Cancer Research AACR Membership  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 2511-2515, June 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taplin, M.-E.
Right arrow Articles by Balk, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taplin, M.-E.
Right arrow Articles by Balk, S. P.
[Cancer Research 59, 2511-2515, June 1, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Selection for Androgen Receptor Mutations in Prostate Cancers Treated with Androgen Antagonist1

Mary-Ellen Taplin, Glenn J. Bubley, Yoo-Joung Ko, Eric J. Small, Melissa Upton, Barur Rajeshkumar and Steven P. Balk2

University of Massachusetts Cancer Center, Worcester, Massachusetts 01655 [M-E. T., B. R.]; Cancer Biology Program-Hematology/Oncology Division [G. J. B., S. P. B.], Clinical Investigator Training Program, Beth Israel Deaconess Medical Center-Harvard/Massachusetts Institute of Technology Health Sciences and Technology, in collaboration with Pfizer, Inc. [Y-J. K.], and Pathology Department [M. U.], Beth Israel Deaconess Medical Center, Boston, Massachusetts 02215; and Urologic Oncology Program, University of California at San Francisco-Mount Zion Cancer Center, San Francisco, California 94120 [E. J. S.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The role of androgen receptor (AR) mutations in androgen-independent prostate cancer (PCa) was determined by examining AR transcripts and genes from a large series of bone marrow metastases. Mutations were found in 5 of 16 patients who received combined androgen blockade with the AR antagonist flutamide, and these mutant ARs were strongly stimulated by flutamide. In contrast, the single mutant AR found among 17 patients treated with androgen ablation monotherapy was not flutamide stimulated. Patients with flutamide-stimulated AR mutations responded to subsequent treatment with bicalutamide, an AR antagonist that blocks the mutant ARs. These findings demonstrate that AR mutations occur in response to strong selective pressure from flutamide treatment.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
PCa3 is dependent upon androgen stimulation mediated by the AR, a member of the steroid hormone receptor family of ligand-dependent nuclear receptors. The primary treatment for metastatic PCa is removal of testicular androgens, carried out most often by surgical or medical castration (androgen ablation monotherapy). Many patients are also treated with an AR antagonist (antiandrogen) to block the effects of androgens produced by the adrenal glands (commonly referred to as combined androgen blockade). Although most patients initially respond, all eventually relapse with tumors that are clinically androgen independent (1) . The mechanisms through which these tumors develop androgen independence are not known and may be diverse. Mutations in the AR and amplification of the AR gene have been identified in some androgen-independent prostate cancers (2, 3, 4, 5, 6, 7) , but how and to what extent these changes contribute to the development of androgen-independent PCa remain unclear. This study determined the role of AR mutations in androgen-independent PCa through an analysis of metastatic androgen-independent prostate cancers in bone marrow biopsies from a large series of patients.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Tissue Acquisition.
After informed consent, a bone marrow biopsy was obtained from the posterior iliac crest in patients with androgen-independent PCa, as described previously (5) . Frozen sections were then analyzed histologically for tumor. PCa was identified in the bone marrow biopsies from ~40% of the patients biopsied, and these samples form the basis of this analysis.

RT-PCR Analysis of AR Transcripts.
RNA was extracted from approximately five adjacent frozen sections of 6 µm using RNazol-B (TM Cinna Scientific, Friendswood, TX), and cDNA was synthesized with MMTV reverse transcriptase and an AR antisense primer located in the 3' UTR (GCAAATAGAATTCAGGAACA). PCR amplifications were carried out with Taq DNA polymerase, a sense primer in the ligand binding domain (ACTCCTTTGCAGCCTTGC), and an internal antisense primer in the 3' UTR (ACAGACTGTACATCAATAGAGGAAATTC) for 25 cycles. Secondary PCR amplifications were carried out for 25 cycles with nested 5' (GCTCTAGACTCAATGAACTGGGAGAGAGAC) and 3' UTR (GGCACTGCAGAGGAGTAGTGCAGA) primers, the former introducing an XbaI site. Negative control samples in which the reverse transcriptase step was omitted were included in all amplifications and did not amplify. The PCR products were cloned, and at least five colonies were sequenced. The region sequenced in all clones was from codon 701 through the stop codon. For direct sequencing of uncloned PCR products, the products were purified using a Microcon-100 membrane (Amicon, Beverly, MA).

Genomic DNA Sequencing.
DNA was extracted from four to five adjacent frozen sections by overnight proteinase K digestion, followed by phenol/chloroform extraction. The DNA was PCR amplified using a primer in intron 7 (GAGGCCACCTCCTTGTCAACCCTG) and primers in the 3' UTR of exon 8. The PCR products were purified and directly sequenced as above.

Transient Transfections.
CV-1 cells in 24-well plates were transfected using Lipofectamine according to the manufacturer’s directions (Life Technologies, Inc.). The wild-type AR expression vector, pSV.ARo, was kindly provided by Dr. A. Brinkmann (Erasmus University, Rotterdam, the Netherlands), and mutant ARs were constructed from this as described (5) . The reported plasmid, pMMTVpLuc, was provided by Dr. Richard Pestell (Albert Einstein, New York, NY) and was also described previously (5) . Each transfection was normalized for ß-galactosidase activity from the cotransfected plasmid pSVgal (Promega Corp., Madison, WI). Each well received 20 ng of AR expression vector, 200 ng of pMMTVLuc, and 50 ng of pSVgal. Transfected cells were assayed after 24 h in medium containing charcoal/dextran-stripped FCS (Hyclone, Logan, UT) and the indicated hormone or AR antagonist. All samples were done in quadruplicate, and data shown are representative of at least three experiments.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
AR Mutations Detected by RT-PCR.
Bone marrow is the most frequent site of metastatic PCa and can provide a source of tumor cells uncontaminated with benign prostatic tissue, which also expresses the AR. It was shown previously that the AR gene, which is on the X chromosome, was expressed at very low or undetectable levels in bone marrow biopsies that did not contain histological evidence of tumor (5) . Therefore, RT-PCR was used to amplify the ligand binding domain of AR transcripts derived from tumor cells in histologically PCa-positive biopsies. The PCR products were cloned, and multiple clones (at least five per biopsy) were analyzed by DNA sequencing. All mutations were confirmed by repeating the PCR amplification, cloning, and sequencing of AR transcripts from another aliquot of cDNA.

In the group of 17 evaluable patients treated initially by androgen ablation without an AR antagonist, a single patient with a point mutation was identified (patient 51, aspartate to asparagine in codon 890; Table 1Citation ). As shown by direct sequencing of AR PCR products, this mutation was present in the majority of AR transcripts (Fig. 1A)Citation . Analysis of genomic DNA from peripheral blood lymphocytes confirmed that the D890N change in this patient was a mutation and not a polymorphism (data not shown).


View this table:
[in this window]
[in a new window]

 
Table 1 Androgen receptors in androgen-independent PCa patients

 


View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Direct sequencing of PCR-amplified AR transcripts and genes. A, direct sequencing of RT-PCR products. The region containing the mutation is shown from the positive strand for patient 51 and negative strand for the remaining patients. The wild-type sequence is shown below each panel, and the amino acid encoded by the mutant AR is shown above. B, representative regions of sections used for DNA extraction from the indicated patients. C, direct sequencing of extracted and amplified genomic DNA. The negative strand sequence is shown for each, and the wild-type sequences for codons 890 (patient 51) and 877 (patients 6, 12, and 14) are shown.

 
In contrast, AR mutations were detected in 5 of the 16 evaluable patients who received combined androgen blockade with the AR antagonist flutamide (Table 1)Citation . In all five cases, a mutation in codon 877, ACT (threonine) to GCT (alanine; T877A) was found. In four of these patients, the T877A was the only mutant AR isolated and was found in most or all of the clones sequenced. A second codon 877 mutation, ACT (threonine) to AGT (serine), was identified in one patient (Table 1Citation , patient 14) and represented the majority of clones isolated from this patient. Direct sequencing of uncloned PCR-amplified AR transcripts from patients 2, 6, 12, and 55 confirmed that the T877A mutant represented most of the AR transcripts (Fig. 1A)Citation . Direct sequencing similarly confirmed that the T877S mutant was the major transcript in patient 14.

AR Mutations Detected by Analysis of Genomic DNA.
In four of the patients with mutant ARs, the initial frozen sections contained predominantly tumor (not shown). Therefore, genomic DNA from these biopsies could be readily analyzed to further confirm the RT-PCR-based results and to determine whether the AR mutations were in a large fraction of the tumor cells versus a small fraction expressing high levels of AR message. Further frozen sections were cut from the appropriate blocks and again analyzed histologically, confirming that the sections were largely replaced by tumor (Fig. 1B)Citation . DNA was then extracted from adjacent frozen sections, and a portion of exon 8, containing codons 877 and 890, was amplified with a 5' primer in intron 7 and 3' exon primers and directly sequenced.

The D890N mutation was clearly observed in the DNA from patient 51 (Fig. 1C)Citation , demonstrating that this mutation was present in most or all of the tumor cells. The sequence analysis of genomic DNA from patients 6 and 12 similarly demonstrated that most or all of the tumor cells from these biopsies had the T877A mutant AR (Fig. 1C)Citation . In patient 14, only a minority of the PCR-amplified genomic DNA had the T877S mutation (AGT to ACT on the antisense strand in Fig. 1CCitation ). A larger fraction had the T877A mutation (AGT to AGC on the antisense strand), indicating that tumor cells with the former mutation expressed higher levels of AR transcripts.

Functional Analysis of Mutant ARs.
Mutations in codon 877 were identified previously in advanced PCa from patients (3, 4, 5, 6) and in a PCa cell line, LNCaP (8) . Importantly, functional studies have shown that both the T877A and T877S mutations alter the AR so that hydroxyflutamide, the active metabolite of the AR antagonist flutamide, becomes a strong agonist (8, 9, 10) . Therefore, identification here of these codon 877 mutations in patients who were treated with flutamide suggested that AR mutations resulting in activation by flutamide were positively selected by the drug. The D890N mutation was found in a patient who was not treated with flutamide. This mutant AR was analyzed functionally for its response to hydroxyflutamide in comparison with the wild-type and T877A mutant ARs.

CV-1 cells were transiently transfected with wild-type or mutant AR expression vectors and a luciferase reporter gene regulated by the androgen-responsive elements in the MMTV-LTR, pMMTVLuc (5 , 10) . The wild-type and mutant ARs showed minimal activity in steroid hormone-free medium but were strongly stimulated (~100-fold induction) by DHT (Fig. 2)Citation . As shown previously, the T877A (Fig. 2)Citation and T877S (not shown) mutant ARs were strongly stimulated by hydroxyflutamide at concentrations <100 nM (10) . This is likely significant in vivo because the serum concentrations achieved in patients are in the micromolar range (11) . In contrast, the D890N AR was only weakly stimulated at the highest hydroxyflutamide concentration. Therefore, although the functional significance of the D890N mutation is not clear, the results support the conclusion that flutamide treatment selects for AR mutations that are strongly activated by hydroxyflutamide.



View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Flutamide activation of mutant ARs. Transfected CV-1 cells were stimulated with DHT (100 nM) or hydroxyflutamide at 20, 100, or 500 nM (flutamide). Luciferase activity was determined, corrected for ß-galactosidase activity, and expressed as a percentage of the maximal DHT-induced activity. All points were done in quadruplicate, and the results are the average; bars, ±1 SD. {blacksquare}, wildtype; , T877A; , D890N.

 
Clinical Responses to Secondary Hormonal Therapies.
Some patients treated by androgen ablation in conjunction with flutamide who subsequently develop androgen-independent PCa respond to discontinuation of their flutamide, a phenomena termed the flutamide withdrawal response (12 , 13) . Although flutamide-activated mutant ARs would be expected to result in flutamide withdrawal responses, this response was seen in only one of the five patients with a codon 877 mutation (patient 12, Table 1Citation ). An explanation for the lack of a flutamide withdrawal response in these patients is that these mutant ARs would have had ongoing activation by other steroid hormones, particularly those produced by the adrenals, when flutamide treatment was discontinued (10) . Indeed, suppression of adrenal steroid hormone synthesis with aminoglutethimide has been reported to increase the response to flutamide withdrawal (14, 15, 16) .

Both the T877A and T877S mutant ARs are inhibited by bicalutamide, a related nonsteroidal AR antagonist approved recently for prostate cancer treatment (10) . Therefore, responses to this drug should be demonstrable in vivo in prostate cancer patients with these mutant ARs if they contribute significantly to the disease. Some of the patients studied here were enrolled in a clinical trial of high-dose bicalutamide (150 mg/day) immediately after bone marrow biopsy (17) . Each of the patients with codon 877 mutations enrolled had responses to the bicalutamide treatment, with their serum PSA levels declining by between 30% and > 99% (Table 1)Citation . These results indicated that ARs inhibited by bicalutamide, but not flutamide, contributed to tumor progression in these patients. The variability in responses to bicalutamide likely reflects tumor cell heterogeneity in these patients with advanced disease, which would clearly limit the clinical effects from this and other therapies.

Clinical data from this and another bicalutamide trial (17 , 18) showed a significant correlation between PSA responses, clinical responses, and previous flutamide treatment. It is not clear whether this reflects AR mutations in all cases, because responses to bicalutamide were seen in some flutamide-treated patients with wild-type ARs (Table 1Citation , patients 4 and 5). Because the AR analysis in all patients was based upon a biopsy from a single site, tumor cells at other sites with AR mutations could have contributed to bicalutamide responses in some patients. Alternatively, because hydroxyflutamide, but not bicalutamide, is a weak agonist of the wild-type AR (10) , mechanisms other that AR mutation may contribute to bicalutamide responses in patients treated previously with flutamide.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
These findings provide direct evidence that AR mutations occur in response to selective pressure from AR antagonist treatment and that these mutations contribute to PCa progression after androgen ablation therapy. Most significantly, the selection for rare tumor cells with hydroxyflutamide-stimulated mutant ARs indicates that ongoing AR activity is critical for tumor cell survival after androgen ablation and that mutation of the AR is an important mechanism for achieving this activity in flutamide-treated patients. In contrast, AR mutation appears to be a less important mechanism for maintaining AR stimulation in patients treated with androgen ablation monotherapy, perhaps due to the ability of residual adrenal androgens to provide an adequate level of stimulation through the wild-type AR. Although the use of an AR antagonist appears to significantly alter the mechanisms used by tumor cells to escape from androgen ablation therapy, results from a series of clinical trials comparing androgen ablation monotherapy to combination therapy with flutamide or other AR antagonists have not shown substantial increases in progression-free or overall survival in the combination therapy groups, except perhaps in patients with low-volume disease (19 , 20) .

The hydroxyflutamide-activated mutant ARs identified here were all altered in codon 877. In a previous study, we identified two additional flutamide-treated patients with hydroxyflutamide-activated ARs, one with a codon 877 mutation (T877S) and one with a codon 874 mutation (H874Y; Refs. 5 and 10 ). The finding of particular codon 877 mutations in these and other studies (4 , 6) suggests that this functional change can be mediated by only a very limited number of structural changes in the AR. It should also be noted that codon 874 and 877 mutations may provide selective advantages in addition to altering flutamide responses, because both have been identified in cell lines derived from patients not treated with flutamide (CWR22 and LNCaP cells, respectively; Refs. 8 and 21 ). A more weakly hydroxyflutamide-activated mutant AR (V715M) was also identified previously in a patient treated with flutamide (2 , 10) .

These results have several significant implications for the hormonal therapy of PCa: (a) the selection for rare tumor cells with mutant ARs indicates that AR antagonists may improve responses to androgen ablation therapy initially but subsequently accelerate the growth of surviving tumor cells; (b) alternative methods to further block the AR-mediated signaling that appears critical for tumor cell survival, such as targeting AR-associated coactivator proteins, downstream target genes, or signal transduction pathways that interact with the AR, may enhance responses to androgen ablation monotherapy or combined androgen blockade; and (c) the additive or synergistic effects of cytotoxic chemotherapy used early in conjunction with androgen ablation therapy may be very effective if, as this study suggests, only a relatively small number of tumor cells survive combined androgen blockade.


    ACKNOWLEDGMENTS
 
We thank Suzanne Lee for expert technical assistance, Dr. Bruce Woda for expert pathological review of samples from the University of Massachusetts, and Nicholas Vogelzang and the CALGB prostate cancer committee, through which additional samples were provided.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported by NIH Grants R01-CA65647 (to S. P. B.) and U10-CA78967 (to M-E. T.), Grant EDT-112 from the American Cancer Society (to G. J. B.), and the Hershey Family Prostate Cancer Research Fund. Back

2 To whom requests for reprints should be addressed, at Hematology-Oncology Division, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. Phone (617) 667-0600; Fax: (617) 667-0610; E-mail: sbalk{at}caregroup.harvard.edu Back

3 The abbreviations used are: PCa, prostate cancer; AR, androgen receptor; MMTV, mouse mammary tumor virus; UTR, untranslated region; RT-PCR, reverse transcription-PCR; DHT, dihydrotestosterone; PSA, prostate-specific antigen. Back

Received 12/15/98. Accepted 4/16/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Catalona W. J. Management of cancer of the prostate[see comments]. N. Engl. J. Med., 331: 996-1004, 1994.[Free Full Text]
  2. Culig Z., Hobisch A., Cronauer M. V., Cato A. C., Hittmair A., Radmayr C., Eberle J., Bartsch G., Klocker H. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol. Endocrinol., 7: 1541-1550, 1993.[Abstract/Free Full Text]
  3. Gaddipati J. P., McLeod D. G., Heidenberg H. B., Sesterhenn I. A., Finger M. J., Moul J. W., Srivastava S. Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res., 54: 2861-2864, 1994.[Abstract/Free Full Text]
  4. Suzuki H., Sato N., Watabe Y., Masai M., Seino S., Shimazaki J. Androgen receptor gene mutations in human prostate cancer. J. Steroid Biochem. Mol. Biol., 46: 759-765, 1993.[Medline]
  5. Taplin M. E., Bubley G. J., Shuster T. D., Frantz M. E., Spooner A. E., Ogata G. K., Keer H. N., Balk S. P. Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer[see comments]. N. Engl. J. Med., 332: 1393-1398, 1995.[Abstract/Free Full Text]
  6. Suzuki H., Akakura K., Komiya A., Aida S., Akimoto S., Shimazaki J. Codon 877 mutation in the androgen receptor gene in advanced prostate cancer: relation to antiandrogen withdrawal syndrome. Prostate, 29: 153-158, 1996.[Medline]
  7. Visakorpi T., Hyytinen E., Koivisto P., Tanner M., Keinanen R., Palmberg C., Palotie A., Tammela T., Isola J., Kallioniemi O. P. In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet., 9: 401-406, 1995.[Medline]
  8. Veldscholte J., Ris-Stalpers C., Kuiper G. G., Jenster G., Berrevoets C., Claassen E., van Rooij H. C., Trapman J., Brinkmann A. O., Mulder E. A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem. Biophys. Res. Commun., 173: 534-540, 1990.[Medline]
  9. Veldscholte J., Berrevoets C. A., Brinkmann A. O., Grootegoed J. A., Mulder E. Anti-androgens and the mutated androgen receptor of LNCaP cells: differential effects on binding affinity, heat-shock protein interaction, and transcription activation. Biochemistry, 31: 2393-2399, 1992.[Medline]
  10. Fenton M. A., Shuster T. D., Fertig A. M., Taplin M-E., Kolvenbag G., Bubley G. J., Balk S. P. Functional characterization of mutant androgen receptors from androgen-independent prostate cancer. Clin. Cancer. Res., 3: 1383-1388, 1997.[Abstract]
  11. Belanger A., Giasson M., Couture J., Dupont A., Cusan L., Labrie F. Plasma levels of hydroxy-flutamide in patients with prostatic cancer receiving the combined hormonal therapy: an LHRH agonist and flutamide. Prostate, 12: 79-84, 1988.[Medline]
  12. Scher H. I., Kelly W. K. Flutamide withdrawal syndrome: its impact on clinical trials in hormone-refractory prostate cancer. J. Clin. Oncol., 11: 1566-1572, 1993.[Abstract/Free Full Text]
  13. Small E. J., Srinivas S. The antiandrogen withdrawal syndrome. Experience in a large cohort of unselected patients with advanced prostate cancer. Cancer (Phila.), 76: 1428-1434, 1995.[Medline]
  14. Dupont A., Gomez J. L., Cusan L., Koutsilieris M., Labrie F. Response to flutamide withdrawal in advanced prostate cancer in progression under combination therapy. J. Urol., 150: 908-913, 1993.[Medline]
  15. Sartor O., Cooper M., Weinberger M., Headlee D., Thibault A., Tompkins A., Steinberg S., Figg W. D., Linehan W. M., Myers C. E. Surprising activity of flutamide withdrawal, when combined with aminoglutethimide, in treatment of "hormone-refractory" prostate cancer[published erratum appears in J. Natl. Cancer Inst., 86: 463, 1994]. J. Natl. Cancer Inst., 86: 222-227, 1994.[Abstract/Free Full Text]
  16. Small E. J., Baron A., Bok R. Simultaneous antiandrogen withdrawal and treatment with ketoconazole and hydrocortisone in patients with advanced prostate carcinoma. Cancer (Phila.), 80: 1755-1759, 1997.[Medline]
  17. Joyce R., Fenton M. A., Rode P., Constantine M., Gaynes L., Kolvenbag G., DeWolf W., Balk S., Taplin M. E., Bubley G. J. High dose bicalutamide for androgen independent prostate cancer: effect of prior hormonal therapy. J. Urol., 159: 149-153, 1998.[Medline]
  18. Scher H. I., Liebertz C., Kelly W. K., Mazumdar M., Brett C., Schwartz L., Kolvenbag G., Shapiro L., Schwartz M. Bicalutamide for advanced prostate cancer: the natural versus treated history of disease. J. Clin. Oncol., 15: 2928-2938, 1997.[Abstract]
  19. Caubet J. F., Tosteson T. D., Dong E. W., Naylon E. M., Whiting G. W., Ernstoff M. S., Ross S. D. Maximum androgen blockade in advanced prostate cancer: a meta-analysis of published randomized controlled trials using nonsteroidal antiandrogens. Urology, 49: 71-78, 1997.[Medline]
  20. Eisenberger M. A., Blumenstein B. A., Crawford E. D., Miller G., McLeod D. G., Loehrer P. J., Wilding G., Sears K., Culkin D. J., Thompson I. M., Jr., Bueschen A. J., Lowe B. A. Bilateral orchiectomy with or without flutamide for metastatic prostate cancer. N. Engl. J. Med., 339: 1036-1042, 1998.[Abstract/Free Full Text]
  21. Tan J., Sharief Y., Hamil K. G., Gregory C. W., Zang D. Y., Sar M., Gumerlock P. H., deVere White R. W., Pretlow T. G., Harris S. E, Wilson E. M., Mohler J. L., French F. S. Dehydroepiandrosterone activates mutant androgen receptors expressed in the androgen-dependent human prostate cancer xenograft CWR22 and LNCaP cells. Mol. Endocrinol., 11: 450-459, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
M.-E. Taplin, M. M. Regan, Y.-J. Ko, G. J. Bubley, S. E. Duggan, L. Werner, T. M. Beer, C. W. Ryan, P. Mathew, S.-M. Tu, et al.
Phase II Study of Androgen Synthesis Inhibition with Ketoconazole, Hydrocortisone, and Dutasteride in Asymptomatic Castration-Resistant Prostate Cancer
Clin. Cancer Res., November 15, 2009; 15(22): 7099 - 7105.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. M. Attar, M. Jure-Kunkel, A. Balog, M. E. Cvijic, J. Dell-John, C. A. Rizzo, L. Schweizer, T. E. Spires, J. S. Platero, M. Obermeier, et al.
Discovery of BMS-641988, a Novel and Potent Inhibitor of Androgen Receptor Signaling for the Treatment of Prostate Cancer
Cancer Res., August 15, 2009; 69(16): 6522 - 6530.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. P. Steinkamp, O. A. O'Mahony, M. Brogley, H. Rehman, E. W. LaPensee, S. Dhanasekaran, M. D. Hofer, R. Kuefer, A. Chinnaiyan, M. A. Rubin, et al.
Treatment-Dependent Androgen Receptor Mutations in Prostate Cancer Exploit Multiple Mechanisms to Evade Therapy
Cancer Res., May 15, 2009; 69(10): 4434 - 4442.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
S. Shah, J. K. Hess-Wilson, S. Webb, H. Daly, S. Godoy-Tundidor, J. Kim, J. Boldison, Y. Daaka, and K. E. Knudsen
2,2-Bis(4-Chlorophenyl)-1,1-Dichloroethylene Stimulates Androgen Independence in Prostate Cancer Cells through Combinatorial Activation of Mutant Androgen Receptor and Mitogen-Activated Protein Kinase Pathways
Mol. Cancer Res., September 1, 2008; 6(9): 1507 - 1520.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
U. Moehren, M. Papaioannou, C. A. Reeb, A. Grasselli, S. Nanni, M. Asim, D. Roell, I. Prade, A. Farsetti, and A. Baniahmad
Wild-type but not mutant androgen receptor inhibits expression of the hTERT telomerase subunit: a novel role of AR mutation for prostate cancer development
FASEB J, April 1, 2008; 22(4): 1258 - 1267.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. C. Hodgson, I. Astapova, A. N. Hollenberg, and S. P. Balk
Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors
Cancer Res., September 1, 2007; 67(17): 8388 - 8395.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
U. Moehren, M. Papaioannou, C. A. Reeb, W. Hong, and A. Baniahmad
Alien Interacts with the Human Androgen Receptor and Inhibits Prostate Cancer Cell Growth
Mol. Endocrinol., May 1, 2007; 21(5): 1039 - 1048.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
Z. Yang, Y.-J. Chang, H. Miyamoto, S. Yeh, J. L. Yao, P. A. di Sant'Agnese, M.-Y. Tsai, and C. Chang
Suppression of Androgen Receptor Transactivation and Prostate Cancer Cell Growth by Heterogeneous Nuclear Ribonucleoprotein A1 via Interaction with Androgen Receptor Coregulator ARA54
Endocrinology, March 1, 2007; 148(3): 1340 - 1349.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
Z. Yang, Y.-J. Chang, H. Miyamoto, J. Ni, Y. Niu, Z. Chen, Y.-L. Chen, J. L. Yao, P. A. di Sant'Agnese, and C. Chang
Transgelin Functions as a Suppressor via Inhibition of ARA54-Enhanced Androgen Receptor Transactivation and Prostate Cancer Cell Growth
Mol. Endocrinol., February 1, 2007; 21(2): 343 - 358.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. K. Hess-Wilson, H. K. Daly, W. A. Zagorski, C. P. Montville, and K. E. Knudsen
Mitogenic Action of the Androgen Receptor Sensitizes Prostate Cancer Cells to Taxane-Based Cytotoxic Insult
Cancer Res., December 15, 2006; 66(24): 11998 - 12008.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
N. Z. Lu, S. E. Wardell, K. L. Burnstein, D. Defranco, P. J. Fuller, V. Giguere, R. B. Hochberg, L. McKay, J.-M. Renoir, N. L. Weigel, et al.
International Union of Pharmacology. LXV. The Pharmacology and Classification of the Nuclear Receptor Superfamily: Glucocorticoid, Mineralocorticoid, Progesterone, and Androgen Receptors
Pharmacol. Rev., December 1, 2006; 58(4): 782 - 797.
[Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. B. Wetherill, J. K. Hess-Wilson, C. E.S. Comstock, S. A. Shah, C. R. Buncher, L. Sallans, P. A. Limbach, S. Schwemberger, G. F. Babcock, and K. E. Knudsen
Bisphenol A facilitates bypass of androgen ablation therapy in prostate cancer
Mol. Cancer Ther., December 1, 2006; 5(12): 3181 - 3190.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-C. Chuan, S.-T. Pang, A. Cedazo-Minguez, G. Norstedt, A. Pousette, and A. Flores-Morales
Androgen Induction of Prostate Cancer Cell Invasion Is Mediated by Ezrin
J. Biol. Chem., October 6, 2006; 281(40): 29938 - 29948.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
X. Yuan, T. Li, H. Wang, T. Zhang, M. Barua, R. A. Borgesi, G. J. Bubley, M. L. Lu, and S. P. Balk
Androgen Receptor Remains Critical for Cell-Cycle Progression in Androgen-Independent CWR22 Prostate Cancer Cells
Am. J. Pathol., August 1, 2006; 169(2): 682 - 696.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. He, R. T. Gampe Jr., A. T. Hnat, J. L. Faggart, J. T. Minges, F. S. French, and E. M. Wilson
Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity
J. Biol. Chem., March 10, 2006; 281(10): 6648 - 6663.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Stanbrough, G. J. Bubley, K. Ross, T. R. Golub, M. A. Rubin, T. M. Penning, P. G. Febbo, and S. P. Balk
Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer.
Cancer Res., March 1, 2006; 66(5): 2815 - 2825.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Zheng, C. Cai, J. Omwancha, S.-Y. Chen, T. Baslan, and L. Shemshedini
SUMO-3 Enhances Androgen Receptor Transcriptional Activity through a Sumoylation-independent Mechanism in Prostate Cancer Cells
J. Biol. Chem., February 17, 2006; 281(7): 4002 - 4012.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. Duff and I. J. McEwan
Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions
Mol. Endocrinol., December 1, 2005; 19(12): 2943 - 2954.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-N. Song and E. P. Gelmann
Interaction of {beta}-Catenin and TIF2/GRIP1 in Transcriptional Activation by the Androgen Receptor
J. Biol. Chem., November 11, 2005; 280(45): 37853 - 37867.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
C. J. Ryan and E. J. Small
Early Versus Delayed Androgen Deprivation for Prostate Cancer: New Fuel for an Old Debate
J. Clin. Oncol., November 10, 2005; 23(32): 8225 - 8231.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H. I. Scher and C. L. Sawyers
Biology of Progressive, Castration-Resistant Prostate Cancer: Directed Therapies Targeting the Androgen-Receptor Signaling Axis
J. Clin. Oncol., November 10, 2005; 23(32): 8253 - 8261.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Yoshida, H. Kinoshita, T. Segawa, E. Nakamura, T. Inoue, Y. Shimizu, T. Kamoto, and O. Ogawa
Antiandrogen Bicalutamide Promotes Tumor Growth in a Novel Androgen-Dependent Prostate Cancer Xenograft Model Derived from a Bicalutamide-Treated Patient
Cancer Res., November 1, 2005; 65(21): 9611 - 9616.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
P. Farla, R. Hersmus, J. Trapman, and A. B. Houtsmuller
Antiandrogens prevent stable DNA-binding of the androgen receptor
J. Cell Sci., September 15, 2005; 118(18): 4187 - 4198.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. U. Agoulnik, A. Vaid, W. E. Bingman III, H. Erdeme, A. Frolov, C. L. Smith, G. Ayala, M. M. Ittmann, and N. L. Weigel
Role of SRC-1 in the Promotion of Prostate Cancer Cell Growth and Tumor Progression
Cancer Res., September 1, 2005; 65(17): 7959 - 7967.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
Z Culig, H Steiner, G Bartsch, and A Hobisch
Mechanisms of endocrine therapy-responsive and -unresponsive prostate tumours
Endocr. Relat. Cancer, June 1, 2005; 12(2): 229 - 244.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
F.C.H. d'Ancona and F.M.J. Debruyne
Endocrine approaches in the therapy of prostate carcinoma
Hum. Reprod. Update, May 1, 2005; 11(3): 309 - 317.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Pandini, R. Mineo, F. Frasca, C. T. Roberts Jr., M. Marcelli, R. Vigneri, and A. Belfiore
Androgens Up-regulate the Insulin-like Growth Factor-I Receptor in Prostate Cancer Cells
Cancer Res., March 1, 2005; 65(5): 1849 - 1857.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Han, G. Buchanan, M. Ittmann, J. M. Harris, X. Yu, F. J. DeMayo, W. Tilley, and N. M. Greenberg
Mutation of the androgen receptor causes oncogenic transformation of the prostate
PNAS, January 25, 2005; 102(4): 1151 - 1156.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. B. Wetherill, N. L. Fisher, A. Staubach, M. Danielsen, R. W. de Vere White, and K. E. Knudsen
Xenoestrogen Action in Prostate Cancer: Pleiotropic Effects Dependent on Androgen Receptor Status
Cancer Res., January 1, 2005; 65(1): 54 - 65.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Masiello, S.-Y. Chen, Y. Xu, M. C. Verhoeven, E. Choi, A. N. Hollenberg, and S. P. Balk
Recruitment of {beta}-Catenin by Wild-Type or Mutant Androgen Receptors Correlates with Ligand-Stimulated Growth of Prostate Cancer Cells
Mol. Endocrinol., October 1, 2004; 18(10): 2388 - 2401.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
A. Biroccio and C. Leonetti
Telomerase as a new target for the treatment of hormone-refractory prostate cancer
Endocr. Relat. Cancer, September 1, 2004; 11(3): 407 - 421.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
H. I Scher, G. Buchanan, W. Gerald, L. M Butler, and W. D Tilley
Targeting the androgen receptor: improving outcomes for castration-resistant prostate cancer
Endocr. Relat. Cancer, September 1, 2004; 11(3): 459 - 476.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
R. Foley, D. Hollywood, and M. Lawler
Molecular pathology of prostate cancer: the key to identifying new biomarkers of disease
Endocr. Relat. Cancer, September 1, 2004; 11(3): 477 - 488.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K.-i. Nakashiro, S. Hara, Y. Shinohara, M. Oyasu, H. Kawamata, S. Shintani, H. Hamakawa, and R. Oyasu
Phenotypic Switch from Paracrine to Autocrine Role of Hepatocyte Growth Factor in an Androgen-Independent Human Prostatic Carcinoma Cell Line, CWR22R
Am. J. Pathol., August 1, 2004; 165(2): 533 - 540.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. A. Heinlein and C. Chang
Androgen Receptor in Prostate Cancer
Endocr. Rev., April 1, 2004; 25(2): 276 - 308.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Rahman, H. Miyamoto, and C. Chang
Androgen Receptor Coregulators in Prostate Cancer: Mechanisms and Clinical Implications
Clin. Cancer Res., April 1, 2004; 10(7): 2208 - 2219.
[Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Fu, M. Rao, C. Wang, T. Sakamaki, J. Wang, D. Di Vizio, X. Zhang, C. Albanese, S. Balk, C. Chang, et al.
Acetylation of Androgen Receptor Enhances Coactivator Binding and Promotes Prostate Cancer Cell Growth
Mol. Cell. Biol., December 1, 2003; 23(23): 8563 - 8575.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Hara, K. Nakamura, H. Araki, M. Kusaka, and M. Yamaoka
Enhanced Androgen Receptor Signaling Correlates with the Androgen-refractory Growth in a Newly Established MDA PCa 2b-hr Human Prostate Cancer Cell Subline
Cancer Res., September 1, 2003; 63(17): 5622 - 5628.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. E. Petre-Draviam, S. L. Cook, C. J. Burd, T. W. Marshall, Y. B. Wetherill, and K. E. Knudsen
Specificity of Cyclin D1 for Androgen Receptor Regulation
Cancer Res., August 15, 2003; 63(16): 4903 - 4913.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
W. G. Nelson, A. M. De Marzo, and W. B. Isaacs
Prostate Cancer
N. Engl. J. Med., July 24, 2003; 349(4): 366 - 381.
[Full Text] [PDF]


Home page
JCOHome page
M.-E. Taplin, B. Rajeshkumar, S. Halabi, C. P. Werner, B. A. Woda, J. Picus, W. Stadler, D. F. Hayes, P. W. Kantoff, N. J. Vogelzang, et al.
Androgen Receptor Mutations in Androgen-Independent Prostate Cancer: Cancer and Leukemia Group B Study 9663
J. Clin. Oncol., July 15, 2003; 21(14): 2673 - 2678.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
I. V. Litvinov, A. M. De Marzo, and J. T. Isaacs
Is the Achilles' Heel for Prostate Cancer Therapy a Gain of Function in Androgen Receptor Signaling?
J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 2972 - 2982.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. M. Rahman, H. Miyamoto, H. Takatera, S. Yeh, S. Altuwaijri, and C. Chang
Reducing the Agonist Activity of Antiandrogens by a Dominant-negative Androgen Receptor Coregulator ARA70 in Prostate Cancer Cells
J. Biol. Chem., May 23, 2003; 278(22): 19619 - 19626.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. J. Nesslinger, X.-B. Shi, and R. W. deVere White
Androgen-independent Growth of LNCaP Prostate Cancer Cells Is Mediated by Gain-of-Function Mutant p53
Cancer Res., May 1, 2003; 63(9): 2228 - 2233.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. de la Taille, M. A. Rubin, M.-W. Chen, F. Vacherot, S. G.-D. de Medina, M. Burchardt, R. Buttyan, and D. Chopin
{beta}-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells
Clin. Cancer Res., May 1, 2003; 9(5): 1801 - 1807.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. M. Rahman, H. Miyamoto, H. Lardy, and C. Chang
Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells
PNAS, April 29, 2003; 100(9): 5124 - 5129.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L.-N. Song, R. Herrell, S. Byers, S. Shah, E. M. Wilson, and E. P. Gelmann
{beta}-Catenin Binds to the Activation Function 2 Region of the Androgen Receptor and Modulates the Effects of the N-Terminal Domain and TIF2 on Ligand-Dependent Transcription
Mol. Cell. Biol., March 1, 2003; 23(5): 1674 - 1687.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
D. J. Lamb, E. Puxeddu, N. Malik, D. L. Stenoien, R. Nigam, G. Y. Saleh, M. Mancini, N. L. Weigel, and M. Marcelli
Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation
J Androl, March 1, 2003; 24(2): 215 - 225.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
S. P. Balk, Y.-J. Ko, and G. J. Bubley
Biology of Prostate-Specific Antigen
J. Clin. Oncol., January 15, 2003; 21(2): 383 - 391.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Hara, J.-i. Miyazaki, H. Araki, M. Yamaoka, N. Kanzaki, M. Kusaka, and M. Miyamoto
Novel Mutations of Androgen Receptor: A Possible Mechanism of Bicalutamide Withdrawal Syndrome
Cancer Res., January 1, 2003; 63(1): 149 - 153.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. Comuzzi, L. Lambrinidis, H. Rogatsch, S. Godoy-Tundidor, N. Knezevic, I. Krhen, Z. Marekovic, G. Bartsch, H. Klocker, A. Hobisch, et al.
The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function
Am. J. Pathol., January 1, 2003; 162(1): 233 - 241.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Adam, J. Kim, J. Lin, A. Orsola, L. Zhuang, D. C. Rice, and M. R. Freeman*
Heparin-Binding Epidermal Growth Factor-Like Growth Factor Stimulates Androgen-Independent Prostate Tumor Growth and Antagonizes Androgen Receptor Function
Endocrinology, December 1, 2002; 143(12): 4599 - 4608.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
A. J. James, I. U. Agoulnik, J. M. Harris, G. Buchanan, W. D. Tilley, M. Marcelli, D. J. Lamb, and N. L. Weigel
A Novel Androgen Receptor Mutant, A748T, Exhibits Hormone Concentration-Dependent Defects in Nuclear Accumulation and Activity Despite Normal Hormone-Binding Affinity
Mol. Endocrinol., December 1, 2002; 16(12): 2692 - 2705.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-F. Lee, W.-J. Lin, J. Huang, E. M. Messing, F. L. Chan, G. Wilding, and C. Chang
Activation of Mitogen-activated Protein Kinase Pathway by the Antiandrogen Hydroxyflutamide in Androgen Receptor-negative Prostate Cancer Cells
Cancer Res., November 1, 2002; 62(21): 6039 - 6044.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Masiello, S. Cheng, G. J. Bubley, M. L. Lu, and S. P. Balk
Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor
J. Biol. Chem., July 12, 2002; 277(29): 26321 - 26326.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
E. P. Gelmann
Molecular Biology of the Androgen Receptor
J. Clin. Oncol., July 1, 2002; 20(13): 3001 - 3015.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Godoy-Tundidor, A. Hobisch, K. Pfeil, G. Bartsch, and Z. Culig
Acquisition of Agonistic Properties of Nonsteroidal Antiandrogens after Treatment with Oncostatin M in Prostate Cancer Cells
Clin. Cancer Res., July 1, 2002; 8(7): 2356 - 2361.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. V. Krishnan, X.-Y. Zhao, S. Swami, L. Brive, D. M. Peehl, K. R. Ely, and D. Feldman
A Glucocorticoid-Responsive Mutant Androgen Receptor Exhibits Unique Ligand Specificity: Therapeutic Implications for Androgen-Independent Prostate Cancer
Endocrinology, May 1, 2002; 143(5): 1889 - 1900.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Neckers
Heat Shock Protein 90 Inhibition by 17-Allylamino-17- demethoxygeldanamycin: A Novel Therapeutic Approach for Treating Hormone-refractory Prostate Cancer : Commentary re: D. B. Solit et al., 17-Allylamino-17-demethoxygeldanamycin Induces the Degradation of Androgen Receptor and Her-2/neu and Inhibits the Growth of Prostate Cancer Xenografts. Clin. Cancer Res., 8: 986-993, 2002.
Clin. Cancer Res., May 1, 2002; 8(5): 962 - 966.
[Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
D. B. Solit, F. F. Zheng, M. Drobnjak, P. N. Munster, B. Higgins, D. Verbel, G. Heller, W. Tong, C. Cordon-Cardo, D. B. Agus, et al.
17-Allylamino-17-demethoxygeldanamycin Induces the Degradation of Androgen Receptor and HER-2/neu and Inhibits the Growth of Prostate Cancer Xenografts
Clin. Cancer Res., May 1, 2002; 8(5): 986 - 993.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
Y. B. Wetherill, C. E. Petre, K. R. Monk, A. Puga, and K. E. Knudsen
The Xenoestrogen Bisphenol A Induces Inappropriate Androgen Receptor Activation and Mitogenesis in Prostatic Adenocarcinoma Cells
Mol. Cancer Ther., May 1, 2002; 1(7): 515 - 524.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C.-Y. Chang and D. P. McDonnell
Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes
Mol. Endocrinol., April 1, 2002; 16(4): 647 - 660.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X.-B. Shi, A.-H. Ma, L. Xia, H.-J. Kung, and R. W. de Vere White
Functional Analysis of 44 Mutant Androgen Receptors from Human Prostate Cancer
Cancer Res., March 1, 2002; 62(5): 1496 - 1502.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. R. Lee, S. M. Ramos, A. Ko, D. Masiello, K. D. Swanson, M. L. Lu, and S. P. Balk
AR and ER Interaction with a p21-Activated Kinase (PAK6)
Mol. Endocrinol., January 1, 2002; 16(1): 85 - 99.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-Y. Chang, P. J. Walther, and D. P. McDonnell
Glucocorticoids Manifest Androgenic Activity in a Cell Line Derived from a Metastatic Prostate Cancer
Cancer Res., December 1, 2001; 61(24): 8712 - 8717.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. E. Grossmann, H. Huang, and D. J. Tindall
Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer
J Natl Cancer Inst, November 21, 2001; 93(22): 1687 - 1697.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Stanbrough, I. Leav, P. W. L. Kwan, G. J. Bubley, and S. P. Balk
Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium
PNAS, September 4, 2001; (2001) 191235898.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. E. Taplin and S.-M. Ho
The Endocrinology of Prostate Cancer
J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3467 - 3477.
[Full Text] [PDF]


Home page
Cancer Res.Home page
M. J. Linja, K. J. Savinainen, O. R. Saramäki, T. L. J. Tammela, R. L. Vessella, and T. Visakorpi
Amplification and Overexpression of Androgen Receptor Gene in Hormone-Refractory Prostate Cancer
Cancer Res., May 1, 2001; 61(9): 3550 - 3555.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
G. Buchanan, N. M. Greenberg, H. I. Scher, J. M. Harris, V. R. Marshall, and W. D. Tilley
Collocation of Androgen Receptor Gene Mutations in Prostate Cancer
Clin. Cancer Res., May 1, 2001; 7(5): 1273 - 1281.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. S. Sack, K. F. Kish, C. Wang, R. M. Attar, S. E. Kiefer, Y. An, G. Y. Wu, J. E. Scheffler, M. E. Salvati, S. R. Krystek Jr., et al.
Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone
PNAS, April 24, 2001; 98(9): 4904 - 4909.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Mononen, K. Syrjäkoski, M. Matikainen, T. L. J. Tammela, J. Schleutker, O.-P. Kallioniemi, J. Trapman, and P. A. Koivisto
Two Percent of Finnish Prostate Cancer Patients Have a Germ-line Mutation in the Hormone-binding Domain of the Androgen Receptor Gene
Cancer Res., November 1, 2000; 60(22): 6479 - 6481.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
C. I. Truica, S. Byers, and E. P. Gelmann
{beta}-Catenin Affects Androgen Receptor Transcriptional Activity and Ligand Specificity
Cancer Res., September 1, 2000; 60(17): 4709 - 4713.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
S. McDonald, L. Brive, D. B. Agus, H. I. Scher, and K. R. Ely
Ligand Responsiveness in Human Prostate Cancer: Structural Analysis of Mutant Androgen Receptors from LNCaP and CWR22 Tumors
Cancer Res., May 1, 2000; 60(9): 2317 - 2322.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Marcelli, M. Ittmann, S. Mariani, R. Sutherland, R. Nigam, L. Murthy, Y. Zhao, D. DiConcini, E. Puxeddu, A. Esen, et al.
Androgen Receptor Mutations in Prostate Cancer
Cancer Res., February 1, 2000; 60(4): 944 - 949.
[Abstract] [Full Text]


Home page
Am. J. Pathol.Home page
A. Chott, Z. Sun, D. Morganstern, J. Pan, T. Li, M. Susani, I. Mosberger, M. P. Upton, G. J. Bubley, and S. P. Balk
Tyrosine Kinases Expressed in Vivo by Human Prostate Cancer Bone Marrow Metastases and Loss of the Type 1 Insulin-Like Growth Factor Receptor
Am. J. Pathol., October 1, 1999; 155(4): 1271 - 1279.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Han, B. A. Foster, S. Mistry, G. Buchanan, J. M. Harris, W. D. Tilley, and N. M. Greenberg
Hormone Status Selects for Spontaneous Somatic Androgen Receptor Variants That Demonstrate Specific Ligand and Cofactor Dependent Activities in Autochthonous Prostate Cancer
J. Biol. Chem., March 30, 2001; 276(14): 11204 - 11213.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Stanbrough, I. Leav, P. W. L. Kwan, G. J. Bubley, and S. P. Balk
Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium
PNAS, September 11, 2001; 98(19): 10823 - 10828.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taplin, M.-E.
Right arrow Articles by Balk, S. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taplin, M.-E.
Right arrow Articles by Balk, S. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online