| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Departments of Surgery [C. A. E., P. W. L.] and Biochemistry and Molecular Biology [C. A. E., K. D. D., K. K., P. V. D., P. W. L.], University of Southern California, School of Medicine, Norris Comprehensive Cancer Center, Los Angeles, California 90033, and Memorial Sloan Kettering Cancer Center, New York, New York 10021-6094 [L. B. S.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
DNA methylation results from a methyl transfer reaction performed by trans-acting enzymes known as DNA methyltransferases. Two distinct methyl transfer activities can be distinguished, based on the methylation status of the substrate. Maintenance DNA methyltransferase activity refers to the conversion of hemimethylated substrates to a fully methylated state, whereas de novo methyltransferase activity refers to the new addition of methyl groups at sites that were previously unmethylated. All known DNA (cytosine-5)-methyltransferases are able to perform both reactions. The predominant mammalian DNA (cytosine-5)-methyltransferase, DNMT1, is unusual in that its relative de novo activity is 12 orders of magnitude lower than its maintenance activity (5
, 6)
Recently, two additional mammalian DNA (cytosine-5)-methyltransferase genes have been identified, which are referred to as DNMT3A and DNMT3B. These genes differ from DNMT1 in that the encoded polypeptides DNMT3
and DNMT3ß have approximately equal ratios of de novo DNA methyltransferase activity:maintenance DNA methyltransferase activity (7)
. An additional candidate DNA methyltransferase gene, DNMT2, has been identified, but the encoded protein has not yet been shown to possess methyltransferase activity (8, 9, 10)
. DNMT3
and DNMT3ß are thought to be responsible for the wave of de novo methylation that occurs during embryogenesis (7)
. Because the abnormal hypermethylation of CpG islands in colorectal tumors involves the new acquisition of DNA methylation (de novo methylation), we have investigated whether transcriptional activation or up-regulation of either DNMT3A or DNMT3B could be responsible for the methylator phenotype observed in colorectal tumors.
Previous studies have analyzed the expression levels of the DNMT1 gene in human tumors and cell lines, with somewhat conflicting results (11, 12, 13, 14, 15) . Some reports documented a substantial increase in the expression of DNMT1 or of total DNA methyltransferase enzyme activity in tumor cells, compared to normal counterparts. However, Lee et al. (14) made the important observation that relative determinations of expression levels can be affected by the gene used for the normalization of RNA amounts. Normalization with a gene associated with cell proliferation, such as histone H4 (H4F2) abolished any statistically significantly higher mean expression of DNMT1 in colorectal tumors compared to matched normal mucosa. One additional caveat to these studies is that in all cases, mean expression levels were determined for tumor tissues compared to normal specimens. However, substantial interindividual variability in DNA methyltransferase expression exists. None of these studies analyzed CpG island hypermethylation frequencies in the same samples to correlate these with DNA methyltransferase expression or activity.
In this study, we extend the analysis of DNA methyltransferase expression levels in colorectal tumors in the following ways: (a) we have analyzed the largest data set used thus far for such an analysis (25 pairs of tumor and matched normal mucosa); (b) we have used a highly quantitative RT-PCR3
method (Fig. 1)
that is linearly accurate in serial dilutions over 6 orders of magnitude; (c) we have used four different genes [ACTB (ß-actin), H4F2 (histone H4), PCNA, or POLR2A (RNA pol II large subunit)] for normalization of RNA levels; (d) we have analyzed the expression levels of two new DNA methyltransferase genes, DNMT3A and DNMT3B, that have not been investigated previously; (e) we investigated whether the individual expression levels of any of the three DNA methyltransferases correlate with the de novo methylation of four commonly hypermethylated CpG islands [APC, ESR1 (estrogen receptor), CDKN2A (p16), and MLH1].
|
| Materials and Methods |
|---|
|
|
|---|
Nucleic Acid Isolation.
Genomic DNA was isolated by the standard method of proteinase K digestion and phenol-chloroform extraction (16)
. Total RNA was isolated by the single-step guanidinium isothiocyanate method (17)
.
Quantitative RT-PCR Analysis.
The quantitation of mRNA levels was carried out using a real-time fluorescence detection method as described previously (18
, 19) . In brief, after RNA isolation, cDNA was prepared from each sample as described previously (20)
. The specific cDNA of interest and reference cDNA (ACTB, H4F2, PCNA, or POLR2A) were PCR-amplified separately using an oligonucleotide probe with a 5' fluorescent reporter dye (6FAM) and a 3' quencher dye (TAMRA; Ref. 21
). The 5' to 3' nuclease activity of Taq DNA polymerase cleaved the probe and released the reporter, whose fluorescence could be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer Corp., Foster City, CA). After crossing a fluorescence detection threshold, the PCR amplification results in a fluorescent signal proportional to the amount of PCR product generated. Initial template concentration was derived from the cycle number at which the fluorescent signal crossed a threshold in the exponential phase of the PCR reaction. Relative gene expression was determined based on the threshold cycles of the gene of interest and of the internal reference gene. Use of a reference gene avoids the need to directly quantitate the RNA, which could be a major source of error for analysis. Several reference samples were included on each assay plate to verify plate-to-plate consistency. Plates were normalized to each other using these reference samples, if necessary. Contamination of the RNA samples by genomic DNA was excluded by an analysis of all RNA samples without prior cDNA conversion. The PCR amplification was performed using a 96-well optical tray and caps with a 25-µl final reaction mixture consisting of 600 nM each primer; 200 nM probe; 5 units of Ampli-Taq Gold; 200 µM each of dATP, dCTP, and dGTP; 400 µM dUTP; 5.5 mM MgCl2; 1 unit of AmpErase uracil N-glycosylase; and 1x TaqMan buffer A containing a reference dye at 50°C for 2 min and at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and at 60°C for 1 min. The primer and probe sequences are listed below. In all cases, the first primer is the forward PCR primer, the second primer is the TaqMan probe, and the third primer is the reverse PCR primer.
The primer and probe sequences are as follows: (a) ACTB, TGAGCGCGGCTACAGCTT, 6FAM5'-ACCACCACGGCCGAGCGG-3' TAMRA, and CCTTAATGTCACACACGATT; (b) H4F2, CTTAGCCTCAGTGCGAATGCT, 6FAM5'-CAGAACCAGAGCACAGCCAAAGCCACTAC-3' TAMRA, and ACGGTCCCCGGGAGAAT; (c) PCNA, GTGCAAAAGACGGAGTGAAATTT, 6FAM5'-TGTTTCCATTTCCAAGTTCTCCACTTGCAG-3' TAMRA, and ATCGACATTACTTGTCTGTGACAATTTA; (d) POLR2A, GCCACCCAGATGACCTTGAA, 6FAM5'-CCTTCCACTATGCTGGTGTGTCTGCCA-3' TAMRA, and GCACACCCAGCGTCACATT; (e) DNMT1, GGTTCTTCCTCCTGGAGAATGTC, 6FAM5'-CCTTCAAGCGCTCCATGGTCCTGAA-3' TAMRA, and GGGCCACGCCGTACTG; (f) DNMT3A, CAATGACCTCTCCATCGTCAAC, 6FAM5'-AGCCGGCCAGTGCCCTC-GTAG-3' TAMRA, and CATGCAGGAGGCGGTAGAA; and (g) DNMT3B, CCATGAAGGTTGGCGACAA, 6FAM5'-CACTCCAGGAACCGTGAGA-TGTCCCT-3' TAMRA, and TGGCATCAATCATCACTGGATT.
DNA Methylation Analysis.
Genomic DNA extracted from tumor and normal samples was treated with sodium bisulfite as described previously (22)
. After conversion, the DNA was amplified by fluorescence-based, real-time quantitative PCR (as described above, but without the addition of AmpErase). Two sets of primers and probes designed specifically for bisulfite-converted DNA were used: (a) a methylated set for the gene of interest [APC, ESR1, CDKN2A (p16), or MLH1]; and (b) an internal reference set (MYOD1) to control for input DNA. The methylated primers and the probe were designed to contain 15 CpG dinucleotides, which amplify only fully methylated molecules. Specificity of the reactions for methylated DNA was confirmed separately using DNAs of known methylation status. The internal reference primers and the probe were designed in a region of the MYOD1 gene that lacks any CpG dinucleotides to allow for unbiased amplification. Parallel TaqMan PCR reactions were performed with primers specific for the bisulfite-converted methylated sequence for a particular locus and with the MYOD1 reference primers. The ratio between the values obtained in these two TaqMan analyses was used as a measure of the degree of methylation at that locus. A ratio greater than or equal to four times the mean ratio for all normal mucosal samples was classified as methylated (Figs. 2
and 3
, ), and a ratio less than four was regarded as unmethylated (Figs. 2
and 3
,
). The primer and probe sequences are listed below. In all cases, the first primer listed is the forward PCR primer, the second primer is the TaqMan probe, and the third primer is the reverse PCR primer.
|
|
Statistics.
TaqMan analyses performed as described above for either RT-PCR or DNA methylation studies yield values that are expressed as ratios between two absolute measurements (DNMT:normalization gene for RT-PCR and CpG island:MYOD1 for DNA methylation analysis). The ratios for each type of analysis were subsequently normalized such that the mean ratio of the 25 normal samples would equal a value of 1. Consequently, the values for the tumor samples represent a fold increase or decrease relative to a mean normal value of 1. Additional statistical manipulations are described in Tables 1
and 2
.
|
|
| Results and Discussion |
|---|
|
|
|---|
) and 25 matched normal mucosal samples (hatched bars). The expression levels are displayed as ratios between DNMT1 and four reference genes (ACTB, Fig. 2A
DNMT3A and DNMT3B Expression in Colorectal Tumors.
Fig. 3
shows the relative expression levels of DNMT3A and DNMT3B in the same samples as described above. The high values seen in some of the samples have been reproduced multiple times and are therefore thought to represent valid ratios. The advantage of the use of multiple normalization genes is apparent from the variable ratios obtained within individual samples. For instance, the apparent high value for DNMT3/PCNA seen in sample 23N is due to an abnormally low expression of PCNA compared to other reference genes in this particular sample and is not due to a high level of DNMT3 gene expression.
The analysis of DNMT3A and DNMT3B expression yielded similar results to the analysis of DNMT1 expression. DNMT3A expression in colorectal tumors appears to be elevated by an average of 2.9- and 2.8-fold when RNA levels are normalized using ACTB and POLR2A, respectively (Table 1
; Fig. 3, A and B
). Likewise, DNMT3B levels appear to be up-regulated by an average of 3.6- and 4.0-fold in a similar analysis (Table 1
; Fig. 3, E and F
). However, this up-regulation is absent for both genes when RNA levels are normalized using either H4F2 or PCNA for normalization (Table 1
; Fig. 3, C, D, G, and H
). The proliferation dependence of DNMT3A and DNMT3B gene expression is not known. These results could indicate true up-regulation of DNMT3A or DNMT3B in tumors, or the situation could be analogous to that for DNMT1. Regardless of which of these two scenarios is correct, if the apparent up-regulation of DNMT3A or DNMT3B is responsible for the methylator phenotype in some human colorectal tumors, then the extent of up-regulation should be greater in tumors with frequent CpG island hypermethylation. We have investigated whether there is a direct link between expression of any of the three DNA methyltransferases and the frequency of CpG island hypermethylation.
CpG Island Hypermethylation and DNA Methyltransferase Expression.
We analyzed the methylation status of four CpG islands known to undergo de novo methylation in human colorectal tumors in all normal and tumor samples. These CpG islands are associated with the genes APC (26)
, ESR1 (estrogen receptor; Ref. 27
), CDKN2A (p16) (2)
, and MLH1 (28
, 29)
. We found that DNMT3A and DNMT3B do not appear to be up-regulated in the two tumors (samples 10 and 17) with the most frequent (three of four) CpG island hypermethylation (Fig. 3)
. Tumors with relatively high DNMT3A or DNMT3B expression levels tend to have at most one hypermethylated CpG island. There is just one sample (26T) with high DNMT3A and/or DNMT3B expression and two hypermethylated CpG islands. A similar lack of concordance is apparent when CpG island hypermethylation frequencies are compared to DNMT1 expression levels (Fig. 2)
. ANOVA was used to compare the mean DNMT gene expression between categories of CpG island hypermethylation frequency (Table 2)
. We performed 12 separate ANOVA calculations to investigate all combinations of the three DNMT genes and the four normalization genes. None of these combinations yielded a statistically significant P value (Table 2)
, which would have indicated a correlation between the frequency of CpG island hypermethylation and the level of DNMT gene expression. Therefore, regardless of whether or not DNMT3A or DNMT3B gene expression is proliferation dependent, as is DNMT1, the RNA levels of neither of these two genes in individual tumors correlate with CpG island hypermethylation frequency.
We conclude that most cases of frequent hypermethylation of CpG islands in human colorectal tumors do not result from a simple transcriptional up-regulation of any of the three known DNA methyltransferase genes. This leaves open the possibility that one or more of these genes are up-regulated posttranscriptionally. It is also conceivable that other factors regulate the activity of the DNA methyltransferases, either by interacting with the enzymes themselves or by regulating access to the DNA substrate. The molecular basis for the methylator phenotype in human colorectal tumors could be found in the disruption of the control mechanisms preventing access of the DNA methyltransferases to CpG islands rather than in the mere up-regulation of DNA methyltransferase levels in the cell.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by NIH/National Cancer Institute Grants R01 CA 71716 (to P. V. D.) and R01 CA 75090 (to P. W. L.). ![]()
2 To whom requests for reprints should be addressed, at University of Southern California/Norris Comprehensive Cancer Center, Mail Stop # 73,, Room 6418, 1441 Eastlake Avenue, Los Angeles, CA 90033. Phone: (323) 865-0650; Fax: (323) 865-0158; E-mail: plaird{at}hsc.usc.edu ![]()
3 The abbreviation used is: RT-PCR, reverse transcription-PCR. ![]()
Received 1/29/99. Accepted 3/30/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. S. Kristensen and L. L. Hansen PCR-Based Methods for Detecting Single-Locus DNA Methylation Biomarkers in Cancer Diagnostics, Prognostics, and Response to Treatment Clin. Chem., August 1, 2009; 55(8): 1471 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Sepulveda, D. Jones, S. Ogino, W. Samowitz, M. L. Gulley, R. Edwards, V. Levenson, V. M. Pratt, B. Yang, K. Nafa, et al. CpG Methylation Analysis--Current Status of Clinical Assays and Potential Applications in Molecular Diagnostics: A Report of the Association for Molecular Pathology J. Mol. Diagn., July 1, 2009; 11(4): 266 - 278. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Y. Sanders, A. Pardo, M. Selman, G. J. Nuovo, T. O. Tollefsbol, G. P. Siegal, and J. S. Hagood Thy-1 Promoter Hypermethylation: A Novel Epigenetic Pathogenic Mechanism in Pulmonary Fibrosis Am. J. Respir. Cell Mol. Biol., November 1, 2008; 39(5): 610 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Gao, Y. Kondo, L. Shen, Y. Shimizu, T. Sano, K. Yamao, A. Natsume, Y. Goto, M. Ito, H. Murakami, et al. Variable DNA methylation patterns associated with progression of disease in hepatocellular carcinomas Carcinogenesis, October 1, 2008; 29(10): 1901 - 1910. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Cheng, H. Pincas, M. D. Bacolod, G. Schemmann, S. F. Giardina, J. Huang, S. Barral, K. Idrees, S. A. Khan, Z. Zeng, et al. CpG Island Methylator Phenotype Associates with Low-Degree Chromosomal Abnormalities in Colorectal Cancer Clin. Cancer Res., October 1, 2008; 14(19): 6005 - 6013. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Yoo, J. C. Chuang, H.-M. Byun, G. Egger, A. S. Yang, L. Dubeau, T. Long, P. W. Laird, V. E. Marquez, and P. A. Jones Long-term Epigenetic Therapy with Oral Zebularine Has Minimal Side Effects and Prevents Intestinal Tumors in Mice Cancer Prevention Research, September 1, 2008; 1(4): 233 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. S. Kristensen, T. Mikeska, M. Krypuy, and A. Dobrovic Sensitive Melting Analysis after Real Time- Methylation Specific PCR (SMART-MSP): high-throughput and probe-free quantitative DNA methylation detection Nucleic Acids Res., April 1, 2008; 36(7): e42 - e42. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Wang, D. J. Smiraglia, Y.-Z. Wu, S. Ghosh, J. S. Rader, K. R. Cho, T. A. Bonfiglio, R. Nayar, C. Plass, and M. E. Sherman Identification of Novel Methylation Markers in Cervical Cancer Using Restriction Landmark Genomic Scanning Cancer Res., April 1, 2008; 68(7): 2489 - 2497. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Jung, E. M. Poole, J. Bigler, J. Whitton, J. D. Potter, and C. M. Ulrich DNA Methyltransferase and Alcohol Dehydrogenase: Gene-Nutrient Interactions in Relation to Risk of Colorectal Polyps Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 330 - 338. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fabbri, R. Garzon, A. Cimmino, Z. Liu, N. Zanesi, E. Callegari, S. Liu, H. Alder, S. Costinean, C. Fernandez-Cymering, et al. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B PNAS, October 2, 2007; 104(40): 15805 - 15810. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. B. Yoo, S. Jeong, G. Egger, G. Liang, P. Phiasivongsa, C. Tang, S. Redkar, and P. A. Jones Delivery of 5-Aza-2'-Deoxycytidine to Cells Using Oligodeoxynucleotides Cancer Res., July 1, 2007; 67(13): 6400 - 6408. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, G. J. Kirkner, P. Kraft, M. Loda, and C. S. Fuchs Evaluation of Markers for CpG Island Methylator Phenotype (CIMP) in Colorectal Cancer by a Large Population-Based Sample J. Mol. Diagn., July 1, 2007; 9(3): 305 - 314. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Fonsatti, H. J.M. Nicolay, L. Sigalotti, L. Calabro, L. Pezzani, F. Colizzi, M. Altomonte, M. Guidoboni, F. M. Marincola, and M. Maio Functional Up-regulation of Human Leukocyte Antigen Class I Antigens Expression by 5-aza-2'-deoxycytidine in Cutaneous Melanoma: Immunotherapeutic Implications Clin. Cancer Res., June 1, 2007; 13(11): 3333 - 3338. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Agoston, P. Argani, A. M. De Marzo, J. L. Hicks, and W. G. Nelson Retinoblastoma Pathway Dysregulation Causes DNA Methyltransferase 1 Overexpression in Cancer via MAD2-Mediated Inhibition of the Anaphase-Promoting Complex Am. J. Pathol., May 1, 2007; 170(5): 1585 - 1593. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Miremadi, M. Z. Oestergaard, P. D.P. Pharoah, and C. Caldas Cancer genetics of epigenetic genes Hum. Mol. Genet., April 15, 2007; 16(R1): R28 - R49. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Widodo, C. C. Deocaris, K. Kaur, K. Hasan, T. Yaguchi, K. Yamasaki, T. Sugihara, T. Ishii, R. Wadhwa, and S. C. Kaul Stress Chaperones, Mortalin, and Pex19p Mediate 5-Aza-2' Deoxycytidine-Induced Senescence of Cancer Cells by DNA Methylation-Independent Pathway J. Gerontol. A Biol. Sci. Med. Sci., March 1, 2007; 62(3): 246 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gu, D. Berman, C. Lu, I. I. Wistuba, J. A. Roth, M. Frazier, M. R. Spitz, and X. Wu Aberrant Promoter Methylation Profile and Association with Survival in Patients with Non-Small Cell Lung Cancer Clin. Cancer Res., December 15, 2006; 12(24): 7329 - 7338. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, G. J. Kirkner, M. Loda, and C. S. Fuchs CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations J. Mol. Diagn., November 1, 2006; 8(5): 582 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, G. Walsh, D. D. Liu, J. J. Lee, and L. Mao Expression of {Delta}DNMT3B Variants and Its Association with Promoter Methylation of p16 and RASSF1A in Primary Non-Small Cell Lung Cancer. Cancer Res., September 1, 2006; 66(17): 8361 - 8366. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Ogino, M Cantor, T Kawasaki, M Brahmandam, G J Kirkner, D J Weisenberger, M Campan, P W Laird, M Loda, and C S Fuchs CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies Gut, July 1, 2006; 55(7): 1000 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, M. Brahmandam, M. Cantor, G. J. Kirkner, D. Spiegelman, G. M. Makrigiorgos, D. J. Weisenberger, P. W. Laird, M. Loda, et al. Precision and Performance Characteristics of Bisulfite Conversion and Real-Time PCR (MethyLight) for Quantitative DNA Methylation Analysis J. Mol. Diagn., May 1, 2006; 8(2): 209 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Schatz, J. Distler, K. Berlin, and M. Schuster Novel method for high throughput DNA methylation marker evaluation using PNA-probe library hybridization and MALDI-TOF detection. Nucleic Acids Res., January 1, 2006; 34(8): e59 - e59. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Weisenberger, M. Campan, T. I. Long, M. Kim, C. Woods, E. Fiala, M. Ehrlich, and P. W. Laird Analysis of repetitive element DNA methylation by MethyLight Nucleic Acids Res., December 2, 2005; 33(21): 6823 - 6836. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, C. R. Martins, Z. B. Fansler, K. L. Roemer, E. A. Kincaid, K. S. Gustafson, D. F. Heitjan, and D. P. Clark DNA Methylation in Anal Intraepithelial Lesions and Anal Squamous Cell Carcinoma Clin. Cancer Res., September 15, 2005; 11(18): 6544 - 6549. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Agoston, P. Argani, S. Yegnasubramanian, A. M. De Marzo, M. A. Ansari-Lari, J. L. Hicks, N. E. Davidson, and W. G. Nelson Increased Protein Stability Causes DNA Methyltransferase 1 Dysregulation in Breast Cancer J. Biol. Chem., May 6, 2005; 280(18): 18302 - 18310. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ushijima, N. Watanabe, K. Shimizu, K. Miyamoto, T. Sugimura, and A. Kaneda Decreased Fidelity in Replicating CpG Methylation Patterns in Cancer Cells Cancer Res., January 1, 2005; 65(1): 11 - 17. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, C. Rocken, C. Lofton-Day, H.-U. Schulz, O. Muller, N. Kutzner, P. Malfertheiner, and M. P.A. Ebert Molecular analysis of APC promoter methylation and protein expression in colorectal cancer metastasis Carcinogenesis, January 1, 2005; 26(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kim, B. N. Trinh, T. I. Long, S. Oghamian, and P. W. Laird Dnmt1 deficiency leads to enhanced microsatellite instability in mouse embryonic stem cells Nucleic Acids Res., October 27, 2004; 32(19): 5742 - 5749. [Abstract] [Full Text] [PDF] |
||||
![]() |
K Baker, Y Zhang, C Jin, and J R Jass Proximal versus distal hyperplastic polyps of the colorectum: different lesions or a biological spectrum? J. Clin. Pathol., October 1, 2004; 57(10): 1089 - 1093. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kaneda, K. Wakazono, T. Tsukamoto, N. Watanabe, Y. Yagi, M. Tatematsu, M. Kaminishi, T. Sugimura, and T. Ushijima Lysyl Oxidase Is a Tumor Suppressor Gene Inactivated by Methylation and Loss of Heterozygosity in Human Gastric Cancers Cancer Res., September 15, 2004; 64(18): 6410 - 6415. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Hoque, S. Begum, O. Topaloglu, C. Jeronimo, E. Mambo, W. H. Westra, J. A. Califano, and D. Sidransky Quantitative Detection of Promoter Hypermethylation of Multiple Genes in the Tumor, Urine, and Serum DNA of Patients with Renal Cancer Cancer Res., August 1, 2004; 64(15): 5511 - 5517. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Fackler, M. McVeigh, J. Mehrotra, M. A. Blum, J. Lange, A. Lapides, E. Garrett, P. Argani, and S. Sukumar Quantitative Multiplex Methylation-Specific PCR Assay for the Detection of Promoter Hypermethylation in Multiple Genes in Breast Cancer Cancer Res., July 1, 2004; 64(13): 4442 - 4452. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Widschwendter, K. D. Siegmund, H. M. Muller, H. Fiegl, C. Marth, E. Muller-Holzner, P. A. Jones, and P. W. Laird Association of Breast Cancer DNA Methylation Profiles with Hormone Receptor Status and Response to Tamoxifen Cancer Res., June 1, 2004; 64(11): 3807 - 3813. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Cheng, D. J. Weisenberger, F. A. Gonzales, G. Liang, G.-L. Xu, Y.-G. Hu, V. E. Marquez, and P. A. Jones Continuous Zebularine Treatment Effectively Sustains Demethylation in Human Bladder Cancer Cells Mol. Cell. Biol., February 1, 2004; 24(3): 1270 - 1278. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Cottrell, J. Distler, N. S. Goodman, S. H. Mooney, A. Kluth, A. Olek, I. Schwope, R. Tetzner, H. Ziebarth, and K. Berlin A real-time PCR assay for DNA-methylation using methylation-specific blockers Nucleic Acids Res., January 13, 2004; 32(1): e10 - e10. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Feltus, E. K. Lee, J. F. Costello, C. Plass, and P. M. Vertino Predicting aberrant CpG island methylation PNAS, October 14, 2003; 100(21): 12253 - 12258. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Girault, S. Tozlu, R. Lidereau, and I. Bieche Expression Analysis of DNA Methyltransferases 1, 3A, and 3B in Sporadic Breast Carcinomas Clin. Cancer Res., October 1, 2003; 9(12): 4415 - 4422. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hibi, M. Koike, H. Nakayama, S. Fujitake, Y. Kasai, K. Ito, S. Akiyama, and A. Nakao A Cancer-prone Case with a Background of Methylation of p16 Tumor Suppressor Gene Clin. Cancer Res., March 1, 2003; 9(3): 1053 - 1056. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Brabender, H. Usadel, R. Metzger, P. M. Schneider, J. Park, D. Salonga, D. D. Tsao-Wei, S. Groshen, R. V. Lord, N. Takebe, et al. Quantitative O6-Methylguanine DNA Methyltransferase Methylation Analysis in Curatively Resected Non-Small Cell Lung Cancer: Associations with Clinical Outcome Clin. Cancer Res., January 1, 2003; 9(1): 223 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. M. Sirotnak, Y. She, F. Lee, J. Chen, and H. I. Scher Studies with CWR22 Xenografts in Nude Mice Suggest That ZD1839 May Have a Role in the Treatment of Both Androgen-dependent and Androgen-independent Human Prostate Cancer Clin. Cancer Res., December 1, 2002; 8(12): 3870 - 3876. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Lorincz, D. Schubeler, S. R. Hutchinson, D. R. Dickerson, and M. Groudine DNA Methylation Density Influences the Stability of an Epigenetic Imprint and Dnmt3a/b-Independent De Novo Methylation Mol. Cell. Biol., November 1, 2002; 22(21): 7572 - 7580. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zochbauer-Muller, J. D. Minna, and A. F. Gazdar Aberrant DNA Methylation in Lung Cancer: Biological and Clinical Implications Oncologist, October 1, 2002; 7(5): 451 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. O. Toyooka, S. Toyooka, A. Maitra, Q. Feng, N. C. Kiviat, A. Smith, J. D. Minna, R. Ashfaq, and A. F. Gazdar Establishment and Validation of Real-Time Polymerase Chain Reaction Method for CDH1 Promoter Methylation Am. J. Pathol., August 1, 2002; 161(2): 629 - 634. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Trinh, T. I. Long, A. E. Nickel, D. Shibata, and P. W. Laird DNA Methyltransferase Deficiency Modifies Cancer Susceptibility in Mice Lacking DNA Mismatch Repair Mol. Cell. Biol., May 1, 2002; 22(9): 2906 - 2917. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Z. Khokhar, A. F. Y. Lam, V. W. Rusch, and F. M. Sirotnak Despite some expression of folate receptor {alpha} in human mesothelioma cells, internalization of methotrexate is predominantly carrier mediated J. Thorac. Cardiovasc. Surg., May 1, 2002; 123(5): 862 - 868. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Eads, A. E. Nickel, and P. W. Laird Complete Genetic Suppression of Polyp Formation and Reduction of CpG-Island Hypermethylation in ApcMin/+Dnmt1-Hypomorphic Mice Cancer Res., March 1, 2002; 62(5): 1296 - 1299. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liang, M. F. Chan, Y. Tomigahara, Y. C. Tsai, F. A. Gonzales, E. Li, P. W. Laird, and P. A. Jones Cooperativity between DNA Methyltransferases in the Maintenance Methylation of Repetitive Elements Mol. Cell. Biol., January 15, 2002; 22(2): 480 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Usadel, J. Brabender, K. D. Danenberg, C. Jeronimo, S. Harden, J. Engles, P. V. Danenberg, S. Yang, and D. Sidransky Quantitative Adenomatous Polyposis Coli Promoter Methylation Analysis in Tumor Tissue, Serum, and Plasma DNA of Patients with Lung Cancer Cancer Res., January 1, 2002; 62(2): 371 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawakami, D. Salonga, J. M. Park, K. D. Danenberg, H. Uetake, J. Brabender, K. Omura, G. Watanabe, and P. V. Danenberg Different Lengths of a Polymorphic Repeat Sequence in the Thymidylate Synthase Gene Affect Translational Efficiency but Not Its Gene Expression Clin. Cancer Res., December 1, 2001; 7(12): 4096 - 4101. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jeronimo, H. Usadel, R. Henrique, J. Oliveira, C. Lopes, W. G. Nelson, and D. Sidransky Quantitation of GSTP1 Methylation in Non-neoplastic Prostatic Tissue and Organ-Confined Prostate Adenocarcinoma J Natl Cancer Inst, November 21, 2001; 93(22): 1747 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Chan, R. van Amerongen, T. Nijjar, E. Cuppen, P. A. Jones, and P. W. Laird Reduced Rates of Gene Loss, Gene Silencing, and Gene Mutation in Dnmt1-Deficient Embryonic Stem Cells Mol. Cell. Biol., November 15, 2001; 21(22): 7587 - 7600. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Osanai, W. Ichikawa, Y. Takagi, H. Uetake, Z. Nihei, and K. Sugihara Expression of Pyrimidine Nucleoside Phosphorylase (PyNPase) in Colorectal Cancer Jpn. J. Clin. Oncol., October 1, 2001; 31(10): 500 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Z. Khokhar, Y. She, V. W. Rusch, and F. M. Sirotnak Experimental Therapeutics with a New 10-Deazaaminopterin in Human Mesothelioma: Further Improving Efficacy through Structural Design, Pharmacologic Modulation at the Level of MRP ATPases, and Combined Therapy with Platinums Clin. Cancer Res., October 1, 2001; 7(10): 3199 - 3205. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-H. Lin, S.-Y. Hsieh, I-S. Sheen, W.-C. Lee, T.-C. Chen, W.-C. Shyu, and Y.-F. Liaw Genome-wide Hypomethylation in Hepatocellular Carcinogenesis Cancer Res., May 1, 2001; 61(10): 4238 - 4243. [Abstract] [Full Text] |
||||
![]() |
M. Toyota, K. J. Kopecky, M.-O. Toyota, K.-W. Jair, C. L. Willman, and J.-P. J. Issa Methylation profiling in acute myeloid leukemia Blood, May 1, 2001; 97(9): 2823 - 2829. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Eads, R. V. Lord, K. Wickramasinghe, T. I. Long, S. K. Kurumboor, L. Bernstein, J. H. Peters, S. R. DeMeester, T. R. DeMeester, K. A. Skinner, et al. Epigenetic Patterns in the Progression of Esophageal Adenocarcinoma Cancer Res., April 1, 2001; 61(8): 3410 - 3418. [Abstract] [Full Text] |
||||
![]() |
S.-i. Mizuno, T. Chijiwa, T. Okamura, K. Akashi, Y. Fukumaki, Y. Niho, and H. Sasaki Expression of DNA methyltransferases DNMT1, 3A, and 3B in normal hematopoiesis and in acute and chronic myelogenous leukemia Blood, March 1, 2001; 97(5): 1172 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawakami, J. Brabender, R. V. Lord, S. Groshen, B. D. Greenwald, M. J. Krasna, J. Yin, A. S. Fleisher, J. M. Abraham, D. G. Beer, et al. Hypermethylated APC DNA in Plasma and Prognosis of Patients With Esophageal Adenocarcinoma J Natl Cancer Inst, November 15, 2000; 92(22): 1805 - 1811. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Eads, R. V. Lord, S. K. Kurumboor, K. Wickramasinghe, M. L. Skinner, T. I. Long, J. H. Peters, T. R. DeMeester, K. D. Danenberg, P. V. Danenberg, et al. Fields of Aberrant CpG Island Hypermethylation in Barrett's Esophagus and Associated Adenocarcinoma Cancer Res., September 1, 2000; 60(18): 5021 - 5026. [Abstract] [Full Text] |
||||
![]() |
M. Esteller, A. Sparks, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, S. Gonzalez, G. Tarafa, D. Sidransky, S. J. Meltzer, et al. Analysis of Adenomatous Polyposis Coli Promoter Hypermethylation in Human Cancer Cancer Res., August 1, 2000; 60(16): 4366 - 4371. [Abstract] [Full Text] |
||||
![]() |
R. T. Cormier and W. F. Dove Dnmt1N/+ Reduces the Net Growth Rate and Multiplicity of Intestinal Adenomas in C57BL/6-Multiple Intestinal Neoplasia (Min)/+ Mice Independently of p53 but Demonstrates Strong Synergy with the Modifier of Min 1AKR Resistance Allele Cancer Res., July 1, 2000; 60(14): 3965 - 3970. [Abstract] [Full Text] |
||||
![]() |
C. A. Eads, K. D. Danenberg, K. Kawakami, L. B. Saltz, C. Blake, D. Shibata, P. V. Danenberg, and P. W. Laird MethyLight: a high-throughput assay to measure DNA methylation Nucleic Acids Res., April 15, 2000; 28(8): e32 - e. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Choi and J. B. Mason Folate and Carcinogenesis: An Integrated Scheme1-3 J. Nutr., January 1, 2000; 130(2): 129 - 132. [Abstract] [Full Text] |
||||
![]() |
S. A. Kuismanen, M. T. Holmberg, R. Salovaara, P. Schweizer, L. A. Aaltonen, A. de la Chapelle, M. Nystrom-Lahti, and P. Peltomaki Epigenetic phenotypes distinguish microsatellite-stable and -unstable colorectal cancers PNAS, October 26, 1999; 96(22): 12661 - 12666. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Detich, S. Ramchandani, and M. Szyf A Conserved 3'-Untranslated Element Mediates Growth Regulation of DNA Methyltransferase 1 and Inhibits Its Transforming Activity J. Biol. Chem., June 29, 2001; 276(27): 24881 - 24890. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |