| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
University of Massachusetts Cancer Center, Worcester, Massachusetts 01655 [M-E. T., B. R.]; Cancer Biology Program-Hematology/Oncology Division [G. J. B., S. P. B.], Clinical Investigator Training Program, Beth Israel Deaconess Medical Center-Harvard/Massachusetts Institute of Technology Health Sciences and Technology, in collaboration with Pfizer, Inc. [Y-J. K.], and Pathology Department [M. U.], Beth Israel Deaconess Medical Center, Boston, Massachusetts 02215; and Urologic Oncology Program, University of California at San Francisco-Mount Zion Cancer Center, San Francisco, California 94120 [E. J. S.]
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
40% of the patients biopsied, and these samples form the basis of this analysis.
RT-PCR Analysis of AR Transcripts.
RNA was extracted from approximately five adjacent frozen sections of 6 µm using RNazol-B (TM Cinna Scientific, Friendswood, TX), and cDNA was synthesized with MMTV reverse transcriptase and an AR antisense primer located in the 3' UTR (GCAAATAGAATTCAGGAACA). PCR amplifications were carried out with Taq DNA polymerase, a sense primer in the ligand binding domain (ACTCCTTTGCAGCCTTGC), and an internal antisense primer in the 3' UTR (ACAGACTGTACATCAATAGAGGAAATTC) for 25 cycles. Secondary PCR amplifications were carried out for 25 cycles with nested 5' (GCTCTAGACTCAATGAACTGGGAGAGAGAC) and 3' UTR (GGCACTGCAGAGGAGTAGTGCAGA) primers, the former introducing an XbaI site. Negative control samples in which the reverse transcriptase step was omitted were included in all amplifications and did not amplify. The PCR products were cloned, and at least five colonies were sequenced. The region sequenced in all clones was from codon 701 through the stop codon. For direct sequencing of uncloned PCR products, the products were purified using a Microcon-100 membrane (Amicon, Beverly, MA).
Genomic DNA Sequencing.
DNA was extracted from four to five adjacent frozen sections by overnight proteinase K digestion, followed by phenol/chloroform extraction. The DNA was PCR amplified using a primer in intron 7 (GAGGCCACCTCCTTGTCAACCCTG) and primers in the 3' UTR of exon 8. The PCR products were purified and directly sequenced as above.
Transient Transfections.
CV-1 cells in 24-well plates were transfected using Lipofectamine according to the manufacturers directions (Life Technologies, Inc.). The wild-type AR expression vector, pSV.ARo, was kindly provided by Dr. A. Brinkmann (Erasmus University, Rotterdam, the Netherlands), and mutant ARs were constructed from this as described (5)
. The reported plasmid, pMMTVpLuc, was provided by Dr. Richard Pestell (Albert Einstein, New York, NY) and was also described previously (5)
. Each transfection was normalized for ß-galactosidase activity from the cotransfected plasmid pSVgal (Promega Corp., Madison, WI). Each well received 20 ng of AR expression vector, 200 ng of pMMTVLuc, and 50 ng of pSVgal. Transfected cells were assayed after 24 h in medium containing charcoal/dextran-stripped FCS (Hyclone, Logan, UT) and the indicated hormone or AR antagonist. All samples were done in quadruplicate, and data shown are representative of at least three experiments.
| Results |
|---|
|
|
|---|
In the group of 17 evaluable patients treated initially by androgen ablation without an AR antagonist, a single patient with a point mutation was identified (patient 51, aspartate to asparagine in codon 890; Table 1
). As shown by direct sequencing of AR PCR products, this mutation was present in the majority of AR transcripts (Fig. 1A)
. Analysis of genomic DNA from peripheral blood lymphocytes confirmed that the D890N change in this patient was a mutation and not a polymorphism (data not shown).
|
|
AR Mutations Detected by Analysis of Genomic DNA.
In four of the patients with mutant ARs, the initial frozen sections contained predominantly tumor (not shown). Therefore, genomic DNA from these biopsies could be readily analyzed to further confirm the RT-PCR-based results and to determine whether the AR mutations were in a large fraction of the tumor cells versus a small fraction expressing high levels of AR message. Further frozen sections were cut from the appropriate blocks and again analyzed histologically, confirming that the sections were largely replaced by tumor (Fig. 1B)
. DNA was then extracted from adjacent frozen sections, and a portion of exon 8, containing codons 877 and 890, was amplified with a 5' primer in intron 7 and 3' exon primers and directly sequenced.
The D890N mutation was clearly observed in the DNA from patient 51 (Fig. 1C)
, demonstrating that this mutation was present in most or all of the tumor cells. The sequence analysis of genomic DNA from patients 6 and 12 similarly demonstrated that most or all of the tumor cells from these biopsies had the T877A mutant AR (Fig. 1C)
. In patient 14, only a minority of the PCR-amplified genomic DNA had the T877S mutation (AGT to ACT on the antisense strand in Fig. 1C
). A larger fraction had the T877A mutation (AGT to AGC on the antisense strand), indicating that tumor cells with the former mutation expressed higher levels of AR transcripts.
Functional Analysis of Mutant ARs.
Mutations in codon 877 were identified previously in advanced PCa from patients (3, 4, 5, 6)
and in a PCa cell line, LNCaP (8)
. Importantly, functional studies have shown that both the T877A and T877S mutations alter the AR so that hydroxyflutamide, the active metabolite of the AR antagonist flutamide, becomes a strong agonist (8, 9, 10)
. Therefore, identification here of these codon 877 mutations in patients who were treated with flutamide suggested that AR mutations resulting in activation by flutamide were positively selected by the drug. The D890N mutation was found in a patient who was not treated with flutamide. This mutant AR was analyzed functionally for its response to hydroxyflutamide in comparison with the wild-type and T877A mutant ARs.
CV-1 cells were transiently transfected with wild-type or mutant AR expression vectors and a luciferase reporter gene regulated by the androgen-responsive elements in the MMTV-LTR, pMMTVLuc (5
, 10)
. The wild-type and mutant ARs showed minimal activity in steroid hormone-free medium but were strongly stimulated (
100-fold induction) by DHT (Fig. 2)
. As shown previously, the T877A (Fig. 2)
and T877S (not shown) mutant ARs were strongly stimulated by hydroxyflutamide at concentrations <100 nM (10)
. This is likely significant in vivo because the serum concentrations achieved in patients are in the micromolar range (11)
. In contrast, the D890N AR was only weakly stimulated at the highest hydroxyflutamide concentration. Therefore, although the functional significance of the D890N mutation is not clear, the results support the conclusion that flutamide treatment selects for AR mutations that are strongly activated by hydroxyflutamide.
|
Both the T877A and T877S mutant ARs are inhibited by bicalutamide, a related nonsteroidal AR antagonist approved recently for prostate cancer treatment (10)
. Therefore, responses to this drug should be demonstrable in vivo in prostate cancer patients with these mutant ARs if they contribute significantly to the disease. Some of the patients studied here were enrolled in a clinical trial of high-dose bicalutamide (150 mg/day) immediately after bone marrow biopsy (17)
. Each of the patients with codon 877 mutations enrolled had responses to the bicalutamide treatment, with their serum PSA levels declining by between 30% and > 99% (Table 1)
. These results indicated that ARs inhibited by bicalutamide, but not flutamide, contributed to tumor progression in these patients. The variability in responses to bicalutamide likely reflects tumor cell heterogeneity in these patients with advanced disease, which would clearly limit the clinical effects from this and other therapies.
Clinical data from this and another bicalutamide trial (17
, 18) showed a significant correlation between PSA responses, clinical responses, and previous flutamide treatment. It is not clear whether this reflects AR mutations in all cases, because responses to bicalutamide were seen in some flutamide-treated patients with wild-type ARs (Table 1
, patients 4 and 5). Because the AR analysis in all patients was based upon a biopsy from a single site, tumor cells at other sites with AR mutations could have contributed to bicalutamide responses in some patients. Alternatively, because hydroxyflutamide, but not bicalutamide, is a weak agonist of the wild-type AR (10)
, mechanisms other that AR mutation may contribute to bicalutamide responses in patients treated previously with flutamide.
| Discussion |
|---|
|
|
|---|
The hydroxyflutamide-activated mutant ARs identified here were all altered in codon 877. In a previous study, we identified two additional flutamide-treated patients with hydroxyflutamide-activated ARs, one with a codon 877 mutation (T877S) and one with a codon 874 mutation (H874Y; Refs. 5 and 10 ). The finding of particular codon 877 mutations in these and other studies (4 , 6) suggests that this functional change can be mediated by only a very limited number of structural changes in the AR. It should also be noted that codon 874 and 877 mutations may provide selective advantages in addition to altering flutamide responses, because both have been identified in cell lines derived from patients not treated with flutamide (CWR22 and LNCaP cells, respectively; Refs. 8 and 21 ). A more weakly hydroxyflutamide-activated mutant AR (V715M) was also identified previously in a patient treated with flutamide (2 , 10) .
These results have several significant implications for the hormonal therapy of PCa: (a) the selection for rare tumor cells with mutant ARs indicates that AR antagonists may improve responses to androgen ablation therapy initially but subsequently accelerate the growth of surviving tumor cells; (b) alternative methods to further block the AR-mediated signaling that appears critical for tumor cell survival, such as targeting AR-associated coactivator proteins, downstream target genes, or signal transduction pathways that interact with the AR, may enhance responses to androgen ablation monotherapy or combined androgen blockade; and (c) the additive or synergistic effects of cytotoxic chemotherapy used early in conjunction with androgen ablation therapy may be very effective if, as this study suggests, only a relatively small number of tumor cells survive combined androgen blockade.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 This work was supported by NIH Grants R01-CA65647 (to S. P. B.) and U10-CA78967 (to M-E. T.), Grant EDT-112 from the American Cancer Society (to G. J. B.), and the Hershey Family Prostate Cancer Research Fund. ![]()
2 To whom requests for reprints should be addressed, at Hematology-Oncology Division, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. Phone (617) 667-0600; Fax: (617) 667-0610; E-mail: sbalk{at}caregroup.harvard.edu ![]()
3 The abbreviations used are: PCa, prostate cancer; AR, androgen receptor; MMTV, mouse mammary tumor virus; UTR, untranslated region; RT-PCR, reverse transcription-PCR; DHT, dihydrotestosterone; PSA, prostate-specific antigen. ![]()
Received 12/15/98. Accepted 4/16/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.-E. Taplin, M. M. Regan, Y.-J. Ko, G. J. Bubley, S. E. Duggan, L. Werner, T. M. Beer, C. W. Ryan, P. Mathew, S.-M. Tu, et al. Phase II Study of Androgen Synthesis Inhibition with Ketoconazole, Hydrocortisone, and Dutasteride in Asymptomatic Castration-Resistant Prostate Cancer Clin. Cancer Res., November 15, 2009; 15(22): 7099 - 7105. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Attar, M. Jure-Kunkel, A. Balog, M. E. Cvijic, J. Dell-John, C. A. Rizzo, L. Schweizer, T. E. Spires, J. S. Platero, M. Obermeier, et al. Discovery of BMS-641988, a Novel and Potent Inhibitor of Androgen Receptor Signaling for the Treatment of Prostate Cancer Cancer Res., August 15, 2009; 69(16): 6522 - 6530. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Steinkamp, O. A. O'Mahony, M. Brogley, H. Rehman, E. W. LaPensee, S. Dhanasekaran, M. D. Hofer, R. Kuefer, A. Chinnaiyan, M. A. Rubin, et al. Treatment-Dependent Androgen Receptor Mutations in Prostate Cancer Exploit Multiple Mechanisms to Evade Therapy Cancer Res., May 15, 2009; 69(10): 4434 - 4442. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shah, J. K. Hess-Wilson, S. Webb, H. Daly, S. Godoy-Tundidor, J. Kim, J. Boldison, Y. Daaka, and K. E. Knudsen 2,2-Bis(4-Chlorophenyl)-1,1-Dichloroethylene Stimulates Androgen Independence in Prostate Cancer Cells through Combinatorial Activation of Mutant Androgen Receptor and Mitogen-Activated Protein Kinase Pathways Mol. Cancer Res., September 1, 2008; 6(9): 1507 - 1520. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Moehren, M. Papaioannou, C. A. Reeb, A. Grasselli, S. Nanni, M. Asim, D. Roell, I. Prade, A. Farsetti, and A. Baniahmad Wild-type but not mutant androgen receptor inhibits expression of the hTERT telomerase subunit: a novel role of AR mutation for prostate cancer development FASEB J, April 1, 2008; 22(4): 1258 - 1267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Hodgson, I. Astapova, A. N. Hollenberg, and S. P. Balk Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors Cancer Res., September 1, 2007; 67(17): 8388 - 8395. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Moehren, M. Papaioannou, C. A. Reeb, W. Hong, and A. Baniahmad Alien Interacts with the Human Androgen Receptor and Inhibits Prostate Cancer Cell Growth Mol. Endocrinol., May 1, 2007; 21(5): 1039 - 1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, Y.-J. Chang, H. Miyamoto, S. Yeh, J. L. Yao, P. A. di Sant'Agnese, M.-Y. Tsai, and C. Chang Suppression of Androgen Receptor Transactivation and Prostate Cancer Cell Growth by Heterogeneous Nuclear Ribonucleoprotein A1 via Interaction with Androgen Receptor Coregulator ARA54 Endocrinology, March 1, 2007; 148(3): 1340 - 1349. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yang, Y.-J. Chang, H. Miyamoto, J. Ni, Y. Niu, Z. Chen, Y.-L. Chen, J. L. Yao, P. A. di Sant'Agnese, and C. Chang Transgelin Functions as a Suppressor via Inhibition of ARA54-Enhanced Androgen Receptor Transactivation and Prostate Cancer Cell Growth Mol. Endocrinol., February 1, 2007; 21(2): 343 - 358. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hess-Wilson, H. K. Daly, W. A. Zagorski, C. P. Montville, and K. E. Knudsen Mitogenic Action of the Androgen Receptor Sensitizes Prostate Cancer Cells to Taxane-Based Cytotoxic Insult Cancer Res., December 15, 2006; 66(24): 11998 - 12008. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Z. Lu, S. E. Wardell, K. L. Burnstein, D. Defranco, P. J. Fuller, V. Giguere, R. B. Hochberg, L. McKay, J.-M. Renoir, N. L. Weigel, et al. International Union of Pharmacology. LXV. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Glucocorticoid, Mineralocorticoid, Progesterone, and Androgen Receptors Pharmacol. Rev., December 1, 2006; 58(4): 782 - 797. [Full Text] [PDF] |
||||
![]() |
Y. B. Wetherill, J. K. Hess-Wilson, C. E.S. Comstock, S. A. Shah, C. R. Buncher, L. Sallans, P. A. Limbach, S. Schwemberger, G. F. Babcock, and K. E. Knudsen Bisphenol A facilitates bypass of androgen ablation therapy in prostate cancer Mol. Cancer Ther., December 1, 2006; 5(12): 3181 - 3190. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Chuan, S.-T. Pang, A. Cedazo-Minguez, G. Norstedt, A. Pousette, and A. Flores-Morales Androgen Induction of Prostate Cancer Cell Invasion Is Mediated by Ezrin J. Biol. Chem., October 6, 2006; 281(40): 29938 - 29948. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yuan, T. Li, H. Wang, T. Zhang, M. Barua, R. A. Borgesi, G. J. Bubley, M. L. Lu, and S. P. Balk Androgen Receptor Remains Critical for Cell-Cycle Progression in Androgen-Independent CWR22 Prostate Cancer Cells Am. J. Pathol., August 1, 2006; 169(2): 682 - 696. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, R. T. Gampe Jr., A. T. Hnat, J. L. Faggart, J. T. Minges, F. S. French, and E. M. Wilson Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity J. Biol. Chem., March 10, 2006; 281(10): 6648 - 6663. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stanbrough, G. J. Bubley, K. Ross, T. R. Golub, M. A. Rubin, T. M. Penning, P. G. Febbo, and S. P. Balk Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer. Cancer Res., March 1, 2006; 66(5): 2815 - 2825. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zheng, C. Cai, J. Omwancha, S.-Y. Chen, T. Baslan, and L. Shemshedini SUMO-3 Enhances Androgen Receptor Transcriptional Activity through a Sumoylation-independent Mechanism in Prostate Cancer Cells J. Biol. Chem., February 17, 2006; 281(7): 4002 - 4012. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Duff and I. J. McEwan Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions Mol. Endocrinol., December 1, 2005; 19(12): 2943 - 2954. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-N. Song and E. P. Gelmann Interaction of {beta}-Catenin and TIF2/GRIP1 in Transcriptional Activation by the Androgen Receptor J. Biol. Chem., November 11, 2005; 280(45): 37853 - 37867. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Ryan and E. J. Small Early Versus Delayed Androgen Deprivation for Prostate Cancer: New Fuel for an Old Debate J. Clin. Oncol., November 10, 2005; 23(32): 8225 - 8231. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. I. Scher and C. L. Sawyers Biology of Progressive, Castration-Resistant Prostate Cancer: Directed Therapies Targeting the Androgen-Receptor Signaling Axis J. Clin. Oncol., November 10, 2005; 23(32): 8253 - 8261. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yoshida, H. Kinoshita, T. Segawa, E. Nakamura, T. Inoue, Y. Shimizu, T. Kamoto, and O. Ogawa Antiandrogen Bicalutamide Promotes Tumor Growth in a Novel Androgen-Dependent Prostate Cancer Xenograft Model Derived from a Bicalutamide-Treated Patient Cancer Res., November 1, 2005; 65(21): 9611 - 9616. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller Antiandrogens prevent stable DNA-binding of the androgen receptor J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. U. Agoulnik, A. Vaid, W. E. Bingman III, H. Erdeme, A. Frolov, C. L. Smith, G. Ayala, M. M. Ittmann, and N. L. Weigel Role of SRC-1 in the Promotion of Prostate Cancer Cell Growth and Tumor Progression Cancer Res., September 1, 2005; 65(17): 7959 - 7967. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Culig, H Steiner, G Bartsch, and A Hobisch Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.C.H. d'Ancona and F.M.J. Debruyne Endocrine approaches in the therapy of prostate carcinoma Hum. Reprod. Update, May 1, 2005; 11(3): 309 - 317. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Pandini, R. Mineo, F. Frasca, C. T. Roberts Jr., M. Marcelli, R. Vigneri, and A. Belfiore Androgens Up-regulate the Insulin-like Growth Factor-I Receptor in Prostate Cancer Cells Cancer Res., March 1, 2005; 65(5): 1849 - 1857. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Han, G. Buchanan, M. Ittmann, J. M. Harris, X. Yu, F. J. DeMayo, W. Tilley, and N. M. Greenberg Mutation of the androgen receptor causes oncogenic transformation of the prostate PNAS, January 25, 2005; 102(4): 1151 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. B. Wetherill, N. L. Fisher, A. Staubach, M. Danielsen, R. W. de Vere White, and K. E. Knudsen Xenoestrogen Action in Prostate Cancer: Pleiotropic Effects Dependent on Androgen Receptor Status Cancer Res., January 1, 2005; 65(1): 54 - 65. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Masiello, S.-Y. Chen, Y. Xu, M. C. Verhoeven, E. Choi, A. N. Hollenberg, and S. P. Balk Recruitment of {beta}-Catenin by Wild-Type or Mutant Androgen Receptors Correlates with Ligand-Stimulated Growth of Prostate Cancer Cells Mol. Endocrinol., October 1, 2004; 18(10): 2388 - 2401. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Biroccio and C. Leonetti Telomerase as a new target for the treatment of hormone-refractory prostate cancer Endocr. Relat. Cancer, September 1, 2004; 11(3): 407 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. I Scher, G. Buchanan, W. Gerald, L. M Butler, and W. D Tilley Targeting the androgen receptor: improving outcomes for castration-resistant prostate cancer Endocr. Relat. Cancer, September 1, 2004; 11(3): 459 - 476. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Foley, D. Hollywood, and M. Lawler Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Nakashiro, S. Hara, Y. Shinohara, M. Oyasu, H. Kawamata, S. Shintani, H. Hamakawa, and R. Oyasu Phenotypic Switch from Paracrine to Autocrine Role of Hepatocyte Growth Factor in an Androgen-Independent Human Prostatic Carcinoma Cell Line, CWR22R Am. J. Pathol., August 1, 2004; 165(2): 533 - 540. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Heinlein and C. Chang Androgen Receptor in Prostate Cancer Endocr. Rev., April 1, 2004; 25(2): 276 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahman, H. Miyamoto, and C. Chang Androgen Receptor Coregulators in Prostate Cancer: Mechanisms and Clinical Implications Clin. Cancer Res., April 1, 2004; 10(7): 2208 - 2219. [Full Text] [PDF] |
||||
![]() |
M. Fu, M. Rao, C. Wang, T. Sakamaki, J. Wang, D. Di Vizio, X. Zhang, C. Albanese, S. Balk, C. Chang, et al. Acetylation of Androgen Receptor Enhances Coactivator Binding and Promotes Prostate Cancer Cell Growth Mol. Cell. Biol., December 1, 2003; 23(23): 8563 - 8575. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hara, K. Nakamura, H. Araki, M. Kusaka, and M. Yamaoka Enhanced Androgen Receptor Signaling Correlates with the Androgen-refractory Growth in a Newly Established MDA PCa 2b-hr Human Prostate Cancer Cell Subline Cancer Res., September 1, 2003; 63(17): 5622 - 5628. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Petre-Draviam, S. L. Cook, C. J. Burd, T. W. Marshall, Y. B. Wetherill, and K. E. Knudsen Specificity of Cyclin D1 for Androgen Receptor Regulation Cancer Res., August 15, 2003; 63(16): 4903 - 4913. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Nelson, A. M. De Marzo, and W. B. Isaacs Prostate Cancer N. Engl. J. Med., July 24, 2003; 349(4): 366 - 381. [Full Text] [PDF] |
||||
![]() |
M.-E. Taplin, B. Rajeshkumar, S. Halabi, C. P. Werner, B. A. Woda, J. Picus, W. Stadler, D. F. Hayes, P. W. Kantoff, N. J. Vogelzang, et al. Androgen Receptor Mutations in Androgen-Independent Prostate Cancer: Cancer and Leukemia Group B Study 9663 J. Clin. Oncol., July 15, 2003; 21(14): 2673 - 2678. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. V. Litvinov, A. M. De Marzo, and J. T. Isaacs Is the Achilles' Heel for Prostate Cancer Therapy a Gain of Function in Androgen Receptor Signaling? J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2972 - 2982. [Full Text] [PDF] |
||||
![]() |
M. M. Rahman, H. Miyamoto, H. Takatera, S. Yeh, S. Altuwaijri, and C. Chang Reducing the Agonist Activity of Antiandrogens by a Dominant-negative Androgen Receptor Coregulator ARA70 in Prostate Cancer Cells J. Biol. Chem., May 23, 2003; 278(22): 19619 - 19626. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Nesslinger, X.-B. Shi, and R. W. deVere White Androgen-independent Growth of LNCaP Prostate Cancer Cells Is Mediated by Gain-of-Function Mutant p53 Cancer Res., May 1, 2003; 63(9): 2228 - 2233. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. de la Taille, M. A. Rubin, M.-W. Chen, F. Vacherot, S. G.-D. de Medina, M. Burchardt, R. Buttyan, and D. Chopin {beta}-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells Clin. Cancer Res., May 1, 2003; 9(5): 1801 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Rahman, H. Miyamoto, H. Lardy, and C. Chang Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells PNAS, April 29, 2003; 100(9): 5124 - 5129. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-N. Song, R. Herrell, S. Byers, S. Shah, E. M. Wilson, and E. P. Gelmann {beta}-Catenin Binds to the Activation Function 2 Region of the Androgen Receptor and Modulates the Effects of the N-Terminal Domain and TIF2 on Ligand-Dependent Transcription Mol. Cell. Biol., March 1, 2003; 23(5): 1674 - 1687. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Lamb, E. Puxeddu, N. Malik, D. L. Stenoien, R. Nigam, G. Y. Saleh, M. Mancini, N. L. Weigel, and M. Marcelli Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation J Androl, March 1, 2003; 24(2): 215 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Balk, Y.-J. Ko, and G. J. Bubley Biology of Prostate-Specific Antigen J. Clin. Oncol., January 15, 2003; 21(2): 383 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hara, J.-i. Miyazaki, H. Araki, M. Yamaoka, N. Kanzaki, M. Kusaka, and M. Miyamoto Novel Mutations of Androgen Receptor: A Possible Mechanism of Bicalutamide Withdrawal Syndrome Cancer Res., January 1, 2003; 63(1): 149 - 153. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Comuzzi, L. Lambrinidis, H. Rogatsch, S. Godoy-Tundidor, N. Knezevic, I. Krhen, Z. Marekovic, G. Bartsch, H. Klocker, A. Hobisch, et al. The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function Am. J. Pathol., January 1, 2003; 162(1): 233 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Adam, J. Kim, J. Lin, A. Orsola, L. Zhuang, D. C. Rice, and M. R. Freeman* Heparin-Binding Epidermal Growth Factor-Like Growth Factor Stimulates Androgen-Independent Prostate Tumor Growth and Antagonizes Androgen Receptor Function Endocrinology, December 1, 2002; 143(12): 4599 - 4608. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. James, I. U. Agoulnik, J. M. Harris, G. Buchanan, W. D. Tilley, M. Marcelli, D. J. Lamb, and N. L. Weigel A Novel Androgen Receptor Mutant, A748T, Exhibits Hormone Concentration-Dependent Defects in Nuclear Accumulation and Activity Despite Normal Hormone-Binding Affinity Mol. Endocrinol., December 1, 2002; 16(12): 2692 - 2705. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-F. Lee, W.-J. Lin, J. Huang, E. M. Messing, F. L. Chan, G. Wilding, and C. Chang Activation of Mitogen-activated Protein Kinase Pathway by the Antiandrogen Hydroxyflutamide in Androgen Receptor-negative Prostate Cancer Cells Cancer Res., November 1, 2002; 62(21): 6039 - 6044. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Masiello, S. Cheng, G. J. Bubley, M. L. Lu, and S. P. Balk Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor J. Biol. Chem., July 12, 2002; 277(29): 26321 - 26326. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Gelmann Molecular Biology of the Androgen Receptor J. Clin. Oncol., July 1, 2002; 20(13): 3001 - 3015. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Godoy-Tundidor, A. Hobisch, K. Pfeil, G. Bartsch, and Z. Culig Acquisition of Agonistic Properties of Nonsteroidal Antiandrogens after Treatment with Oncostatin M in Prostate Cancer Cells Clin. Cancer Res., July 1, 2002; 8(7): 2356 - 2361. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. Krishnan, X.-Y. Zhao, S. Swami, L. Brive, D. M. Peehl, K. R. Ely, and D. Feldman A Glucocorticoid-Responsive Mutant Androgen Receptor Exhibits Unique Ligand Specificity: Therapeutic Implications for Androgen-Independent Prostate Cancer Endocrinology, May 1, 2002; 143(5): 1889 - 1900. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Neckers Heat Shock Protein 90 Inhibition by 17-Allylamino-17- demethoxygeldanamycin: A Novel Therapeutic Approach for Treating Hormone-refractory Prostate Cancer : Commentary re: D. B. Solit et al., 17-Allylamino-17-demethoxygeldanamycin Induces the Degradation of Androgen Receptor and Her-2/neu and Inhibits the Growth of Prostate Cancer Xenografts. Clin. Cancer Res., 8: 986-993, 2002. Clin. Cancer Res., May 1, 2002; 8(5): 962 - 966. [Full Text] [PDF] |
||||
![]() |
D. B. Solit, F. F. Zheng, M. Drobnjak, P. N. Munster, B. Higgins, D. Verbel, G. Heller, W. Tong, C. Cordon-Cardo, D. B. Agus, et al. 17-Allylamino-17-demethoxygeldanamycin Induces the Degradation of Androgen Receptor and HER-2/neu and Inhibits the Growth of Prostate Cancer Xenografts Clin. Cancer Res., May 1, 2002; 8(5): 986 - 993. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. B. Wetherill, C. E. Petre, K. R. Monk, A. Puga, and K. E. Knudsen The Xenoestrogen Bisphenol A Induces Inappropriate Androgen Receptor Activation and Mitogenesis in Prostatic Adenocarcinoma Cells Mol. Cancer Ther., May 1, 2002; 1(7): 515 - 524. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Chang and D. P. McDonnell Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes Mol. Endocrinol., April 1, 2002; 16(4): 647 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-B. Shi, A.-H. Ma, L. Xia, H.-J. Kung, and R. W. de Vere White Functional Analysis of 44 Mutant Androgen Receptors from Human Prostate Cancer Cancer Res., March 1, 2002; 62(5): 1496 - 1502. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Lee, S. M. Ramos, A. Ko, D. Masiello, K. D. Swanson, M. L. Lu, and S. P. Balk AR and ER Interaction with a p21-Activated Kinase (PAK6) Mol. Endocrinol., January 1, 2002; 16(1): 85 - 99. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Chang, P. J. Walther, and D. P. McDonnell Glucocorticoids Manifest Androgenic Activity in a Cell Line Derived from a Metastatic Prostate Cancer Cancer Res., December 1, 2001; 61(24): 8712 - 8717. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Grossmann, H. Huang, and D. J. Tindall Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer J Natl Cancer Inst, November 21, 2001; 93(22): 1687 - 1697. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stanbrough, I. Leav, P. W. L. Kwan, G. J. Bubley, and S. P. Balk Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium PNAS, September 4, 2001; (2001) 191235898. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Taplin and S.-M. Ho The Endocrinology of Prostate Cancer J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3467 - 3477. [Full Text] [PDF] |
||||
![]() |
M. J. Linja, K. J. Savinainen, O. R. Saramäki, T. L. J. Tammela, R. L. Vessella, and T. Visakorpi Amplification and Overexpression of Androgen Receptor Gene in Hormone-Refractory Prostate Cancer Cancer Res., May 1, 2001; 61(9): 3550 - 3555. [Abstract] [Full Text] |
||||
![]() |
G. Buchanan, N. M. Greenberg, H. I. Scher, J. M. Harris, V. R. Marshall, and W. D. Tilley Collocation of Androgen Receptor Gene Mutations in Prostate Cancer Clin. Cancer Res., May 1, 2001; 7(5): 1273 - 1281. [Abstract] [Full Text] |
||||
![]() |
J. S. Sack, K. F. Kish, C. Wang, R. M. Attar, S. E. Kiefer, Y. An, G. Y. Wu, J. E. Scheffler, M. E. Salvati, S. R. Krystek Jr., et al. Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone PNAS, April 24, 2001; 98(9): 4904 - 4909. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mononen, K. Syrjäkoski, M. Matikainen, T. L. J. Tammela, J. Schleutker, O.-P. Kallioniemi, J. Trapman, and P. A. Koivisto Two Percent of Finnish Prostate Cancer Patients Have a Germ-line Mutation in the Hormone-binding Domain of the Androgen Receptor Gene Cancer Res., November 1, 2000; 60(22): 6479 - 6481. [Abstract] [Full Text] |
||||
![]() |
C. I. Truica, S. Byers, and E. P. Gelmann {beta}-Catenin Affects Androgen Receptor Transcriptional Activity and Ligand Specificity Cancer Res., September 1, 2000; 60(17): 4709 - 4713. [Abstract] [Full Text] |
||||
![]() |
S. McDonald, L. Brive, D. B. Agus, H. I. Scher, and K. R. Ely Ligand Responsiveness in Human Prostate Cancer: Structural Analysis of Mutant Androgen Receptors from LNCaP and CWR22 Tumors Cancer Res., May 1, 2000; 60(9): 2317 - 2322. [Abstract] [Full Text] |
||||
![]() |
M. Marcelli, M. Ittmann, S. Mariani, R. Sutherland, R. Nigam, L. Murthy, Y. Zhao, D. DiConcini, E. Puxeddu, A. Esen, et al. Androgen Receptor Mutations in Prostate Cancer Cancer Res., February 1, 2000; 60(4): 944 - 949. [Abstract] [Full Text] |
||||
![]() |
A. Chott, Z. Sun, D. Morganstern, J. Pan, T. Li, M. Susani, I. Mosberger, M. P. Upton, G. J. Bubley, and S. P. Balk Tyrosine Kinases Expressed in Vivo by Human Prostate Cancer Bone Marrow Metastases and Loss of the Type 1 Insulin-Like Growth Factor Receptor Am. J. Pathol., October 1, 1999; 155(4): 1271 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Han, B. A. Foster, S. Mistry, G. Buchanan, J. M. Harris, W. D. Tilley, and N. M. Greenberg Hormone Status Selects for Spontaneous Somatic Androgen Receptor Variants That Demonstrate Specific Ligand and Cofactor Dependent Activities in Autochthonous Prostate Cancer J. Biol. Chem., March 30, 2001; 276(14): 11204 - 11213. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stanbrough, I. Leav, P. W. L. Kwan, G. J. Bubley, and S. P. Balk Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium PNAS, September 11, 2001; 98(19): 10823 - 10828. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |