This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ono, M. Articles by Hakomori, S.-i. Search for Related Content PubMed PubMed Citation Articles by Ono, M. Articles by Hakomori, S.-i.

Motility Inhibition and Apoptosis Are Induced by Metastasis-suppressing Gene Product CD82 and Its Analogue CD9, with Concurrent Glycosylation¹

Pacific Northwest Research Institute, Seattle, Washington 98122, and Departments of Pathobiology and Microbiology, University of Washington, Seattle, Washington 98195

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Metastasis-suppressing gene product CD82 and its analogue CD9 are considered to suppress the malignancy of various human cancers, although the rationale for this effect is unknown. The present study addresses phenotypic changes in Chinese hamster ovary mutant cell line ldlD deficient in UDP-Glc 4-epimerase and expressing CD82 or CD9 by cDNA transfection. Only CD82- or CD9-expressing cells grown in Gal-supplemented medium showed reduced motility and massive cell death, which are characteristic of apoptosis, after a latent period. Under this condition, endogenous GM3 synthesis was observed as a common factor, and N-glycosylation occurred at a high level in CD82 and to a lesser extent in CD9. Thus, the malignancy-suppressing effect of CD82 or CD9 is based partially on cell motility inhibition and apoptosis induction promoted by concurrent GM3 synthesis and N-glycosylation.

	Introduction

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Expression of the tetraspan membrane proteins CD82 (1 , 2) and CD9 (3) is down-regulated in various human cancers and is inversely correlated with the patient survival rate (2 , 4 , 5) . CD82 and CD9 suppress tumor cell malignancy, although the mechanism for this phenomenon is unknown. The cell biological significance of these proteins should be explored in relation not only to their expression per se, but also to the effects of their N-glycosylation and surrounding endogenous gangliosides in membrane, because these factors profoundly affect membrane receptor function in general (for a review, see Ref. 6 ). For this purpose, Chinese hamster ovary mutant cell line ldlD-14 deficient in UDP-Glc 4-epimerase and expressing CD82 or CD9 by cDNA transfection was utilized. Phenotypic changes of the transfectants, in terms of cell motility inhibition and enhancement of apoptosis, were clearly observed in Gal-supplemented medium. These changes reflect not only the effect of CD82 or CD9 expression per se, but also the effect of endogenous GM3 synthesis as a common factor and a high level of N-glycosylation in CD82 and a lower level of N-glycosylation in CD9. These findings provide a rationale for the suppression of malignancy by CD82 and CD9 with proper glycosylation.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
ldlD-14 Cell Culture, Antibodies, Reagents, and Flow Cytometry.
Cell line ldlD-14, a Chinese hamster ovary cell mutant deficient in UDP-Glc 4-epimerase (7) , was maintained in Ham’s F-12 medium supplemented with 5% fetal bovine serum. The glycosylation pattern was altered in serum-free ITS⁴ medium (Collaborative Biomedical Products, Bedford, MA; Ref. 8 ) by changing the medium on day 1 to serum-free ITS with or without Gal (20 µM) and/or GalNAc (200 µM). The effect of glycosylation on cellular function was determined on day 3 for cell migration and on day 10–11 for apoptosis.

Preparation of cDNA Encoding CD9 and CD82, and Its Transfection into ldlD-14 Cells.
cDNAs for CD9 and CD82 were generated by reverse transcription-PCR using human placental RNA (Clontech, Palo Alto, CA) and Superscript II reverse transcriptase (Life Technologies, Inc., Gaithersburg, MD). PCR amplification with Elongase (Life Technologies, Inc.) was performed with 5' primer AGAGGAATTCCATGCCGGTCAAAGGAGG and 3' primer GAGGGGATCCTTCCTGCTCAGGGATGTAAG for CD9 and with 5' primer GCGGGAATTCGATGGGCTCAGCCTGTATCAAAG and 3' primer GGCGGCTCGAGTCAGTACTTGGGGACCTTGC for CD82. The resulting PCR products were cloned into pCDNA3 (Invitrogen, Carlsbad, CA) and sequenced to confirm identity by comparison with published sequences (1 , 3) .

pCDNA3 containing CD9 and CD82 was transfected into ldlD-14 cells using LipofectAMINE (Life Technologies, Inc.), transfectants were isolated by growing them in G418 (Life Technologies, Inc.)-containing medium, and clones were selected by expression of the respective antigens probed by the mAb, as described previously (9) .

Haptotactic and Phagokinetic Motility Assay.
Transwell assay using a 6.5-mm transwell assembly (8-µm pore size; Costar, Cambridge, MA; Refs. 10 and 11 ) and the gold sol phagokinetic assay (12) were performed as described previously. Some modifications of the procedures are explained in the legend of Fig. 2 .

View larger version (41K): [in this window] [in a new window]   Fig. 2. Haptotactic and phagokinetic motility of ldlD/CD9 and ldlD/CD82 cells. Motility was determined by transwell assay (A–C) and by phagokinetic gold sol assay (D–F). In the transwell assay (10 , 11) , the lower surface of the filter was coated by placing 10 µl of solution (containing 1.5 µg of Matrigel; Collaborative Biomedical Products) in distilled water, and the filter was dried at room temperature. Cell suspension (100 µl; containing 5 x 104 cells) in Ham’s F-12 medium with 0.25% BSA was placed in the upper compartment, and 0.6 ml of Ham’s F-12 medium with 0.25% BSA was added in the lower compartment. Cells that migrated during the 24-h period were counted in five areas after hematoxylin staining. For the phagokinetic gold sol assay (12) , cells were incubated and grown for 24 h on gold sol-coated plates. Cells were then fixed for 30 min in 3.5% formaldehyde solution, and the migrated area (in µm2) was measured using the Scion Image 1.62a computer program (Scion Corporation, Frederick, MD). A and B, transwell motility of ldlD/CD9 and ldlD/CD82, respectively, in ITS medium (a), ITS + Gal (b), ITS + GalNAc (c), or ITS + Gal + GalNAc (d). and represent ldlD/CD9 clones 24 and 28, respectively, in A and and represent IdlD/CD82 clones 515 and 1209 in B. Statistical significance of the differences between the groups are indicated by P values. NS, not significant. C, transwell motility of parental ldlD in ITS with or without the addition of Gal and/or GalNAc. D and E, phagokinetic motility of ldlD/CD9 and ldlD/CD82, respectively, in different media as described in A and B. and represent clones 24 and 47, respectively, in D and clones 515 and 1209 in E. Statistical significance is indicated as described in A and B. F, phagokinetic motility of parental ldlD in ITS with or without the addition of Gal and/or GalNAc.

Determination of CD9 and CD82 with Glycosylation Status.
Cells were solubilized in lysis buffer, subjected to SDS-PAGE, electrophoretically transferred to Immobilon-P (Millipore, Bedford, MA), and subjected to Western blotting with a chemiluminescence system (Pierce, Rockford, IL; Ref. 11 ). Protein content was determined with a BCA kit (Pierce). Antihuman CD9 mouse mAb M-L13 was from PharMingen (San Diego, CA). Antihuman CD82 mouse mAb B-L2 was from Serotec (Raleigh, NC).

Determination of Apoptosis.
Morphological changes characteristic of apoptosis (14) , i.e. nuclear compaction, cytoplasmic condensation, and disintegration into dense particles, were examined. DNA fragmentation was determined by terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (15) using the in situ cell death detection kit (Boehringer Mannheim, Indianapolis, IN). Translocation of phosphatidylserine associated with apoptosis (16) was determined by the annexin-V-fluos staining kit (Boehringer Mannheim).

	Results and Discussion

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
CD82- and CD9-expressing ldlD-14 Cells.
ldlD-14 clones expressing CD82 (ldlD/CD82; clones 515 and 1209) and clones expressing CD9 (ldlD/CD9; clones 24, 28, and 47) were established (Fig. 1A) . SDS-PAGE and Western blotting indicate that: (a) the molecular mass (23 kDa) of CD9 in ldlD/CD9 cells was unchanged, regardless of the addition of Gal (Fig. 1 B, a) ; (b) CD82 had a much higher molecular mass and a broader band (45–65 kDa) in ldlD/CD82 cells grown in the presence of Gal or Gal plus GalNAc (Fig. 1B, b) ; and (c) endogenous GM3 synthesis occurred for both CD9- and CD82-expressing cells grown in the presence of Gal or Gal plus GalNAc (Fig. 1C) .

View larger version (64K): [in this window] [in a new window]   Fig. 1. Expression of CD9 and CD82 (A), SDS-PAGE profiles of CD9 and CD82 (B), and patterns of GM3 and other GSLs in ldlD transfectants (C). A, flow cytometric pattern on EPICS XL (Coulter Corp.) showing CD9 expression (a) and CD82 expression (b). i, parental ldlD. ii, ldlD/CD9 clone 24 (clones 28 and 47 show similar reactivity). iii, ldlD/CD82 clone 515 (clone 1209 shows similar reactivity). B, SDS-PAGE profiles of CD9 in ldlD/CD9 (a) and CD82 in ldlD/CD82 (b). Lane 1, cells grown in ITS medium. Lane 2, ITS with Gal. Lane 3, ITS with GalNAc. Lane 4, ITS with Gal plus GalNAc. Numbers on the left indicate molecular mass x 10-3. C, high performance thin-layer chromatography pattern of GSLs in parental ldlD (a), ldlD/CD9 (b), and ldlD/CD82 (c). Lanes 1–4, same as those in B. Lanes x, y, and z, reference LacCer, GM1, and GM3 revealed by orcinol-sulfuric acid.

Apoptosis Was Induced Only in CD9 and CD82-expressing Cells, with Concurrent GM3 Synthesis and Complete N-Glycosylation.
Massive cell death (apoptosis) occurred after 11 days in ldlD/CD9 (Fig. 3A , first column) or ldlD/CD82 (second column) culture in ITS added with Gal (Fig. 3A , row b) or with Gal plus GalNAc (row c). Cell death did not occur in ITS medium without Gal addition (row a) or for parental ldlD14 cells, regardless of Gal addition (third column). The effect of CD9 and CD82 with concurrent glycosylation (Gal addition) on the induction of apoptosis was confirmed by flow cytometry after nick end labeling, i.e. 3' hydroxyl end detected on day 11 in cells cultured on a Matrigel-coated plate. Clear labeling was observed in ldlD/CD9 and ldlD/CD82 in Gal-supplemented medium (Fig. 3B , row b) and in Gal plus GalNAc-supplemented medium (row c). Labeling was minimal in ITS medium without Gal addition (row a) or for parental ldlD14 cells, regardless of Gal addition (third column).

View larger version (70K): [in this window] [in a new window]   Fig. 3. CD9- and CD82-dependent apoptosis promoted by glycosylation. A, morphology change of ldlD cells at day 11 on a Matrigel-coated plate. Three cell lines (as indicated at the bottom) were grown in ITS medium alone (a), ITS + Gal (b), and ITS + Gal + GalNAc (c). The number of adherent cells is dramatically decreased in Gal-containing medium (b and c) for CD9- and CD82-expressing cells but is minimally changed for parental ldlD14 cells. Dead cells are characterized by round shape, nuclear compaction, cytoplasmic condensation, and disintegration into dense particles. B, flow cytometric patterns showing nick end labeling of ldlD/CD9, ldlD/CD82, and parental ldlD cells. Cells were cultured on Matrigel-coated plates in ITS medium (top row), ITS + Gal (second row), or ITS + Gal + GalNAc (third row) and stained on day 11. Note that the high fluorescence peak representing apoptotic cells is clearly observed only in CD9- or CD82-transfected cells in the presence of Gal. This trend is much weaker in parental cells without CD9 or CD82.

View larger version (34K): [in this window] [in a new window]   Fig. 4. CD9- or CD82-dependent cell death of ldlD/CD9 or ldlD/CD82 in Gal-added medium. Cells (5 x 104) were plated on 24-well dishes coated with or without Matrigel in 5% fetal bovine serum with Ham’s F-12 medium. The medium was changed to ITS with or without Gal and GalNAc the next day (day 1). The adherent cell number was counted as four random places for each dish using a videocapture system (0.2 mm2/screen; Scion Corp.). Experiments were run in duplicate. Ordinate, cell number/mm2. Cell numbers and morphology showed the same pattern until day 9 for dishes coated with (A) or without Matrigel (B). Massive cell death occurred at day 11 for ldlD/CD9 and ldlD/CD82 cells grow in in ITS + Gal ) or ITS + Gal + GalNC (). Cell death was minimal for cells grown in ITS alone () and for parental cells not expressing CD9 or CD82, regardless of the addition of sugars (A, ldlD14). The degree of cell death was greater for cells on dishes without Matrigel (B). Statistical significance of the differences between the groups is indicated by P values.

The Malignancy-suppressing Effect of CD82 and CD9 Is Due to Motility Inhibition and Apoptosis and Is Promoted by Concurrent GM3 Synthesis and Complete N-Glycosylation.
CD82 (KAI-1) was originally assigned as a metastasis-suppressing gene product, and its expression was shown to be down-regulated in a few types of human cancer (1 , 2 , 5) . Its analogue, CD9, is also down-regulated in metastatic tumors (3 , 4) . Expression of both CD82 and CD9 was correlated with the patient survival rate (2 , 4 , 5) . However, the cell biological mechanism for these effects of CD82 and CD9 is unknown.

Results of the present study indicate that expression of both CD82 and CD9 inhibits haptotactic and phagokinetic cell motility and induces cell death with features typical of apoptosis, and that this process is promoted by concurrent GM3 synthesis and complete N-glycosylation. Because N-glycosylation in CD9 is minimal, endogenous GM3 synthesis has the major effect on CD9. On the other hand, there is a high level of N-glycosylation in CD82, as indicated by the great increase in molecular mass and heterogeneity in ldlD/CD82 cells grown in Gal-supplemented medium. Inhibition of cell motility and induction of apoptosis in ldlD/CD82 cells are ascribable to enhanced N-glycosylation. The effect of endogenous GM3 synthesis on CD82 must be similar to the effect on CD9, i.e. endogenous GM3 is the common factor for both CD9- and CD82-dependent inhibition of cell motility and induction of apoptosis.

Expression of CD82 or CD9 per se is an essential, but not sufficient, factor to induce cell motility inhibition and apoptosis. Completion of N-glycosylation and endogenous GM3 synthesis, as observed typically in ldlD cells grown in Gal-supplemented medium, are required to manifest motility inhibition as well as CD82- or CD9-dependent induction of apoptosis, although the latter process requires at least a 10-day latent period. What type of molecular mechanism takes place during the latent period is yet unidentified. Little is known about the correlation between glycosylation and apoptosis, although Le^x (17) and Le^y (18) expressed in colorectal carcinoma are associated with apoptosis. Glycosylation that defines malignancy depends largely on which molecular species is glycosylated and is susceptible to gangliosides. Tetraspan membrane proteins that suppress tumor malignancy are undoubtedly target molecules of glycosylation, controlling motility and apoptosis.

	ACKNOWLEDGMENTS

 
We thank Dr. Monty Krieger for the donation of ldlD-14 cells, Wendy Smith and Jon McBride for technical assistance, and Dr. Stephen Anderson for scientific editing and preparation of the manuscript.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported by National Cancer Institute Outstanding Investigator Grant CA42505 (to S. H.).

² Fellowship awardee from the Department of Surgery, University of Tokyo.

³ To whom requests for reprints should be addressed, at Pacific Northwest Research Institute, 720 Broadway, Seattle, WA 98122. Phone: (206) 726-1222; Fax: (206) 726-1212; E-mail: hakomori{at}u.washington.edu

⁴ The abbreviations used are: ITS, insulin-transferrin-selenium; Gal, galactose; GalNAc, N-acetylgalactosamine; GM3, NeuAc2-3Galß1-4GlcßCer; GSL, glycosphingolipid; mAb, monoclonal antibody; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis.

Received 2/25/99. Accepted 4/ 5/99.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 

1. Dong J-T., Lamb P. W., Rinker-Schaeffer C. W., Vukanovic J., Ichikawa T., Isaacs J. T., Barrett J. C. KAI1, a metastasis suppressor gene for prostate cancer on human chromosome 11p11.2. Science (Washington DC), 268: 884-886, 1995.[Abstract/Free Full Text]
2. Dong J. T., Suzuki H., Pin S. S., Bova S., Schalken J. A., Isaacs W. B., Barrett J. C., Isaacs J. T. Down-regulation of the KAI1 metastasis suppressor gene during the progression of human prostatic cancer infrequently involves gene mutation or allelic loss. Cancer Res., 56: 4387-4390, 1996.[Abstract/Free Full Text]
3. Miyake M., Koyama M., Seno M., Ikeyama S. Identification of the motility-related protein (MRP-1), recognized by monoclonal antibody M31-15, which inhibits cell motility. J. Exp. Med., 174: 1347-1354, 1991.[Abstract/Free Full Text]
4. Cajot J-F., Sordat I., Silvestre T., Sordat B. Differential display cloning identifies motility-related protein (MRP1/CD9) as highly expressed in primary compared to metastatic human colon carcinoma cells. Cancer Res., 57: 2593-2597, 1997.[Abstract/Free Full Text]
5. Adachi M., Taki T., Ieki Y., Huang C., Higashiyama M., Miyake M. Correlation of KAII/CD82 gene expression with good prognosis in patients with non-small cell lung cancer. Cancer Res., 56: 1751-1755, 1996.[Abstract/Free Full Text]
6. Hakomori S. Tumor malignancy defined by aberrant glycosylation and sphingo(glyco)lipid metabolism. Cancer Res., 56: 5309-5318, 1996.[Abstract/Free Full Text]
7. Kingsley D. M., Kozarsky K. F., Hobbie L., Krieger M. Reversible defects in O-linked glycosylation and LDL receptor expression in a UDP-Gal/UDP-GalNAc 4-epimerase deficient mutant. Cell, 44: 749-759, 1986.[Medline]
8. Krieger M., Reddy P., Kozarsky K., Kingsley D., Hobbie L., Penman M. Analysis of the synthesis, intracellular sorting, and function of glycoproteins using a mammalian cell mutant with reversible glycosylation defects. Methods Cell Biol., 32: 57-84, 1989.[Medline]
9. Handa K., White T., Ito K., Fang H., Wang S., Hakomori S. P-selectin-dependent adhesion of human cancer cells: requirement for co-expression of a "PSGL-1-like" core protein and the glycosylation process for sialosyl-Le^x or sialosyl-Le^a. Int. J. Oncol., 6: 773-781, 1995.
10. Albini A., Iwamoto Y., Kleinman H. K., Martin G. R., Aaronson S. A., Kozlowski J. M., McEwan R. N. A rapid in vitro assay for quantitating the invasive potential of tumor cells. Cancer Res., 47: 3239-3245, 1987.[Abstract/Free Full Text]
11. Ichikawa D., Handa K., Withers D. A., Hakomori S. Histo-blood group A/B versus H status of human carcinoma cells as correlated with haptotactic cell motility: approach with A and B gene transfection. Cancer Res., 57: 3092-3096, 1997.[Abstract/Free Full Text]
12. Albrecht-Buehler G. The phagokinetic tracks of 3T3 cells. Cell, 11: 395-404, 1977.[Medline]
13. Saito T., Hakomori S. Quantitative isolation of total glycosphingolipids from animal cells. J. Lipid Res., 12: 257-259, 1971.[Abstract]
14. Martin S. J., Green D. R., Cotter T. G. Dicing with death: dissecting the components of the apoptosis machinery. Trends Biochem. Sci., 19: 26-30, 1994.[Medline]
15. Gavrieli Y., Sherman Y., Ben-Sasson S. A. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol., 119: 493-501, 1992.[Abstract/Free Full Text]
16. Koopman G., Reutelingsperger C. P., Kuijten G. A., Keehnen R. M., Pals S. T., van Oers M. H. Annexin V for flow cytometric detection of phosphatidylserine expression on B cells undergoing apoptosis. Blood, 84: 1415-1420, 1994.[Abstract/Free Full Text]
17. Akamatsu S., Yazawa S., Zenita K., Matsumoto H., Tachikawa T., Kannagi R. Elevation of an (1,3)fucosyltransferase activity correlated with apoptosis in the human colon adenocarcinoma cell line, HT-29. Glycoconj. J., 13: 1021-1029, 1996.[Medline]
18. Hiraishi K., Suzuki K., Hakomori S., Adachi M. Le^y antigen expression is correlated with apoptosis (programmed cell death). Glycobiology, 3: 381-390, 1993.[Abstract/Free Full Text]

This article has been cited by other articles:

				Y. Nakazawa, S. Sato, M. Naito, Y. Kato, K. Mishima, H. Arai, T. Tsuruo, and N. Fujita Tetraspanin family member CD9 inhibits Aggrus/podoplanin-induced platelet aggregation and suppresses pulmonary metastasis Blood, September 1, 2008; 112(5): 1730 - 1739. [Abstract] [Full Text] [PDF]

				A. R. Todeschini, J. N. Dos Santos, K. Handa, and S.-i. Hakomori Ganglioside GM2/GM3 complex affixed on silica nanospheres strongly inhibits cell motility through CD82/cMet-mediated pathway PNAS, February 12, 2008; 105(6): 1925 - 1930. [Abstract] [Full Text] [PDF]

				X.-q. Wang, Q. Yan, P. Sun, J.-W. Liu, L. Go, S. M. McDaniel, and A. S. Paller Suppression of Epidermal Growth Factor Receptor Signaling by Protein Kinase C-{alpha} Activation Requires CD82, Caveolin-1, and Ganglioside Cancer Res., October 15, 2007; 67(20): 9986 - 9995. [Abstract] [Full Text] [PDF]

				A. R. Todeschini, J. N. Dos Santos, K. Handa, and S.-i. Hakomori Ganglioside GM2-Tetraspanin CD82 Complex Inhibits Met and Its Cross-talk with Integrins, Providing a Basis for Control of Cell Motility through Glycosynapse J. Biol. Chem., March 16, 2007; 282(11): 8123 - 8133. [Abstract] [Full Text] [PDF]

				T. Tohami, L. Drucker, H. Shapiro, J. Radnay, and M. Lishner Overexpression of tetraspanins affects multiple myeloma cell survival and invasive potential FASEB J, March 1, 2007; 21(3): 691 - 699. [Abstract] [Full Text] [PDF]

				Y. Saito, I. Tachibana, Y. Takeda, H. Yamane, P. He, M. Suzuki, S. Minami, T. Kijima, M. Yoshida, T. Kumagai, et al. Absence of CD9 Enhances Adhesion-Dependent Morphologic Differentiation, Survival, and Matrix Metalloproteinase-2 Production in Small Cell Lung Cancer Cells Cancer Res., October 1, 2006; 66(19): 9557 - 9565. [Abstract] [Full Text] [PDF]

				H.-J. Choi, T.-W. Chung, S.-K. Kang, Y.-C. Lee, J.-H. Ko, J.-G. Kim, and C.-H. Kim Ganglioside GM3 modulates tumor suppressor PTEN-mediated cell cycle progression--transcriptional induction of p21WAF1 and p27kip1 by inhibition of PI-3K/AKT pathway Glycobiology, July 1, 2006; 16(7): 573 - 583. [Abstract] [Full Text] [PDF]

				H. Sohn, Y.-S. Kim, H.-T. Kim, C.-H. Kim, E.-W. Cho, H.-Y. Kang, N.-S. Kim, C.-H. Kim, S. E. Ryu, J.-H. Lee, et al. Ganglioside GM3 is involved in neuronal cell death FASEB J, June 1, 2006; 20(8): 1248 - 1250. [Abstract] [Full Text] [PDF]

				K. Mitsuzuka, K. Handa, M. Satoh, Y. Arai, and S. Hakomori A Specific Microdomain ("Glycosynapse 3") Controls Phenotypic Conversion and Reversion of Bladder Cancer Cells through GM3-mediated Interaction of {alpha}3{beta}1 Integrin with CD9 J. Biol. Chem., October 21, 2005; 280(42): 35545 - 35553. [Abstract] [Full Text] [PDF]

				F. Martin, D. M. Roth, D. A. Jans, C. W. Pouton, L. J. Partridge, P. N. Monk, and G. W. Moseley Tetraspanins in Viral Infections: a Fundamental Role in Viral Biology? J. Virol., September 1, 2005; 79(17): 10839 - 10851. [Full Text] [PDF]

				H. Huang, J. Groth, K. Sossey-Alaoui, L. Hawthorn, S. Beall, and J. Geradts Aberrant Expression of Novel and Previously Described Cell Membrane Markers in Human Breast Cancer Cell Lines and Tumors Clin. Cancer Res., June 15, 2005; 11(12): 4357 - 4364. [Abstract] [Full Text] [PDF]

				S. Gesierich, C. Paret, D. Hildebrand, J. Weitz, K. Zgraggen, F. H. Schmitz-Winnenthal, V. Horejsi, O. Yoshie, D. Herlyn, L. K. Ashman, et al. Colocalization of the Tetraspanins, CO-029 and CD151, with Integrins in Human Pancreatic Adenocarcinoma: Impact on Cell Motility Clin. Cancer Res., April 15, 2005; 11(8): 2840 - 2852. [Abstract] [Full Text] [PDF]

				B. He, L. Liu, G. A. Cook, S. Grgurevich, L. K. Jennings, and X. A. Zhang Tetraspanin CD82 Attenuates Cellular Morphogenesis through Down-regulating Integrin {alpha}6-Mediated Cell Adhesion J. Biol. Chem., February 4, 2005; 280(5): 3346 - 3354. [Abstract] [Full Text] [PDF]

				Y. Miura, M. Kainuma, H. Jiang, H. Velasco, P. K. Vogt, and S. Hakomori Reversion of the Jun-induced oncogenic phenotype by enhanced synthesis of sialosyllactosylceramide (GM3 ganglioside) PNAS, November 16, 2004; 101(46): 16204 - 16209. [Abstract] [Full Text] [PDF]

				B. Zhou, L. Liu, M. Reddivari, and X. A. Zhang The Palmitoylation of Metastasis Suppressor KAI1/CD82 Is Important for Its Motility- and Invasiveness-Inhibitory Activity Cancer Res., October 15, 2004; 64(20): 7455 - 7463. [Abstract] [Full Text] [PDF]

				M. S. Toledo, E. Suzuki, K. Handa, and S. Hakomori Cell Growth Regulation through GM3-enriched Microdomain (Glycosynapse) in Human Lung Embryonal Fibroblast WI38 and Its Oncogenic Transformant VA13 J. Biol. Chem., August 13, 2004; 279(33): 34655 - 34664. [Abstract] [Full Text] [PDF]

				Y. Murayama, J.-i. Miyagawa, K. Oritani, H. Yoshida, K. Yamamoto, O. Kishida, T. Miyazaki, S. Tsutsui, T. Kiyohara, Y. Miyazaki, et al. CD9-mediated activation of the p46 Shc isoform leads to apoptosis in cancer cells J. Cell Sci., July 1, 2004; 117(15): 3379 - 3388. [Abstract] [Full Text] [PDF]

				E. Odintsova, J. Voortman, E. Gilbert, and F. Berditchevski Tetraspanin CD82 regulates compartmentalisation and ligand-induced dimerization of EGFR J. Cell Sci., November 15, 2003; 116(22): 4557 - 4566. [Abstract] [Full Text] [PDF]

				X. A. Zhang, B. He, B. Zhou, and L. Liu Requirement of the p130CAS-Crk Coupling for Metastasis Suppressor KAI1/CD82-mediated Inhibition of Cell Migration J. Biol. Chem., July 11, 2003; 278(29): 27319 - 27328. [Abstract] [Full Text] [PDF]

				X. A. Zhang, W. S. Lane, S. Charrin, E. Rubinstein, and L. Liu EWI2/PGRL Associates with the Metastasis Suppressor KAI1/CD82 and Inhibits the Migration of Prostate Cancer Cells Cancer Res., May 15, 2003; 63(10): 2665 - 2674. [Abstract] [Full Text] [PDF]

				Y. Kawakami, K. Kawakami, W. F. A. Steelant, M. Ono, R. C. Baek, K. Handa, D. A. Withers, and S. Hakomori Tetraspanin CD9 Is a "Proteolipid," and Its Interaction with alpha 3 Integrin in Microdomain Is Promoted by GM3 Ganglioside, Leading to Inhibition of Laminin-5-dependent Cell Motility J. Biol. Chem., September 6, 2002; 277(37): 34349 - 34358. [Abstract] [Full Text] [PDF]

				C. M. Longhurst, J. D. Jacobs, M. M. White, J. T. Crossno Jr., D. A. Fitzgerald, J. Bao, T. J. Fitzgerald, R. Raghow, and L. K. Jennings Chinese Hamster Ovary Cell Motility to Fibronectin Is Modulated by the Second Extracellular Loop of CD9. IDENTIFICATION OF A PUTATIVE FIBRONECTIN BINDING SITE J. Biol. Chem., August 30, 2002; 277(36): 32445 - 32452. [Abstract] [Full Text] [PDF]

				S. Hakomori Glycosylation defining cancer malignancy: New wine in an old bottle PNAS, August 6, 2002; 99(16): 10231 - 10233. [Full Text] [PDF]

				T. KOHNO, A. WADA, and Y. IGARASHI N-Glycans of sphingosine 1-phosphate receptor Edg-1 regulate ligand-induced receptor internalization FASEB J, July 1, 2002; 16(9): 983 - 992. [Abstract] [Full Text] [PDF]

				T. Tanaka, H. Kohno, M. Murakami, S. Kagami, and K. El-Bayoumy Suppressing Effects of Dietary Supplementation of the Organoselenium 1,4-Phenylenebis(methylene)selenocyanate and the Citrus Antioxidant Auraptene on Lung Metastasis of Melanoma Cells in Mice Cancer Res., July 1, 2000; 60(14): 3713 - 3716. [Abstract] [Full Text]

				D. P. Lombardi, J. Geradts, J. F. Foley, C. Chiao, P. W. Lamb, and J. C. Barrett Loss of KAI1 Expression in the Progression of Colorectal Cancer Cancer Res., November 1, 1999; 59(22): 5724 - 5731. [Abstract] [Full Text] [PDF]

				C. S. Stipp, T. V. Kolesnikova, and M. E. Hemler EWI-2 Is a Major CD9 and CD81 Partner and Member of a Novel Ig Protein Subfamily J. Biol. Chem., October 26, 2001; 276(44): 40545 - 40554. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ono, M. Articles by Hakomori, S.-i. Search for Related Content PubMed PubMed Citation Articles by Ono, M. Articles by Hakomori, S.-i.