Cancer Research Grants  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 2825-2828, June 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kristensen, V. N.
Right arrow Articles by Børresen-Dale, A.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kristensen, V. N.
Right arrow Articles by Børresen-Dale, A.-L.
[Cancer Research 59, 2825-2828, June 15, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

CYP17 and Breast Cancer Risk

The Polymorphism in the 5' Flanking Area of the Gene Does Not Influence Binding to Sp-11

Vessela Nedelcheva Kristensen2, Ellen K. Haraldsen, Kristin B. Anderson, P. E. Lønning, Bjørn Erikstein, Rolf Kåresen, Odd S. Gabrielsen and Anne-Lise Børresen-Dale

Department of Genetics [V. N. K., E. K. H., A-L. B-D.] and Department of Oncology [B. E.], Institute of Cancer Research, the Norwegian Radium Hospital, University Clinic, Montebello 0310, Oslo; Department of Biochemistry, University of Oslo, Oslo 0316 [K. B. A., O. S. G.]; Department of Oncology, Haukeland Hospital, 5021 Bergen [P. E. L.]; and Department of Oncology, Ullevål Hospital, Oslo 0407 [R. K.], Norway.


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The ability of a motif of the CYP17 5' untranslated region, created by a polymorphic T to C substitution, to bind to the human transcription factor Sp-1 was investigated. No binding of any of the polymorphic alleles was observed in electromobility shift assay. No other sequence within +1 to +100 of each of the CYP17 alleles formed complex with the Sp-1 or enhanced binding to the polymorphic CACC box. Genotyping of 510 breast cancer patients and 201 controls revealed no difference in genotype frequencies. Age at onset, tumor grade, lymph node status and distant metastases, stage, and estrogen and progesterone receptor status were not associated with the CYP17 genotype.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cytochrome P450c17 is a key enzyme in the sex steroid synthesis (1) . The enzyme catalyzes the 17{alpha}-hydroxylation of pregnenolone and progesterone. The same enzyme also catalyzes the conversion of C21 steroids to C17. Both activities are required for androgen and estrogen synthesis (1 , 2) . A role for estrogen in human breast carcinogenesis is supported by epidemiological risk factors, as well as by recent studies linking plasma estrogen levels to breast cancer risk. (3 , 4 ; reviewed in Ref. 5 ). It has been hypothesized that the 17{alpha}-hydroxylase/17,20lyase activity may be at least one of the biochemical determinants of these phenomena. CYP17, the gene coding for this enzyme, maps to chromosome 10 and contains eight exons and seven introns (6) . A polymorphism (a T-C substitution) in the 5' UTR3 , at +27 relative to the start of transcription, has been described (7 , 8) . Feigelson et al. (8) demonstrated that the C (A2) allele was more frequent in postmenopausal patients with advanced breast cancer than in controls and suggested this variant to be associated with an increased risk of the disease. In a recent study, the variant A2 allele was found to be associated with higher serum hormone levels in young healthy individuals (9) . The substitution has several times been discussed to create a putative Sp-1 binding site (CCACT-CCACC), thus providing a mechanism for higher expression of the variant allele (8 , 9) . The constitutive transcription factor Sp-1 plays a role in the transcription of numerous cellular genes, including constitutive housekeeping genes, as well as inducible genes. Transcription factor Sp-1 (initially isolated from human HeLa cell lines) binds to some, but not all, hexanucleotide GGGCGG (GC box) sequences (10) . Sp1-responsive promoters often contain multiple Sp-1 binding sites (11) . A CACC box upstream of the human embryonic {varepsilon} globin gene has also been shown to bind to Sp-1 in vitro and in vivo (12) . Therefore, it has been repeatedly suggested that the T-C polymorphism of CYP17 converting the sequence CACT into CACC may create such a site (8 , 9) and provide a mechanism for higher level of expression of the variant A2 allele. However, this possibility has never been verified experimentally.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Case and Control Population.
Leukocyte DNA samples from a total number of 510 breast cancer patients were genotyped. Samples were collected from patients admitted to the Norwegian Radium Hospital, Ullevål Hospital (Oslo, Norway), and Haukeland Hospital (Bergen, Norway). The patient cohorts have been described previously (13 , 14) . Mean age at diagnosis for the total group was 59 (range, 27–91). Tumor and lymph node status were based on the pathology reports according to the WHO tumor-node-metastasis classification from 1988. The frequencies of the CYP17 polymorphic alleles of the breast cancer patients were compared with the frequencies found in the series of 201 Norwegian control samples. The controls were healthy female individuals obtained through the Norwegian Population Registry as a population-based series of women ages 20–44.

Genotyping.
Genotyping of the CYP17, 5' UTR polymorphism was performed using forward primer 5'CATTCGCACCTCTGGAGTC3' and reverse primer 5'GGCTCTTGGGGTACTTG3' with PCR parameters, as described previously (8) . PCR was performed in 25-µl reaction volumes on a Perkin Elmer 9600 thermocycler using 96-well microtiter plates. After the PCR reaction, restriction enzyme MspAI (2 units/reaction; Promega) and 10 x restriction enzyme buffer were added using a multichannel pipette directly to the microtiter plates to a final volume of 50 µl/well. Plates were incubated at 37°C overnight, and 10 µl of the restriction mix of all 96 samples were analyzed by standard electrophoresis on a single agarose gel, 3% NuSieve3:1 (FMC).

EMSA.
The following DNA probes were used in this study: Sp-1-consensus: 5'GATCATATCTGCGGGGCGGGGCAGACACAG3'; CYP17-A120mer: 5'CTTCTACTCCACTGCTGTCT3'; CYP17-A220mer: 5'CTTCTACTCCACCGCTGTCT3'; CYP17-A1100mer:5'GTTGCCACAGCTCTTCTACTCCACTGCTGTCTATCTTGCCTGCCGGCACCCAGCCACCATGTGGGAGCTCGTGGCTCTCTTGCTGCTTACCCTAGCTTA3'; CYP17-A2100mer:5'GTTGCCACAGCTCTTCTACTCCACCGCTGTCTATCTTGCCTGCCGGCACCCAGCCACCATGTGGGAGCTCGTGGCTCTCTTGCTGCTTACCCTAGCTTA3'; {varepsilon}-globCCACC: 5'ACCTGACTCCACCCCTGAGG3' from Ref. 12 ; {varepsilon}-globCCACT: 5'ACCTGACTCCACTCCTGAGG3' mutated.

Gel mobility shift assay was performed as described (15) . Oligos for EMSA had been end-labeled with T4 polymucloetide kinase (Pharmacia Biotech, Uppsala, Sweden), annealed, and purified as described (15) . One unit of recombinant Sp-1 protein (1 µl; Promega) was mixed with 1 pmol purified 32P end-labeled DNA probe, 0.5 unit poly(dI-dC) (Pharmacia Biotech), and reaction buffer H, according to Oelgeschlager et al. (15) , in a final volume of 20 µl. The binding reaction was allowed to proceed for 30 min either at room temperature or on ice. The reaction mixture was then run on a 5% polyacrylamide gel (1:37,5; BioRad) for approximately 1.5 h at 16°C. Protein-DNA complexes were visualized by autoradiography with intensifying screen overnight at -70°C.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We have investigated the ability of motifs of CYP17 5' UTR, containing the T-C polymorphic site, to bind to human transcription factor Sp-1 in vitro. 32P end-labeled oligonucleotides, 20 bp long, corresponding to each of the alleles [A1 (CACT) and A2 (CACC)], were incubated with recombinant Sp-1 protein and analyzed by EMSA. The incubation mix was run on an EMSA gel and compared with the binding of the protein to an Sp-1 consensus sequence (GGGCCGG box). No binding of any of the motifs corresponding to the CYP17 polymorphic alleles (A1 or A2) was observed under the given experimental conditions (Fig. 1Citation , Lanes 1–4) in contrast to a strong binding to the Sp-1 consensus sequence (GGGCCGG; Fig. 1Citation , Lanes 7 and 8). To verify that under the same experimental conditions binding to sequence similar to that of the A2 allele (CACC) can be observed, a sequence containing a CACC box, previously shown to bind transcription factor Sp-1 (12) , was used as another Sp-1 consensus sequence. A 20-nucleotide long sequence from the human {varepsilon} globin promoter, containing the CACC box (12) , identical to the one found on the A2 allele of CYP17 (CACC), did bind Sp-1 under our experimental conditions (Fig. 1Citation , Lanes 5 and 6 and Fig. 2Citation , Lanes 1 and 2). It could be, therefore, concluded that the negative result in the case of CYP17 was not due to failure in the experimental design. Furthermore, a single C-T substitution in the CACC box in the human {varepsilon} globin promoter leading to the formation of a CACT motif, in analogy to the A1 allele of CYP17, abrogated this binding (Fig. 2Citation , Lanes 3 and 4).



View larger version (38K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. EMSA of the polymorphic CYP17 5' UTR. Purified 32P end-labeled DNA probes were incubated with and without recombinant Sp-1 protein, (Lanes 2, 4, 6 and 8 and Lanes 1, 3, 5 and 7, respectively). The binding reaction was allowed to proceed 30 min on ice. The reaction mixture was run on a 5% 1:37.5 polyacrylamide gel (BioRad) for approximately 1.5 h at 16°C. Lanes 1 and 2, CYP17-A120mer; Lanes 3 and 4, CYP17-A220mer; Lanes 5 and 6, Sp-1 {varepsilon}-glob; Lanes 7 and 8, Sp-1cons.

 


View larger version (50K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. EMSA of normal and mutated human {varepsilon} globin promoter and a 100-bp long fragment of CYP17 5' UTR, including the promoter sequence and polymorphic alleles. Purified 32P-end-labeled DNA probes were incubated with and without recombinant Sp-1 protein, (Lanes 2, 4, 6 and 8 and Lanes 1, 3, 5 and 7, respectively). Lanes 1 and 2, Sp-1 {varepsilon}-glob; Lanes 3 and 4, Sp-1 {varepsilon}-glob-mut; Lanes 5 and 6, CYP17-A1100mer; Lanes 7 and 8, CYP17-A2100mer.

 
To examine the role of the sequences further upstream and downstream of the studied putative Sp-1 box in the A2 allele, we repeated the experiment with a longer sequence from both alleles. Two different 100mers spanning from the promotor sequence 100 nucleotides downstream into the coding sequence, including several other putative CACC binding sites. None of these probes formed complexes with Sp-1 transcription factor (Fig. 2Citation , Lanes 5–8).

Thus, given these experimental conditions, under which we were able to reproduce the Sp-1 binding to the {varepsilon} globin promoter area from Yu et al. (12) , we failed to observe an interaction between Sp-1 and the polymorphic CYP17 5' UTR sequence. A comparison of the 20-nucleotide long sequence of the human {varepsilon}-globin promoter with that of CYP17 ' UTR (Fig. 3)Citation reveals a stretch of 12 nucleotides (ACTCCACCC/GCTG) of which 11, including the CACC box, are identical.



View larger version (12K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Alignment of the 20-nucleotide long sequence of the human {varepsilon}-globin promoter with that of CYP17' UTR.

 
The genotype distribution of the CYP17 polymorphism in Norwegian breast cancer patients and healthy controls is shown in Table 1Citation . The allele frequencies in the control population, as well as in patients, did not deviate from Hardy-Weinberg equilibrium. No difference in the allele distribution was observed between cases and controls (P = 0.755). When analyzing the genotypes according to premenopausal (<45 years of age) and postmenopausal (>55 years of age), individuals homozygous for A2A2 were found to be almost twice as frequent in the older patients group (>55 years of age) compared with the younger patients (<45 years; 15.2% versus 8%, respectively). This trend was in agreement with the data from Feigelson et al. (8) , but the difference was not statistically significant (P = 0.16). The same nonsignificant trend was seen for patients >55 years at diagnosis with advanced stage of the disease. When comparing postmenopausal patients (>55 years of age) with stage III and IV to premenopausal patients with stage I and II (<45 years), A2A2 carriers were found more frequent among the older patients with advanced stage of disease (18.3% versus 9.2%). This difference was, however, not statistically significant (P = 0.23). There was no association between any of the CYP17 genotypes and age of disease, lymph node status, and estrogen or progesterone status of the tumors (results not shown).


View this table:
[in this window]
[in a new window]

 
Table 1 Distribution of genotypes of the CYP17 5'UTR polymorphism in breast cancer patients and healthy controls. Relationship to stage of the disease and age of the patients at diagnosis.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
No binding of human Sp-1 recombinant protein to a 20mer sequence containing the polymorphic site of CYP17 was observed, although binding to another similar sequence in the {varepsilon}-globin gene was demonstrated. The fact that a substitution of the last C in the CACC box in the {varepsilon}-globin gene with a T abrogates the binding suggests that the CACC box is a necessary, although not sufficient determinant of Sp-1 binding. A comparison of the 20-nucleotide sequence of the human {varepsilon} globin promoter with that of the CYP17 5' UTR shows that the C immediately after the CACC box in {varepsilon}-globin gene, which is a G at the same position in sequence of CYP17, is the most likely candidate to contribute to the observed difference. Because multimer links of Sp-1 had been described to act in synergism for which DNA looping is essential (11) , the protein-DNA complex formation of a larger motif of 100 nucleotides, including both the polymorphic site and the promoter region, was studied. No complex formation of Sp-1 with these long stretches, containing further putative Sp-1 boxes, of either of the polymorphic sequences was observed.

The A2 allele of CYP17 has previously been found to be more frequent among postmenopausal women with advanced breast cancer compared with controls (8) . In this study, a nonsignificant trend was observed for a higher frequency of the A2A2 genotype among patients with age at diagnosis above 55 years versus patients with age at diagnosis below 45 years of age. When stratifying the patients similarly to previous studies (8) , the same nonsignificant trend was observed for postmenopausal patients with higher stage of the disease (stage III and IV) versus premenopausal patients with stage I and II disease. The A2A2 genotype is infrequent, which leads to small size of the compared groups and low statistical power. In addition, a very small portion of the patients in our cohort was with distant metastases (3.5%). If the A2 allele is associated with a metastatic phenotype, as shown by Feigelson et al. (8) , it would not have been detected in our study. Additional studies are necessary to clarify the association of the A2 allele with metastatical breast cancer. Elevated estrogen levels throughout the premenopausal period was a suggested explanation of the observed association between the A2 allele and a higher risk of advanced breast cancer in elderly patients (8) . It was unclear why elevated estrogen levels should not confer a high-risk phenotype already earlier in life. While this manuscript was in preparation, other studies reported no association between the CYP17 genotype and risk of breast cancer (16, 17, 18) . However, these studies, discuss repeatedly the possible creation of Sp-1 site in the A2 genotype, without testing this experimentally. We report a negative result. Additional studies are needed to find out whether the A2 allele confers specifically a higher expression level of CYP17.

Cytochrome P450c17 is encoded by a single gene (CYP17) in mammals (6) . The enzyme has a bifunctional active site: one catalytic center performs the 17{alpha}-hydroxylation of pregnenolone and progesterone and another, the 17,20-lyase activity, is responsible for the conversions of 17{alpha}-hydroxypregnenolone to dihydroepiandrosterone and 17{alpha}-hydroxyprogesterone to androstenedione, precursors of testosterone and estrogens (17 , 18) . In the adrenal glands the bulk of 17{alpha}-hydroxypregnenolone and 17OH progesterone is used in glucocorticoid production with minor fractions ending as difydroepiandrosterone and androstenedione (19) . A single event of upregulation of transcription by Sp-1 binding, which was discussed as a possible phenotype of the T to C polymorphism of CYP17, would be expected to lead to up-regulation of both activities and have as a consequence overproduction of glucocorticoids. An interesting example is the failure of an aromatase inhibitor, aminoglutethimide, to block ovarian hormone production due to compensatory increase in the gonadotropin levels (20) . The adrenal CYP17 expresses considerable 17{alpha}-hydroxylase activity, but little 17,20 lyase activity, suggesting tissue-specific regulation of gene expression (2) . Differential regulation of both activities is further supported by evidence that the 17,20 lyase activity, which yields precursors to testosterone and estradiol, is developmentally stimulated during puberty (19) . Ovarian theca cells express high levels of 17, 20 lyase activity during the reproductive period, suggesting tissue specific regulation of CYP17. It would be of interest to search for interactions of the polymorphism in the 5' flanking area of CYP17 with tissue-specific transcription factors other than the relatively ubiquitous Sp-1, which are present in the ovarian theca cells, but absent in the adrenal tissues.

We report that the T-C polymorphism does not create a binding site for Sp-1. There was no observed difference in distribution of the different alleles among 201 healthy individuals and 510 breast cancer patients. Among the breast cancer patients, allelic distribution was not associated to age at onset of disease, tumor grade, lymph node status, stage, or expression of the estrogen and progesterone receptors.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Norwegian Cancer Society and the Norwegian Research Council of Science and the Humanities. Back

2 To whom requests for reprints should be addressed, at Institute for Cancer Research, the Norwegian Radium Hospital, Montebello 0310, Oslo, Norway. Phone: 47-22-93-44-17; Fax: 47-22-93-44-40; E-mail: nedelcheva.vessela{at}dnr.uio.no Back

3 The abbreviations used are: UTR, untranslated region; EMSA, electromobility shift assay. Back

Received 3/ 1/99. Accepted 4/29/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Martucci C. P., Fishman J. P450 enzymes of estrogen metabolism. Pharmacol. Ther., 57: 237-257, 1993.[Medline]
  2. Voutilainen R., Miller W. L. Developmental expression of genes for steroidogenic enzymes P450scc (20,22-desmolase), P450c17 (17 {alpha}-hydroxylase/17,20 lyase), and P450c21 (21-hydroxylase) in the human fetus. J. Clin. Endocrinol. Metab., 63: 1145-1150, 1986.[Abstract/Free Full Text]
  3. Thomas H. V., Key T. J., Allen D. S., Moore J. W., Dowsett M., Fentiman I. S., Wang D. Y. A prospective study of endogenous serum hormone concentrations and breast cancer risk in premenopausal women on the island of Guernsey. Br. J. Cancer, 75: 1075-1079, 1997.[Medline]
  4. Hankinson S. E., Willett W. C., Manson J. E., Colditz G. A., Hunter D. J., Spiegelman D., Barbieri R. L., Speizer F. E. Plasma sex steroid hormone levels and risk of breast cancer in postmenopausal women. J. Natl. Cancer Inst., 90: 1292-1299, 1998.[Abstract/Free Full Text]
  5. Hiegelson H. S., Henderson B. E. Estrogens and breast cancer. Carcinogenesis (Lond.), 17: 2279-2284, 1996.[Free Full Text]
  6. Picardo-Leonard J., Miller W. L. Cloning and sequence of the human gene for p450c17 (steroid 17a-hydroxylase/17,20 lyase): similarity with the gene for P450c21. DNA, 6: 439-448, 1987.[Medline]
  7. Carey A. H., Chan K. L., Short F., White D., Williamson R., Franks S. Evidence for a single gene effect causing polycistic ovaries and male pattern baldness. Clin. Endocrinol., 38: 653-658, 1993.[Medline]
  8. Feigelson H. S., Coetzee G. A., Kolonel L. N., Ross R. K., Henderson B. E. A polymorphism in the CYP17 gene increases the risk of breast cancer. Cancer Res., 57: 1063-1065, 1997.[Abstract/Free Full Text]
  9. Feigelson H. S., Shames L. S., Pike M. C., Coetzee G. A., Stanczyk F. Z., Henderson B. E. A cytochrome p450c17a gene (CYP17) polymorphism is associated with serum estrogen and progesterone concentrations. Cancer Res., 58: 585-587, 1998.[Abstract/Free Full Text]
  10. Kadonada J. T., Carner K. R., Masiarz F. R., Tjan R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell, 51: 1079-1090, 1987.[Medline]
  11. Gidoni D., Dynan W. S., Tjan R. Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature (Lond.), 312: 409-413, 1984.[Medline]
  12. Yu C. Y., Motamed K., Chen J., Bailey A. D., Shen S. K. J. The CACC box upstream of human embryonic {varepsilon}-globin gene binds Sp1 and is a functional promoter element in vitro and in vivo. J. Biol. Chem., 14: 8907-8915, 1991.
  13. Nedelcheva Kristensen V., Andersen T. I., Lindblom A., Nesland J., Olsen A., Børresen-Dale A-L. A rare CYP19 (aromatase) variant increases the risk of breast cancer. Pharmacogenetics, 8: 43-48, 1998.[Medline]
  14. Bukholm I. K., Nesland J., Kåresen R., Jacobsen U., Børresen-Dale A-L. Relationship between abnormal p53 protein and failure to express p21 protein in human breast carcinomas. J. Pathol., 181: 140-145, 1997.[Medline]
  15. Oelgeschlager M., Nuchprayoon I., Luscher B., Friedman A. D. C/EBP, c-Myb and PU.1 cooperate to regulate the neutrophil elastase promoter. Mol. Cell. Biol., 16: 4717-4725, 1996.[Abstract]
  16. Dunning A. M., Healey C. S., Pharoah P. D. P., Foster N. A., Lipscombe J. M., Redman K. L., Easton D. F., Day N. E., Ponder B. A. J. No association between a polymorphism in the steroid metabolism gene CYP17 and risk of breast cancer. Br. J. Cancer, 77: 2045-2047, 1998.[Medline]
  17. Weston A., Pan C-f., Bleiweiss I. J., Ksieski H. B., Roy N., Maloney N., Wolf M. S. CYP17 genotype and breast cancer risk. Cancer Epidemiol. Biomark. Prev., 7: 941-945, 1998.[Abstract]
  18. Helzlsouer K. J., Huang H-Y., Strickland P. T., Hoffman S. H., Alberg A. J., Comstock G. W., Bell D. Association between CYP17 polymorphisms and the development of breast cancer. Cancer Epidemiol. Biomark. Prev., 7: 945-951, 1998.[Abstract]
  19. Nakajin S., Shinoda M., Haniu M., Shively J. E., Hall P. F. C21 steroid side chain vleavage enzyme from porcine adrenal microsomes: purification and characterization of the 17a hydroxylase/C17,20-lyase cytochrome P450. J. Biol. Chem., 259: 3971-3976, 1984.[Abstract/Free Full Text]
  20. Santen R. J., Samojlik E., Wells S. A. Resistance of the ovary to blockade of aromatization with aminogluthimide. J. Clin. Endocrinol. Metab., 51: 473-477, 1980.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
D. W. Bell, B. W. Brannigan, K. Matsuo, D. M. Finkelstein, R. Sordella, J. Settleman, T. Mitsudomi, and D. A. Haber
Increased Prevalence of EGFR-Mutant Lung Cancer in Women and in East Asian Populations: Analysis of Estrogen-Related Polymorphisms
Clin. Cancer Res., July 1, 2008; 14(13): 4079 - 4084.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
L. C. Sakoda, C. Blackston, J. A. Doherty, R. M. Ray, M. G. Lin, H. Stalsberg, D. L. Gao, Z. Feng, D. B. Thomas, and C. Chen
Polymorphisms in Steroid Hormone Biosynthesis Genes and Risk of Breast Cancer and Fibrocystic Breast Conditions in Chinese Women
Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1066 - 1073.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
Y. Chen, M. D. Gammon, S. L. Teitelbaum, J. A. Britton, M. B. Terry, S. Shantakumar, S. M. Eng, Q. Wang, I. Gurvich, A. I. Neugut, et al.
Estrogen-biosynthesis gene CYP17 and its interactions with reproductive, hormonal and lifestyle factors in breast cancer risk: results from the Long Island Breast Cancer Study Project
Carcinogenesis, April 1, 2008; 29(4): 766 - 771.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
V. W. Setiawan, F. R. Schumacher, C. A. Haiman, D. O. Stram, D. Albanes, D. Altshuler, G. Berglund, J. Buring, E. E. Calle, F. Clavel-Chapelon, et al.
CYP17 Genetic Variation and Risk of Breast and Prostate Cancer from the National Cancer Institute Breast and Prostate Cancer Cohort Consortium (BPC3)
Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2237 - 2246.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Henningson, U. Johansson, A. Borg, H. Olsson, and H. Jernstrom
CYP17 genotype is associated with short menstrual cycles, early oral contraceptive use and BRCA mutation status in young healthy women
Mol. Hum. Reprod., April 1, 2007; 13(4): 231 - 236.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
S. H. Olson, E. V. Bandera, and I. Orlow
Variants in Estrogen Biosynthesis Genes, Sex Steroid Hormone Levels, and Endometrial Cancer: A HuGE Review
Am. J. Epidemiol., February 1, 2007; 165(3): 235 - 245.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
G. Jasienska, M. Kapiszewska, P. T. Ellison, M. Kalemba-Drozdz, I. Nenko, I. Thune, and A. Ziomkiewicz
CYP17 Genotypes Differ in Salivary 17-{beta} Estradiol Levels: A Study Based on Hormonal Profiles from Entire Menstrual Cycles.
Cancer Epidemiol. Biomarkers Prev., November 1, 2006; 15(11): 2131 - 2135.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. Piller, E. Verla-Tebit, S. Wang-Gohrke, J. Linseisen, and J. Chang-Claude
CYP17 Genotype Modifies the Association between Lignan Supply and Premenopausal Breast Cancer Risk in Humans
J. Nutr., June 1, 2006; 136(6): 1596 - 1603.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
C. M. Small, M. Marcus, S. L. Sherman, A. K. Sullivan, A. K. Manatunga, and H. S. Feigelson
CYP17 genotype predicts serum hormone levels among pre-menopausal women
Hum. Reprod., August 1, 2005; 20(8): 2162 - 2167.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. C. Onland-Moret, C. H. van Gils, M. Roest, D. E. Grobbee, and P. H.M. Peeters
Cyp17, Urinary Sex Steroid Levels and Breast Cancer Risk in Postmenopausal Women
Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 815 - 820.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
H. S. Kok, N. C. Onland-Moret, K. M. van Asselt, C. H. van Gils, Y. T. van der Schouw, D. E. Grobbee, and P. H.M. Peeters
No association of estrogen receptor {alpha} and cytochrome P450c17{alpha} polymorphisms with age at menopause in a Dutch cohort
Hum. Reprod., February 1, 2005; 20(2): 536 - 542.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
B. K. Dunn, D. L. Wickerham, and L. G. Ford
Prevention of Hormone-Related Cancers: Breast Cancer
J. Clin. Oncol., January 10, 2005; 23(2): 357 - 367.
[Abstract] [Full Text] [PDF]


Home page
Am J EpidemiolHome page
L. Sharp, A. H. Cardy, S. C. Cotton, and J. Little
CYP17 Gene Polymorphisms: Prevalence and Associations with Hormone Levels and Related Factors. A HuGE Review
Am. J. Epidemiol., October 15, 2004; 160(8): 729 - 740.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
J. Somner, S. McLellan, J. Cheung, Y. T. Mak, M. L. Frost, K. M. Knapp, A. S. Wierzbicki, M. Wheeler, I. Fogelman, S. H. Ralston, et al.
Polymorphisms in the P450 c17 (17-Hydroxylase/17,20-Lyase) and P450 c19 (Aromatase) Genes: Association with Serum Sex Steroid Concentrations and Bone Mineral Density in Postmenopausal Women
J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 344 - 351.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
F. Sata, H. Yamada, A. Yamada, E. H. Kato, S. Kataoka, Y. Saijo, T. Kondo, J. Tamaki, H. Minakami, and R. Kishi
A polymorphism in the CYP17 gene relates to the risk of recurrent pregnancy loss
Mol. Hum. Reprod., November 1, 2003; 9(11): 725 - 728.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis
Association of the CYP17 Gene Polymorphism with the Risk of Prostate Cancer: A Meta-Analysis
Cancer Epidemiol. Biomarkers Prev., February 1, 2003; 12(2): 120 - 126.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. E. McCann, K. B. Moysich, J. L. Freudenheim, C. B. Ambrosone, and P. G. Shields
The Risk of Breast Cancer Associated with Dietary Lignans Differs by CYP17 Genotype in Women
J. Nutr., October 1, 2002; 132(10): 3036 - 3041.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
H. S. Feigelson, R. McKean-Cowdin, and B. E. Henderson
Concerning the CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis
Mutagenesis, September 1, 2002; 17(5): 445 - 446.
[Full Text] [PDF]


Home page
MutagenesisHome page
Z. Ye and J. M. Parry
Concerning the CYP17 MSPA1 polymorphism and breast cancer risk: a meta-analysis
Mutagenesis, September 1, 2002; 17(5): 447 - 448.
[Full Text] [PDF]


Home page
EndocrinologyHome page
J. Simard, M. Dumont, P. Soucy, and F. Labrie
Perspective: Prostate Cancer Susceptibility Genes
Endocrinology, June 1, 2002; 143(6): 2029 - 2040.
[Full Text] [PDF]


Home page
Hum ReprodHome page
N. Kado, J. Kitawaki, H. Obayashi, H. Ishihara, H. Koshiba, I. Kusuki, K. Tsukamoto, G. Hasegawa, N. Nakamura, T. Yoshikawa, et al.
Association of the CYP17 gene and CYP19 gene polymorphisms with risk of endometriosis in Japanese women
Hum. Reprod., April 1, 2002; 17(4): 897 - 902.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M M de Jong, I M Nolte, G J te Meerman, W T A van der Graaf, J C Oosterwijk, J H Kleibeuker, M Schaapveld, and E G E de Vries
Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility
J. Med. Genet., April 1, 2002; 39(4): 225 - 242.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. L. Stanford, E. A. Noonan, L. Iwasaki, S. Kolb, R. B. Chadwick, Z. Feng, and E. A. Ostrander
A Polymorphism in the CYP17 Gene and Risk of Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., March 1, 2002; 11(3): 243 - 247.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
Z. Ye and J. M. Parry
The CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis
Mutagenesis, March 1, 2002; 17(2): 119 - 126.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
R. A. Kittles, R. K. Panguluri, W. Chen, A. Massac, C. Ahaghotu, A. Jackson, F. Ukoli, L. Adams-Campbell, W. Isaacs, and G. M. Dunston
CYP17 Promoter Variant Associated with Prostate Cancer Aggressiveness in African Americans
Cancer Epidemiol. Biomarkers Prev., September 1, 2001; 10(9): 943 - 947.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
C. J. Lin, J. W. M. Martens, and W. L. Miller
NF-1C, Sp1, and Sp3 Are Essential for Transcription of the Human Gene for P450c17 (Steroid 17{alpha}-hydroxylase/17,20 lyase) in Human Adrenal NCI-H295A Cells
Mol. Endocrinol., August 1, 2001; 15(8): 1277 - 1293.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
C. A. Haiman, M. J. Stampfer, E. Giovannucci, J. Ma, N. E. Decalo, P. W. Kantoff, and D. J. Hunter
The Relationship between a Polymorphism in CYP17 with Plasma Hormone Levels and Prostate Cancer
Cancer Epidemiol. Biomarkers Prev., July 1, 2001; 10(7): 743 - 748.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. T. Goodman, K. McDuffie, C. Guo, K. Terada, and T. A. Donlon
CYP17 Genotype and Ovarian Cancer: A Null Case-Control Study
Cancer Epidemiol. Biomarkers Prev., May 1, 2001; 10(5): 563 - 564.
[Full Text]


Home page
Cancer Res.Home page
C. A. Haiman, S. E. Hankinson, G. A. Colditz, D. J. Hunter, and I. De Vivo
A Polymorphism in CYP17 and Endometrial Cancer Risk
Cancer Res., May 1, 2001; 61(10): 3955 - 3960.
[Abstract] [Full Text]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
N. E. Allen, M. S. Forrest, and T. J. Key
The Association between Polymorphisms in the CYP17 and 5{{alpha}}-Reductase (SRD5A2) Genes and Serum Androgen Concentrations in Men
Cancer Epidemiol. Biomarkers Prev., March 1, 2001; 10(3): 185 - 189.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
H. S. Feigelson, R. McKean-Cowdin, G. A. Coetzee, D. O. Stram, L. N. Kolonel, and B. E. Henderson
Building a Multigenic Model of Breast Cancer Susceptibility: CYP17 and HSD17B1 Are Two Important Candidates
Cancer Res., January 1, 2001; 61(2): 785 - 789.
[Abstract] [Full Text]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
K. Mitrunen, N. Jourenkova, V. Kataja, M. Eskelinen, V.-M. Kosma, S. Benhamou, H. Vainio, M. Uusitupa, and A. Hirvonen
Steroid Metabolism Gene CYP17 Polymorphism and the Development of Breast Cancer
Cancer Epidemiol. Biomarkers Prev., December 1, 2000; 9(12): 1343 - 1348.
[Abstract] [Full Text]


Home page
JNCI J Natl Cancer InstHome page
A. B. Spurdle, J. L. Hopper, G. S. Dite, X. Chen, J. Cui, M. R. E. McCredie, G. G. Giles, M. C. Southey, D. J. Venter, D. F. Easton, et al.
CYP17 Promoter Polymorphism and Breast Cancer in Australian Women Under Age Forty Years
J Natl Cancer Inst, October 18, 2000; 92(20): 1674 - 1681.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Habuchi, Z. Liqing, T. Suzuki, R. Sasaki, N. Tsuchiya, H. Tachiki, N. Shimoda, S. Satoh, K. Sato, Y. Kakehi, et al.
Increased Risk of Prostate Cancer and Benign Prostatic Hyperplasia Associated with a CYP17 Gene Polymorphism with a Gene Dosage Effect
Cancer Res., October 1, 2000; 60(20): 5710 - 5713.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kristensen, V. N.
Right arrow Articles by Børresen-Dale, A.-L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kristensen, V. N.
Right arrow Articles by Børresen-Dale, A.-L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online