA in PBS for 10 min at 37°C to block nonspecific binding. Cells were suspended in DMEM containing 0.25% BSA and 200 µl of cell suspension (at a cell density of 5 x 104 cells/well) were applied to 96-well plates precoated with VN, GST, or the various GST-OPN fusion proteins and incubated for 1 h at 37°C. The medium was removed from the plates, and all wells were washed twice with DMEM. The adherent cells were fixed and stained by 0.5% crystal violet in 20% methanol for 30 min. All wells were rinsed three times with water and adherent cells were then lysed with 20% acetic acid. The resulting supernatants from each well were analyzed by an immunoreader and the absorbance at 590 nm was measured to determine the relative number of cells adhered to wells. In some experiments, cell adhesion was expressed as a percentage of maximum binding to the precoated plates in the absence of synthetic peptides as an inhibitor. All assays were performed in triplicate and at least three independent experiments were performed. Each value represents the mean of at least three separate experiments.

Flow Cytometry.
Cells were incubated with a saturating amount of mAb for 30 min at 4°C. Cells were washed with PBS, then incubated with phycoerythrin-labeled antimouse k chain or FITC-labeled murine antirat k chain monoclonal antibody for 30 min at 4°C. After washing, cells were analyzed by using a fluorescence-activated cell sorter (Becton Dickinson, Mountain View, CA).

Cell Spreading Studies.
Cell spreading assays were performed as described by Guan and Hynes (38) . Briefly, plates were precoated with GST, GST-OPN, GST-N-half OPN, or GST-C-half OPN overnight at 4°C and then blocked with PBS containing 1% BSA. Cells (5 x 104) suspended in DMEM containing 0.25% BSA were added to each well at a volume of 200 µl/well. After incubation for 90 min at 37°C, all wells were washed twice with PBS, and photographs were taken. The photomicrographs are representatives of several independent experiments (magnification, x120).

Chemotactic Migration Assay.
The chemotactic migration of transfectants was measured by using ChemoTx 101–8 (Neuroprobe, Gaithersburg, MD) with polyvinylpyrrolidon-free polycarbonate filters (8.0-µm pore size). Log-phase cell cultures of transfectants were harvested with 1 mM EDTA in PBS, washed three times with serum-free DMEM, and resuspended to a final concentration of 2 x 106/ml in DMEM containing 0.1% BSA. Cell suspensions (25 µl) were added to the upper surface of the plate, and various concentrations of OPN proteins were added to the lower compartment. ChemoTx plates were incubated at 37°C in a 5% CO2 atmosphere. After a 12-h incubation, the filters were fixed with methanol, and stained with H&E. The cells on the upper surface of the filters were removed by wiping them with a cotton swab. The cells that had migrated to the lower surface were manually counted under a microscope, at a magnification of x400. To distinguish chemotactic activity from chemokinetic activity, checkerboard assays were also performed as described previously (39) . All samples were tested in six replicates, and data were expressed as the mean of the migrating cell number ± SD. A two-tailed Student’s t test was used to determine the significance of differences between experimental groups.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Ability of Cells to Bind to OPN Correlates with Their CD44 Variant Expression.
We have previously shown that B16-BL6 bind to OPN in an RDG-independent manner, but that the L929 and B16-F10 cell lines do not (11) . CD44 has been shown to mediate RGD-independent OPN binding (12) . We, therefore, investigated the expression pattern of CD44 on these cell lines to see whether this could account for their different OPN binding properties. Fig. 2Citation shows that B16-BL6, B16-F10, and L929 express CD44s. B16-BL6 expresses significant level of CD44v6, whereas B16-F10 expresses a very low level, if any, of CD44v6 and L929 does not express CD44v6. These data, therefore, suggest that CD44 variants rather than CD44s may be mediating the RGD-independent OPN binding.



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. The expression of CD44s and CD44v by murine cell lines. B16-BL6 cells with high spontaneous metastatic potential, B16-F10 cells with experimental metastatic potential, and nonmetastatic L929 cells were stained with antimurine CD44s (IM7) or antimurine CD44v6 (9A4) monolconal antibody, followed by FITC-labeled antirat k monoclonal antibody ( {blacksquare}{blacksquare}). Cells were also stained with FITC-labeled antirat k monoclonal antibody alone and were used as a negative control (—).

 
To determine whether CD44 variants rather than CD44s do indeed mediate RGD-independent OPN binding, we used transfected cell lines expressing defined CD44 variants and examined whether these cell lines could bind to the recombinant nonglycosylated, nonphosphorylated form of OPN. We have previously described transfected derivatives of the endogenously CD44s-expressing rat pancreatic carcinoma cell line BSp73AS (18 , 40) . These derivatives have been transfected either with resistance plasmid alone (ASneo), or together with expression plasmids encoding CD44v4-v7 (ASv4-v7), CD44v1-v10 (ASv1-v10) or CD44s (ASCD44N). Fig. 3ACitation shows that, as expected, Asneo and ASv4-v7 expressed similar levels of CD44s expression. The augmented expression of CD44s in ASv1-v10 is due to the inclusion of exon 15 in the CD44v1-v10 expression plasmid that encodes the 5G8 epitope (18) . BSp73ASneo and ASCD44N expressed insignificant amounts of the CD44v6 epitope, whereas Asv4-v7 and ASv1-v10 highly expressed the CD44v6 epitope. When these cell lines were investigated for their ability to bind to recombinant OPN, ASneo could not bind to OPN significantly, whereas the two cell lines expressing significant amounts of CD44 variants bound strongly to OPN (Fig. 3B)Citation . ASCD44N also did not significantly bind to OPN, excluding the possibility that the overexpression of CD44, per se, resulted in OPN binding. Thus, we conclude that CD44s does not bind to OPN in this system, although CD44 variants can mediate OPN binding.



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. The binding of AS cells to OPN. A, ASneo, ASv4-v7, ASv1-v10, and ASCD44N cells were stained with murine antirat CD44s (5G8; {blacksquare}{blacksquare}) or antirat CD44v6 (1.1ASML; - - -) monoclonal antibody, followed by PE-labeled rat antimouse k monoclonal antibody or by PE-labeled secondary antibody alone as a negative control (—) and analyzed by flow cytometry. B, the binding of various transfectants to GST-OPN ({square}) or GST ({diamond}) was studied. Plates were coated with the indicated concentrations of proteins, overnight at 4°C. The cell binding was quantitated as described in "Materials and Methods."

 
To more precisely define which variant exons contribute to OPN binding, and to demonstrate that the differential binding of OPN by CD44s and CD44v is not limited to BSp73AS cells, we examined the OPN-binding properties of derivatives of the rat fibrosarcoma BDX2 cell line (18 , 20) . These cell lines are stably transfected either with the resistance plasmid alone or together with CD44v4-v7, CD44v6, CD44v6,7, or CD44v7. BDX2CD44v4-v7, BDX2CD44v6,7, and BDX2CD44v6 exhibited augmented levels of both CD44s and v6 epitopes on their surface (Fig. 4A)Citation . Again, the augmented expression of CD44s is due to the inclusion of exon 15 in the CD44v6,7, CD44v6, and CD44v7 expression plasmids (20) . It should be noted that although no antirat CD44v7 antibodies are available to demonstrate the v7 epitope on BDX2CD44v7 in fluorescence-activated cell sorter analysis, we have previously shown by Western blotting that the BDX2v7 cell line does, indeed, express the transfected CD44v7 protein (20) . Whereas ASneo cells expressed very little CD44v and failed to bind to OPN (Fig. 3)Citation , BDX2neo expressed moderate levels of endogenous CD44v and bound to OPN moderately (Fig. 4B)Citation . Strikingly, BDX2CD44v4-v7, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 exhibited augmented binding to OPN as compared with that of BDX2neo (Fig. 4B)Citation . We conclude that in cells of widely differing origin, CD44 variants but not CD44s can mediate OPN binding. This effect seems not to be specific for one exon or group of exons as inclusion of v6 alone or v7 alone into CD44 results in OPN binding.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. The binding of BDX2 cells to OPN. A, BDX2neo, BDX2CD44v4-v7, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells were stained with murine antirat CD44s (5G8; {blacksquare}{blacksquare}) or antirat CD44v6 (1.1ASML; - - -) monoclonal antibody followed by PE-labeled rat antimouse k monoclonal antibody or by PE-labeled secondary antibody alone as a negative control (—) and analyzed by flow cytometry. B, the binding of various transfectants to GST-OPN ({square}) or GST ({diamond}) was studied. Plates were coated with the indicated concentrations of proteins, overnight at 4°C. The cell binding was quantitated as described in "Materials and Methods."

 
Binding of CD44v Transfectants to OPN is RGD-independent.
It is well established that cell surface {alpha}v integrin receptors are able to bind to the RGD sequence within OPN. To exclude the involvement of {alpha}v integrin in the binding to OPN to the surface of the BDX2 transfectants, we examined the ability of these transfectants to bind to OPN in the presence of exogenous GRGDS synthetic peptides. As shown in Fig. 5Citation , the binding of BDX2neo to both OPN and another RGD-containing extracellular matrix protein, VN, was almost completely inhibited by GRGDS, but not by GRGES synthetic peptides. Thus, BDX2neo, which expresses moderate amounts of endogenous CD44v and CD44s, binds to OPN in an RGD-dependent manner. In contrast, the binding of BDX2CD44v6,7 cells to OPN was RGD-independent, whereas the binding to VN was completely RGD-dependent. Although the binding was reduced, BDX2CD44v6 and BDX2CD44v7 cells were still able to bind to OPN even in the presence of excess amounts (250 µg/ml) of GRGDS synthetic peptides where the binding of BDX2neo was completely inhibited.



View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. The binding of CD44v transfectants to OPN in an RGD-independent manner. The binding of BDX2neo, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells to plates precoated with 2 µg/ml GST-OPN or 2 µg/ml VN was studied in the presence of various concentrations of GRGDS or GRGES synthetic peptides. Maximum binding of various transfectants, as measured by the absorbance (A590 nm) to GST-OPN or VN, was as follows: BDX2neo, 0.292 and 0.55; BDX2CD44v6,7, 1.156 and 0.910; BDX2CD44v6, 0.936 and 1.070; BDX2CD44v7, 1.134 and 0.813; respectively. {square}, GRGDS; {blacksquare}, GRGES.

 
To extend these observations, we also examined the binding ability of CD44v transfectants to recombinant COOH-terminal and amino-terminal halves of OPN that lack the RGD sequence. The binding of BDX2neo cells to full-length OPN as well as the RGD-deficient COOH- and amino-terminal halves of OPN was weak. In contrast, BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells bound to both full-length OPN and to the COOH-terminal and amino-terminal halves of OPN (Fig. 6)Citation . To exclude the possibility that the truncated forms of OPN undergo conformational changes that could result in unexpected binding patterns, we prepared mutated full-length OPN in which the RGD sequence was mutated to RGE (RGE-OPN) or to AAA (AAA-OPN). The binding of the BDX2 transfectants to RGE- and AAA-OPN in the presence of excess amounts of GRGDS peptide was then analyzed. BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells bound to both RGE-OPN and AAA-OPN even in the presence of excess amounts of GRGDS peptides, again demonstrating that CD44v-mediated OPN binding is RGD-independent (data not shown).



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. The binding of CD44v transfectants to truncated forms of OPN. The binding of various transfectants to plates precoated with the indicated concentrations of full-length GST-OPN (OPN), GST-N-half OPN (N-half OPN), GST-C-half OPN (C-half OPN), or GST was studied. The cell binding was quantitated as described in "Materials and Methods."

 
RGD-independent CD44v-mediated OPN Binding Involves the ß1 Integrin.
It has been reported that when OPN is cleaved by thrombin, a crytic epitope is exposed within the amino-terminal half of human OPN, and that this epitope is recognized by the tenascin receptor {alpha}9ß1 (10) . To exclude the possibility that this integrin may be responsible for the CD44v-mediated, RGD-independent OPN binding, we included saturating amounts of anti-ß1 as well as anti-ß3 monoclonal antibodies in OPN cell binding assays. Surprisingly, the anti-ß1 integrin monoclonal antibody almost completely inhibited the binding of BDX2CD44v6,7, BDX2CD44v6, and BDX2CD44v7 cells to both the amino- and COOH-terminal halves of OPN (Fig. 7)Citation . However, the binding of BDX2CD44v6,7 and BDX2CD44v6 cells to full-length OPN was not significantly blocked by anti-ß1 antibody. The binding of BDX2CD44v7 cells to full-length OPN was reduced by anti-ß1 antibody, but still significant level of cell binding was detected. Anti-ß3 antibody failed to interfere with the cell binding to any form of OPN tested. These data suggested that ß1 integrin contributes to the RGD-independent OPN binding mediated by CD44 variants. An explanation for this finding would be that the transfected CD44 variants triggered up-regulation of the ß1 integrin, which in turn mediated the RGD-independent OPN binding. We, therefore, checked the levels of ß1 integrin on the BDX2 transfectants. However, ß1 integrin is expressed at equivalent levels on all of the BDX2 cell lines tested (data not shown).



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. The binding of various transfectants to plates precoated with 2 µg/ml OPN (1), 10 µg/ml N-half OPN (2), or 10 µg/ml C-half OPN (3) in the presence of PBS, affinity purified 100 µg/ml anti-ß1 (HMß1) or affinity purified 100 µg/ml anti-ß3 (HMß3). The cell binding was quantitated as described in "Materials and Methods."

 
Anti-CD44 Antibodies Induce Enhanced RGD-independent Cell Binding to OPN, Which is Blocked by Anti-ß1 Integrin Antibodies.
To determine whether CD44 variants actively bind to OPN RGD independently, or whether they somehow augment ß1 integrin binding to OPN RGD independently, we examined whether the binding of the BDX2 CD44 variant transfectants to OPN lacking RGD sequence could be inhibited by monoclonal antibodies directed against CD44. Pretreatment of the transfectants with either anti-CD44s or anti-CD44v6 antibodies resulted in augmented binding to the RGD-deleted, amino-terminal and COOH-terminal halves of OPN (Fig. 8A)Citation . Treatment of the cells with a control antibody did not induce augmented cell binding to RGD-deleted OPN. In contrast, the binding to another RGD-containing extracellular matrix protein, VN was not augmented by anti-CD44 antibody treatment, indicating that CD44-mediated augmentation of cell binding is specific for OPN. We then examined whether the CD44 antibody-mediated augmentation of cell binding to OPN lacking the RGD sequence can be inhibited by monoclonal antibodies directed against either ß1 or ß3 integrin subunit. As shown in Fig. 8BCitation , the cell binding to both the amino-terminal half and the COOH-terminal half of OPN was significantly inhibited by the anti-ßl antibody. The treatment of the cells with the anti-CD44 antibodies did not up-regulate the expression of ß1 integrin (data not shown). We conclude that CD44 variants and ß1 integrin cooperate to bind to OPN in a RGD-independent manner.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. The augmentation of cell binding to OPN by anti-CD44 monoclonal antibody. A, BDX2CD44v7 cells were pretreated with PBS or 100 µg/ml anti-CD44v6 (1.1ASML), anti-CD44s (5G8) or antirat MHC class I (R4–8B1) monoclonal antibody for 30 min at 4°C. After washing, cells were added to the plates precoated with 10 µg/ml {Delta}RGD-OPN (1), 10 µg/ml N-half OPN (2), 10 µg/ml C-half OPN (3), or 2 µg/ml VN (4). B, the anti-CD44 monoclonal antibody treated (1.1ASML or 5G8; 10 µg/ml) or PBS-treated cells were added to the plates precoated with 10 µg/ml N-half OPN or 10 µg/ml C-half OPN, as described above, in the presence or absence of affinity purified 100 µg/ml monoclonal antibody reacting to ß1 (HMß1) or ß3 (HMß3) integrin. The cell binding was quantitated as described in "Materials and Methods."

 
RGD-independent OPN Binding Promotes Cell Motility.
To gain an insight into the functional role of the RGD-independent OPN binding mediated by CD44 variants and ß1 integrin, we examined the effect of RGD-deleted OPN on the BDX2 transfectants in tissue culture. The binding of cells to truncated forms of OPN resulted in cell spreading, but less efficiently than to intact OPN (data not shown). We also examined whether OPN was able to induce chemotaxis of the BDX2 transfectants. Full-length OPN, RGD-deleted OPN and the COOH-terminal half of OPN induced migration of BDX2CD44v7 in a dose-dependent manner (Fig. 9A)Citation . The N-terminal half of OPN failed to induce statistically significant migration of CD44v transfectants. Similar results were obtained with the other CD44v transfectants (data not shown). In contrast, none of the OPN proteins induced migration of BDX2neo. Furthermore, the migration of BDX2CD44v7 cells induced by full-length OPN and COOH-terminal half of OPN was almost completely inhibited by anti-ß1 integrin antibody (Fig. 9B)Citation . We performed checkerboard analyses that showed that the migration of CD44v transfectants to OPN was chemotactic (Table 1)Citation . We conclude that CD44 variants and ß1 integrin cooperate to allow cells to bind to OPN in an RGD-independent manner and thereby promote cell motility and chemotaxis.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. The migration of BDX2CD44v transfectants induced by OPN in an RGD-independent manner. BDX2neo and BDX2CD44v7 cells were tested for their migration activity against indicated concentrations of full-length GST-OPN (OPN), GST-N-half OPN (N-half OPN), GST-C-half OPN (C-half OPN), {Delta}RGD-OPN ({Delta}RGD), or GST in the absence (A) or presence (B) of affinity purified 10 µg/ml antibodies reacting to ß1 integrin (HMß1), ß3 integrin (HMß3), or rat MHC class I (R4–8B1). B, number of cells migrating toward OPN and C-half OPN without antibody treatment was expressed as 100%. The percentage of migration = number of migrating cells in the absence of antibody/number of migrating cells in the presence of antibody x 100. The data are representative of several independent experiments. {blacksquare} 0.1 ng/ml; ng/ml; 10 ng/ml.

 

View this table:
[in this window]
[in a new window]

 
Table 1 OPN induces chemotaxis of CD44v transfectantsa

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The up-regulated expression of both OPN and CD44 variants correlates with tumorigenesis and metastatic progression in many types of tumor (4, 5, 6 , 17) . Although it has been shown that CD44 variant expression promotes metastasis formation, HA (a well known CD44 ligand) binding by CD44v-expressing tumor cells is not rate limiting for metastasis, and contact of the CD44 variant protein with a ligand other than HA is required for metastasis to occur (18) . Intriguingly, CD44 is able to bind to OPN in an RGD-independent manner (12) . Parameters that permit CD44 to bind to OPN in an RGD-independent manner have until now remained unresolved. Here we report two important new findings. First, CD44 variants, but not CD44s, bind to OPN. Second, this binding is dependent on ß1 integrin. Furthermore, CD44-mediated OPN binding leads to enhanced cell motility and chemotactic behavior. These data have significant ramifications for the interpretation of why OPN and CD44 variant expression is associated with the progression of tumor cells to metastatic competence.

At first sight, the binding of CD44 variants to OPN is not limited to sequences encoded by individual CD44v exons or a group of exons. For example, both the BDX2CD44v6 and BDX2CD44v7 were able to bind to OPN. However, the BDX2CD44v7 cells express some CD44v6 endogenously (Fig. 4)Citation . This presumably explains the stimulatory effect of the 1.1AMSL (anti-CD44v6) antibody on OPN binding observed with BDX2CD44v7 cells in Fig. 8Citation . Thus, we cannot at present definitely determine the relative contributions of CD44v6 and CD44v7 to the binding of OPN by BDX2CD44v7 cells. Assuming that CD44v7 can bind to OPN, these data would suggest that the incorporation of variant exons may change the secondary structure of the CD44 protein to reveal OPN binding sites.

A major finding of this study is that CD44-mediated OPN binding requires the ß1 integrin subunit. OPN must contain multiple CD44/ß1 binding sites, as both the amino- and COOH-terminal portions of OPN lacking an RGD sequence were bound by CD44 variants in a ß1-dependent manner. It is known that the {alpha}9ß1 tenascin receptor is involved in the binding of human melanoma cells to the amino-terminal, but not the COOH-terminal half of human OPN (10) . It will, therefore, be important to determine what kind of integrin {alpha} chain heterodimerizes with ß1 in the CD44v transfectants used in this study. One possibility is that the transfectants express both {alpha}9ß1 integrin, which mediates cell binding to the amino-terminal half of OPN, and an integrin consisting of an undetermined {alpha} chain together with ß1, which mediates binding to the COOH-terminal half of OPN. Alternatively, another {alpha} subunit may participate with ß1 in the binding to the amino-terminal half of OPN.

How might CD44 variants and ß1-containing integrins cooperate to bind to OPN? Two hypotheses are plausible. In the first, either CD44 variants or ß1-containing integrins bind directly to OPN, whereas the non-OPN-binding partner regulates OPN binding via intracellular signaling. Thus, in the scenario that ß1-containing integrins regulate CD44v-mediated OPN binding, anti-ß1 antibodies would cause transduction of intracellular signals by cross-coupling ß1, which would down-regulate CD44-mediated OPN binding. In the opposite case where CD44 regulates OPN binding by ß1, signal transduction via CD44 would activate preexisting ß1 to bind OPN, because expression of CD44 variants, per se, does not result in the up-regulation of ß1 (data not shown), nor does the potentially signal-transducing cross-coupling of CD44 by anti-CD44 antibodies (data not shown). The alternative hypothesis to explain the effects of ectopic CD44 variant expression and anti-CD44 and anti-ß1 antibodies on OPN binding is that CD44 variants and ß1-containing integrins bind cooperatively to OPN. Thus, transfection of cells expressing ß1-containing integrin endogenously with CD44 variants would permit a ternary complex to form between CD44v, ß1-containing integrin and OPN. The anti-CD44 antibodies would stimulate clustering of CD44 and thereby potentiate the formation of the ternary complex, whereas the anti-ß1 antibody would inhibit OPN binding by sterically hindering the formation of the ternary complex. Support for this latter hypothesis comes from the observation that the clustering of CD44 promote its binding to HA (2 , 19 , 41) .

The striking consequence of CD44 variant-mediated OPN binding is to increase cell motility and to promote chemotactic behavior (Fig. 9)Citation . Both OPN and CD44 variant expression is associated with tumorigeneis and metastatic progression, and these OPN-mediated events are likely to contribute to the function of CD44 variants during tumor progression and metastasis. Thus, OPN binding via CD44 variants and ß1-containing integrins would serve to promote metastasis by increasing the motility of the tumor cells, permitting them to migrate away from the primary tumor and to colonize distant sites. Furthermore, changes in the subunit composition of the integrin family of cell surface adhesion molecules during tumor progression play an important role in the metastatic cascade, as these changes alter the range of ligands bound by the integrin heterodimers (22 , 23) . The involvement of ß1-containing integrins in the OPN-induced enhancement of motility, we report here, adds a new dimension to how these subunit changes can promote metastatic spread. Moreover, OPN binding resulted in cell spreading, which requires reorganization of cytoskeleton, and the ß1-containing integrin involvement in OPN binding may also contribute to the cytoskeletal changes necessary for the cell spreading we observed, as ß1-containing integrins are known to regulate cytoskeletal components (24 , 25) .

We note with interest that the disruption of CD44 variant/ß1-containing integrin binding to OPN is likely to interfere with the metastatic spread of tumors and, therefore, constitutes a novel target for therapeutic intervention. In conclusion, our finding that CD44 variants and ß1-containing integrins cooperate to bind to OPN and thereby promote cell motility functionally connects three molecules that have been implicated in tumor metastasis, and provides a fascinating insight into how they function to permit the spread of tumors.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by a Grant-in-Aid from Sagawa Cancer Research Foundation; the Ministry of Education, Science, and Culture of Japan Grant 10557024 (to T. U.); and by Grant 8426 from the National Cancer Institute of Canada (to A. F. C). J. P. S. was supported by a European Union Marie Curie Fellowship. Back

2 To whom requests for reprints should be addressed, at Institute of Immunological Science, Hokkaido University, Kita-15, Nishi-7, Kita-ku, Sapporo, 0600815, Japan. Phone and Fax: 85-11-736-9836; E-mail: toshi{at}imm.hokudai.ac.jp Back

3 The abbreviations used are: OPN, osteopontin; CD44s, standard form of CD44; CD44v, variant form of CD44; GST, glutathione S-transferase, EC2.5.1.18; GRGDS, glycine-arginine-glycine-aspartic acid-cysteine; GRGES, glycine-arginine-glycine-glutamine-cysteine; HA, hyaluronic acid; RGD, arginine-glycine-aspartic acid; VN, vitronectin; PE, phycoerythrin. Back

Received 6/23/98. Accepted 10/28/98.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Denhardt D. T., Guo X. Osteopontin: a protein with diverse functions. FASEB J., 7: 1475-1482, 1993.[Abstract]
  2. Behrend E. I., Craig A. M., Wilson S. M., Denhardt D., Chambers A. F. Reduced malignancy of ras-transformed NIH 3T3 cells expressing antisense osteopontin RNA. Cancer Res., 54: 832-837, 1994.[Abstract/Free Full Text]
  3. Patarca R., Saavedra R. A., Cantor H. Molecular and cellular basis of genetic resistance to bacterial infection: the role of the early T-lymphocyte activation-1/osteopontin gene. Crit. Rev. Immunol., 13: 225-246, 1993.[Medline]
  4. Oates A. J., Barraclough R., Rudland P. S. The role of osteopontin in tumorigenesis and metastasis. Invasion Metastasis, 17: 1-15, 1997.[Medline]
  5. Singhal H., Bautista D. S., Tonkin K. S., O’Malley F. P., Tuck A. B., Chambers A. F., Harris J. F. Elevated plasma osteopontin in metastatic breast cancer associated with increased tumor burden and decreased survival. Clin. Cancer Res., 3: 605-611, 1997.[Abstract]
  6. Tuck A. B., O’Malley F. P., Singhal H., Tonkin K. S., Harris J. F., Bautista D., Chambers A. F. Osteopontin (OPN) and p53 expression are associated with tumor progression in a case of synthronous, bilateral, invasive mammary carcinomas. Arch. Pathol. Lab. Med., 121: 578-584, 1997.[Medline]
  7. Helfrich M. H., Nesbitt S. A., Dorey E. L., Horton M. A. Rat osteoblasts adhere to a wide range of RGD (Arg-Gly-Asp) peptide-containing proteins, including the bone sialoproteins and fibronectin, via a ß 3 integrin. J. Bone Miner. Res., 7: 335-343, 1994.
  8. Hu D. D., Lin E. C. K., Kovach N. L., Hoyer J. R., Smith J. W. A biochemical characterization of the binding of osteopontin to integrin {alpha}vß3, {alpha}vß1 and {alpha}vß5. J. Biol. Chem., 270: 2632-2638, 1995.
  9. Liaw L., Skinner M. P., Ranies E. W., Ross R., Cheresh D. A., Schwartz S. M., Giachelli C. M. The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins: role of {alpha}vß3 in smooth muscle migration to osteopontin in vitro. J. Clin. Invest., 95: 713-724, 1995.
  10. Smith L. L., Cheung H-K., Ling L. E., Chen J., Sheppard D., Pytela R., Giachelli C. M. Osteopontin N-terminal domain contains a cryptic adhesive sequence recognized by {alpha}9ß1 integrin. J. Biol. Chem., 271: 28485-28491, 1996.[Abstract/Free Full Text]
  11. Katagiri Y., Murakami M., Mori K., Iizuka J., Hara T., Tanaka K., Jia W-J., Chambers A. F., Uede T. 1996. Non-RGD domains of osteopontin promote cell adhesion without involving {alpha}v integrins. J. Cell. Biochem., 62: 123-131, 1996.[Medline]
  12. Weber G. F., Ashkar S., Glimcher M. J., Cantor H. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science (Washington DC), 271: 509-512, 1996.[Abstract]
  13. Herrlich P., Zoller M., Pals S. T., Ponta H. CD44 splice variants: metastasis meet lymphocytes. Immunol. Today, 14: 395-399, 1993.[Medline]
  14. Knudson C. B., Knudson W. Hyaluronan-binding protein in development, tissue homeostasis, and disease. FASEB J., 7: 1233-1241, 1993.[Abstract]
  15. Lesley J., Hyman R., Kincade P. W. CD44 and its interaction with the cellular matrix. Adv. Immunol., 54: 271-335, 1993.[Medline]
  16. Screaton G. R., Bell M. V., Jackson D. G., Cornelis F. B., Gerth U., Bell J. I. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc. Natl. Acad. Sci. USA, 89: 12160-12164, 1992.[Abstract/Free Full Text]
  17. Naot D., Sionov R. V., Ish-Scalom D. CD44: structure, function and association with the malignant process. Adv. Cancer Res., 71: 241-319, 1997.[Medline]
  18. Sleeman J. P., Arming S., Moll J. F., Hekele A., Rudy W., Sherman L. S., Kreil G., Ponta H., Herrlich P. Hyaluronate-independent metastatic behavior of CD44 variant-expressing pancreatic carcinoma cells. Cancer Res., 56: 3134-3141, 1996.[Abstract/Free Full Text]
  19. Sleeman J. P., Ruddy W., Hofmann M., Moll J., Herrlich P., Ponta H. Regulated clustering of variant CD44 proteins increases their hyaluonate binding capacity. J. Cell Biol., 135: 1139-1150, 1996.[Abstract/Free Full Text]
  20. Sleeman J. P., Kondo K., Moll J., Ponta H., Herrlich P. Variant exons v6 and v7 together expand the repertoire of glycosamino glycans bound by CD44. J. Biol. Chem., 272: 31837-31844, 1997.[Abstract/Free Full Text]
  21. Gille J., Swerlick R. A. Integrins: role in cell adhesion and communication. Ann. NY Acad. Sci., 797: 93-106, 1996.[Medline]
  22. Imhof B. A., Piali L., Gisler R. H., Dunon D. 1996 Involvement of {alpha} 6 and {alpha} v integrins in metastasis. Curr. Top. Microbiol. Immunol., 213: 195-203, 1996.
  23. Varner J. A., Cheresh D. A. Integrins and cancer. Curr. Opin. Cell Biol., 8: 724-730, 1996.[Medline]
  24. Dedhar S., Hannigan G. E. Integrin cytoplasmic interactions and bidirectional transmembrane signalling. Curr. Opin. Cell Biol., 8: 657-669, 1996.[Medline]
  25. Humphreis M. J. Integrin activation: the link between ligand binding and signal transduction. Curr. Opin. Cell Biol., 8: 632-640, 1996.[Medline]
  26. Matsku S., Wenzel A., Liu S., Zoller A. Antigenic differences between metastatic and nonmetastatic BSp73 rat tumor variants characterized by monoclonal antibodies. Cancer Res., 49: 1294-1299, 1989.[Abstract/Free Full Text]
  27. Weiss J. M., Sleeman J. P., Renkl A. C., Dittmar H., Termeer C. C., Taxis S., Howells N., Hofmann M., Kohler G., Schopf E., Ponta H., Herrlich P., Simon J. C. An essential role for CD44 variant isoforms in epidermal Langerhans cell and blood dendritic cell function. J. Cell Biol., 5: 1137-1147, 1997.
  28. Noto K., Kato K., Okumura K., Yagita H. Identification and functional characterization of mouse CD29 with a mAb. Int. Immunol., 7: 835-842, 1995.[Abstract/Free Full Text]
  29. Yasuda M., Hsunuma Y., Adachi H., Sekino C., Sakanishi T., Hashimoto H., Ra C., Yagita H., Okumura K. Expression and function of fibronectin binding integrins on rat mast cells. Int. Immunol., 7: 251-258, 1995.[Abstract/Free Full Text]
  30. Hudson D. L., Sleeman J. P., Watt F. M. CD44 is the major peanut lectin-binding glycoprotein of human epidermal keratinocytes and plays a role in intercellular adhesion. J. Cell Sci., 108: 1959-1970, 1995.[Abstract]
  31. Rudy W., Hofmann M., Schwartz-Albiez R., Zoller M., Heider K. H., Ponta H., Herrlich P. The two major CD44 proteins expressed on a metastatic rat tumor cell line are derived from different splice variants: each one individually suffices to confer metastatic behavior. Cancer Res., 53: 1262-1268, 1993.[Abstract/Free Full Text]
  32. Seiter S., Arch R., Reber S., Komitowski D., Hofmann M., Ponta H., Herrlich P., Matzku S., Zoller M. Prevention of tumor metastasis formation by anti-variant CD44. J. Exp. Med., 177: 1443-1445, 1993.
  33. Matsumoto Y., Saiki I., Murota J., Okuyama H., Tamura M., Azuma I. Recombinant human granulocyte colony-stimulating factor inhibits the metastasis of hematogenous and non-hematogenous tumors in mice. Int. J. Cancer, 49: 444-449, 1991.[Medline]
  34. Craig A. M., Smith J. H., Denhardt D. T. Osteopontin, a transformation-associated cell adhesion phosphoprotein, is induced by 12–0-tetradecanoylphorbol 13 acetate in mouse epidermis. J. Biol. Chem., 264: 9682-9689, 1989.[Abstract/Free Full Text]
  35. Staar L., Quaranta V. An efficient and reliable method for cloning PCR-amplification products: a survey of point mutations in integrin cDNA. Biotechniques, 13: 612-618, 1992.[Medline]
  36. Smith D. B., Johnson K. S. Single step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene, 67: 31-40, 1988.[Medline]
  37. Xuan J-W., Hota C., Shigeyama Y., D’Errico J. A., Somerman M. J., Chambers A. F. Site-directed mutagenesis of the arginine-glycine-aspartic acid sequence in osteopontin destroys cell adhesion and migration functions. J. Cell. Biochem., 56: 1-11, 1994.[Medline]
  38. Guan J. L., Hynes R. O. Lymphoid cells recognize an alternatively spliced segment of fibronectin via the integrin receptor {alpha}4ß7. Cell, 60: 53-61, 1990.[Medline]
  39. Yamaki T., Uede T., Shijubo N., Kikuchi K. Functional analysis of mononuclear cells infiltrating into tumors. III. Soluble factors involved in the regulation of T lymphocyte infiltration into tumors. J. Immunol., 140: 4388-4396, 1988.[Abstract]
  40. Gunthert U., Hottmann M., Rudy W., Reber S., Zoller M., Haussmann I., Mastzku S., Wenzel A., Ponta H., Herrlich P. A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell, 65: 13-24, 1991.[Medline]
  41. Perschl A., Lesley J., English N., Trowbridge I., Hyman R. Role of CD44 cytoplasmic domain in hyaluronan binding. Eur. J. Immunol., 25: 495-501, 1995.[Medline]



This article has been cited by other articles:


Home page
Biol. Reprod.Home page
D. W. Erikson, R. C. Burghardt, K. J. Bayless, and G. A. Johnson
Secreted Phosphoprotein 1 (SPP1, Osteopontin) Binds to Integrin Alphavbeta6 on Porcine Trophectoderm Cells and Integrin Alphavbeta3 on Uterine Luminal Epithelial Cells, and Promotes Trophectoderm Cell Adhesion and Migration
Biol Reprod, November 1, 2009; 81(5): 814 - 825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Das, L. G. Harris, B. J. Metge, S. Liu, A. I. Riker, R. S. Samant, and L. A. Shevde
The Hedgehog Pathway Transcription Factor GLI1 Promotes Malignant Behavior of Cancer Cells by Up-regulating Osteopontin
J. Biol. Chem., August 21, 2009; 284(34): 22888 - 22897.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
I. Snitcovsky, G. M. Leitao, F. S. Pasini, K. C. S. Brunialti, F. R. R. Mangone, S. Maistro, G. de Castro Jr, R. C. Villar, and M. H. H. Federico
Plasma Osteopontin Levels in Patients With Head and Neck Cancer Undergoing Chemoradiotherapy
Arch Otolaryngol Head Neck Surg, August 1, 2009; 135(8): 807 - 811.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Schack, R. Stapulionis, B. Christensen, E. Kofod-Olsen, U. B. Skov Sorensen, T. Vorup-Jensen, E. S. Sorensen, and P. Hollsberg
Osteopontin Enhances Phagocytosis through a Novel Osteopontin Receptor, the {alpha}X{beta}2 Integrin
J. Immunol., June 1, 2009; 182(11): 6943 - 6950.
[Abstract] [Full Text] [PDF]


Home page
The OncologistHome page
G.-H. Yang, J. Fan, Y. Xu, S.-J. Qiu, X.-R. Yang, G.-M. Shi, B. Wu, Z. Dai, Y.-K. Liu, Z.-Y. Tang, et al.
Osteopontin Combined with CD44, a Novel Prognostic Biomarker for Patients with Hepatocellular Carcinoma Undergoing Curative Resection
Oncologist, November 1, 2008; 13(11): 1155 - 1165.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
P. C. Mack, M. W. Redman, K. Chansky, S. K. Williamson, N. C. Farneth, P. N. Lara Jr, W. A. Franklin, Q.-T. Le, J. J. Crowley, and D. R. Gandara
Lower Osteopontin Plasma Levels Are Associated With Superior Outcomes in Advanced Non-Small-Cell Lung Cancer Patients Receiving Platinum-Based Chemotherapy: SWOG Study S0003
J. Clin. Oncol., October 10, 2008; 26(29): 4771 - 4776.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Ono, K. Nakashima, S. R. Rittling, E. Schipani, T. Hayata, K. Soma, D. T. Denhardt, H. M. Kronenberg, Y. Ezura, and M. Noda
Osteopontin Negatively Regulates Parathyroid Hormone Receptor Signaling in Osteoblasts
J. Biol. Chem., July 11, 2008; 283(28): 19400 - 19409.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-A. Kang, Y. Zhou, T. L. Weis, H. Liu, J. Ulaszek, N. Satgurunathan, L. Zhou, K. van Besien, J. Crispino, A. Verma, et al.
Osteopontin Regulates Actin Cytoskeleton and Contributes to Cell Proliferation in Primary Erythroblasts
J. Biol. Chem., March 14, 2008; 283(11): 6997 - 7006.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Vachon, R. Martin, V. Kwok, V. Cherepanov, C.-W. Chow, C. M. Doerschuk, J. Plumb, S. Grinstein, and G. P. Downey
CD44-mediated phagocytosis induces inside-out activation of complement receptor-3 in murine macrophages
Blood, December 15, 2007; 110(13): 4492 - 4502.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Pacheco-Rodriguez, W. K. Steagall, D. M. Crooks, L. A. Stevens, H. Hashimoto, S. Li, J.-a. Wang, T. N. Darling, and J. Moss
TSC2 Loss in Lymphangioleiomyomatosis Cells Correlated with Expression of CD44v6, a Molecular Determinant of Metastasis
Cancer Res., November 1, 2007; 67(21): 10573 - 10581.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Leali, E. Moroni, F. Bussolino, and M. Presta
Osteopontin Overexpression Inhibits in Vitro Re-endothelialization via Integrin Engagement
J. Biol. Chem., July 6, 2007; 282(27): 19676 - 19684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Christensen, C. C. Kazanecki, T. E. Petersen, S. R. Rittling, D. T. Denhardt, and E. S. Sorensen
Cell Type-specific Post-translational Modifications of Mouse Osteopontin Are Associated with Different Adhesive Properties
J. Biol. Chem., July 6, 2007; 282(27): 19463 - 19472.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Zoller, P. Gupta, R. Marhaba, M. Vitacolonna, and P. Freyschmidt-Paul
Anti-CD44-mediated blockade of leukocyte migration in skin-associated immune diseases
J. Leukoc. Biol., July 1, 2007; 82(1): 57 - 71.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
L. R. Rodrigues, J. A. Teixeira, F. L. Schmitt, M. Paulsson, and H. Lindmark-Mansson
The Role of Osteopontin in Tumor Progression and Metastasis in Breast Cancer
Cancer Epidemiol. Biomarkers Prev., June 1, 2007; 16(6): 1087 - 1097.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. H. Burdo, M. R. Wood, and H. S. Fox
Osteopontin prevents monocyte recirculation and apoptosis
J. Leukoc. Biol., June 1, 2007; 81(6): 1504 - 1511.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
D. W Erikson, A. L Way, D. A Chapman, and G. J Killian
Detection of osteopontin on Holstein bull spermatozoa, in cauda epididymal fluid and testis homogenates, and its potential role in bovine fertilization
Reproduction, May 1, 2007; 133(5): 909 - 917.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-L. Lee, M.-J. Wang, P.-R. Sudhir, G.-D. Chen, C.-W. Chi, and J.-Y. Chen
Osteopontin Promotes Integrin Activation through Outside-In and Inside-Out Mechanisms: OPN-CD44V Interaction Enhances Survival in Gastrointestinal Cancer Cells
Cancer Res., March 1, 2007; 67(5): 2089 - 2097.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Y. Wai, Z. Mi, C. Gao, H. Guo, C. Marroquin, and P. C. Kuo
Ets-1 and Runx2 Regulate Transcription of a Metastatic Gene, Osteopontin, in Murine Colorectal Cancer Cells
J. Biol. Chem., July 14, 2006; 281(28): 18973 - 18982.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. L. Allan, R. George, S. A. Vantyghem, M. W. Lee, N. C. Hodgson, C. J. Engel, R. L. Holliday, D. P. Girvan, L. A. Scott, C. O. Postenka, et al.
Role of the Integrin-Binding Protein Osteopontin in Lymphatic Metastasis of Breast Cancer
Am. J. Pathol., July 1, 2006; 169(1): 233 - 246.
[Abstract] [Full Text] [PDF]


Home page
JDRHome page
J. Sodek, A. P. Batista Da Silva, and R. Zohar
Osteopontin and Mucosal Protection
Journal of Dental Research, May 1, 2006; 85(5): 404 - 415.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Cheng and P. A. Sharp
Regulation of CD44 Alternative Splicing by SRm160 and Its Potential Role in Tumor Cell Invasion
Mol. Cell. Biol., January 1, 2006; 26(1): 362 - 370.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Celetti, D. Testa, S. Staibano, F. Merolla, V. Guarino, M. D. Castellone, R. Iovine, G. Mansueto, P. Somma, G. De Rosa, et al.
Overexpression of the Cytokine Osteopontin Identifies Aggressive Laryngeal Squamous Cell Carcinomas and Enhances Carcinoma Cell Proliferation and Invasiveness
Clin. Cancer Res., November 15, 2005; 11(22): 8019 - 8027.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. K. Nilsson, H. M. Johnston, G. A. Whitty, B. Williams, R. J. Webb, D. T. Denhardt, I. Bertoncello, L. J. Bendall, P. J. Simmons, and D. N. Haylock
Osteopontin, a key component of the hematopoietic stem cell niche and regulator of primitive hematopoietic progenitor cells
Blood, August 15, 2005; 106(4): 1232 - 1239.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Y. Wai, Z. Mi, H. Guo, S. Sarraf-Yazdi, C. Gao, J. Wei, C. E. Marroquin, B. Clary, and P. C. Kuo
Osteopontin silencing by small interfering RNA suppresses in vitro and in vivo CT26 murine colon adenocarcinoma metastasis
Carcinogenesis, April 1, 2005; 26(4): 741 - 751.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
K. Kawamura, K. Iyonaga, H. Ichiyasu, J. Nagano, M. Suga, and Y. Sasaki
Differentiation, Maturation, and Survival of Dendritic Cells by Osteopontin Regulation
Clin. Vaccine Immunol., January 1, 2005; 12(1): 206 - 212.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Iwata, N. Awaya, L. Graf, C. Kahl, and B. Torok-Storb
Human marrow stromal cells activate monocytes to secrete osteopontin, which down-regulates Notch1 gene expression in CD34+ cells
Blood, June 15, 2004; 103(12): 4496 - 4502.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Chiocchetti, M. Indelicato, T. Bensi, R. Mesturini, M. Giordano, S. Sametti, L. Castelli, F. Bottarel, M. C. Mazzarino, L. Garbarini, et al.
High levels of osteopontin associated with polymorphisms in its gene are a risk factor for development of autoimmunity/lymphoproliferation
Blood, February 15, 2004; 103(4): 1376 - 1382.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
C. Gao, H. Guo, L. Downey, C. Marroquin, J. Wei, and P. C. Kuo
Osteopontin-dependent CD44v6 expression and cell adhesion in HepG2 cells
Carcinogenesis, December 1, 2003; 24(12): 1871 - 1878.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P.-L. Chang, M. Cao, and P. Hicks
Osteopontin induction is required for tumor promoter-induced transformation of preneoplastic mouse cells
Carcinogenesis, November 1, 2003; 24(11): 1749 - 1758.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
G. A. Johnson, R. C. Burghardt, F. W. Bazer, and T. E. Spencer
Osteopontin: Roles in Implantation and Placentation
Biol Reprod, November 1, 2003; 69(5): 1458 - 1471.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
K. A. Furger, A. L. Allan, S. M. Wilson, C. Hota, S. A. Vantyghem, C. O. Postenka, W. Al-Katib, A. F. Chambers, and A. B. Tuck
{beta}3 Integrin Expression Increases Breast Carcinoma Cell Responsiveness to the Malignancy-Enhancing Effects of Osteopontin
Mol. Cancer Res., September 1, 2003; 1(11): 810 - 819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. A. Chellaiah, R. S. Biswas, S. R. Rittling, D. T. Denhardt, and K. A. Hruska
Rho-dependent Rho Kinase Activation Increases CD44 Surface Expression and Bone Resorption in Osteoclasts
J. Biol. Chem., August 1, 2003; 278(31): 29086 - 29097.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
A. Verhulst, M. Asselman, V. P. Persy, M. S.J. Schepers, M. F. Helbert, C. F. Verkoelen, and M. E. De Broe
Crystal Retention Capacity of Cells in the Human Nephron: Involvement of CD44 and Its Ligands Hyaluronic Acid and Osteopontin in the Transition of a Crystal Binding- into a Nonadherent Epithelium
J. Am. Soc. Nephrol., January 1, 2003; 14(1): 107 - 115.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
V. Orian-Rousseau, L. Chen, J. P. Sleeman, P. Herrlich, and H. Ponta
CD44 is required for two consecutive steps in HGF/c-Met signaling
Genes & Dev., December 1, 2002; 16(23): 3074 - 3086.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
G. F. Weber, S. Zawaideh, S. Hikita, V. A. Kumar, H. Cantor, and S. Ashkar
Phosphorylation-dependent interaction of osteopontin with its receptors regulates macrophage migration and activation
J. Leukoc. Biol., October 1, 2002; 72(4): 752 - 761.
[Abstract] [Full Text] [PDF]


Home page
Sci SignalHome page
G. F. Weber
Meeting Report: The Next Interleukin?
Sci. Signal., August 27, 2002; 2002 (147): pe37 - pe37.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. R. Rittling, Y. Chen, F. Feng, and Y. Wu
Tumor-derived Osteopontin Is Soluble, Not Matrix Associated
J. Biol. Chem., March 8, 2002; 277(11): 9175 - 9182.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
Y. Koguchi, K. Kawakami, S. Kon, T. Segawa, M. Maeda, T. Uede, and A. Saito
Penicillium marneffei Causes Osteopontin-Mediated Production of Interleukin-12 by Peripheral Blood Mononuclear Cells
Infect. Immun., March 1, 2002; 70(3): 1042 - 1048.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J.M. Weiss, A.C. Renkl, C.S. Maier, M. Kimmig, L. Liaw, T. Ahrens, S. Kon, M. Maeda, H. Hotta, T. Uede, et al.
Osteopontin Is Involved in the Initiation of Cutaneous Contact Hypersensitivity by Inducing Langerhans and Dendritic Cell Migration to Lymph Nodes
J. Exp. Med., October 29, 2001; 194(9): 1219 - 1230.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Medico, A. Gentile, C. L. Celso, T. A. Williams, G. Gambarotta, L. Trusolino, and P. M. Comoglio
Osteopontin Is an Autocrine Mediator of Hepatocyte Growth Factor-induced Invasive Growth
Cancer Res., August 1, 2001; 61(15): 5861 - 5868.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
F. Takahashi, K. Takahashi, T. Okazaki, K. Maeda, H. Ienaga, M. Maeda, S. Kon, T. Uede, and Y. Fukuchi
Role of Osteopontin in the Pathogenesis of Bleomycin-Induced Pulmonary Fibrosis
Am. J. Respir. Cell Mol. Biol., March 1, 2001; 24(3): 264 - 271.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
L. S. Sherman, T. A. Rizvi, S. Karyala, and N. Ratner
Cd44 Enhances Neuregulin Signaling by Schwann Cells
J. Cell Biol., September 4, 2000; 150(5): 1071 - 1084.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y.-H. Lin, C.-J. Huang, J.-R. Chao, S.-T. Chen, S.-F. Lee, J. J.-Y. Yen, and H.-F. Yang-Yen
Coupling of Osteopontin and Its Cell Surface Receptor CD44 to the Cell Survival Response Elicited by Interleukin-3 or Granulocyte-Macrophage Colony-Stimulating Factor
Mol. Cell. Biol., April 15, 2000; 20(8): 2734 - 2742.
[Abstract] [Full Text]


Home page
J. Cell Sci.Home page
L Hebbard, A Steffen, V Zawadzki, C Fieber, N Howells, J Moll, H Ponta, M Hofmann, and J Sleeman
CD44 expression and regulation during mammary gland development and function
J. Cell Sci., January 7, 2000; 113(14): 2619 - 2630.
[Abstract] [PDF]


Home page
CROBMHome page
J. Sodek, B. Ganss, and M.D. McKee
Osteopontin
Critical Reviews in Oral Biology & Medicine, January 1, 2000; 11(3): 279 - 303.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D.-Q. Zheng, A. S. Woodard, G. Tallini, and L. R. Languino
Substrate Specificity of alpha vbeta 3 Integrin-mediated Cell Migration and Phosphatidylinositol 3-Kinase/AKT Pathway Activation
J. Biol. Chem., August 4, 2000; 275(32): 24565 - 24574.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Katagiri, Y. U.
Right arrow Articles by Uede, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Katagiri, Y. U.
Right arrow Articles by Uede, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online