| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Genetics [V. N. K., E. K. H., A-L. B-D.] and Department of Oncology [B. E.], Institute of Cancer Research, the Norwegian Radium Hospital, University Clinic, Montebello 0310, Oslo; Department of Biochemistry, University of Oslo, Oslo 0316 [K. B. A., O. S. G.]; Department of Oncology, Haukeland Hospital, 5021 Bergen [P. E. L.]; and Department of Oncology, Ullevål Hospital, Oslo 0407 [R. K.], Norway.
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
-hydroxylation of pregnenolone and progesterone. The same enzyme also catalyzes the conversion of C21 steroids to C17. Both activities are required for androgen and estrogen synthesis (1
, 2)
. A role for estrogen in human breast carcinogenesis is supported by epidemiological risk factors, as well as by recent studies linking plasma estrogen levels to breast cancer risk. (3
, 4
; reviewed in Ref. 5
). It has been hypothesized that the 17
-hydroxylase/17,20lyase activity may be at least one of the biochemical determinants of these phenomena. CYP17, the gene coding for this enzyme, maps to chromosome 10 and contains eight exons and seven introns (6)
. A polymorphism (a T-C substitution) in the 5' UTR3
, at +27 relative to the start of transcription, has been described (7
, 8)
. Feigelson et al. (8)
demonstrated that the C (A2) allele was more frequent in postmenopausal patients with advanced breast cancer than in controls and suggested this variant to be associated with an increased risk of the disease. In a recent study, the variant A2 allele was found to be associated with higher serum hormone levels in young healthy individuals (9)
. The substitution has several times been discussed to create a putative Sp-1 binding site (CCACT-CCACC), thus providing a mechanism for higher expression of the variant allele (8
, 9)
. The constitutive transcription factor Sp-1 plays a role in the transcription of numerous cellular genes, including constitutive housekeeping genes, as well as inducible genes. Transcription factor Sp-1 (initially isolated from human HeLa cell lines) binds to some, but not all, hexanucleotide GGGCGG (GC box) sequences (10)
. Sp1-responsive promoters often contain multiple Sp-1 binding sites (11)
. A CACC box upstream of the human embryonic
globin gene has also been shown to bind to Sp-1 in vitro and in vivo (12)
. Therefore, it has been repeatedly suggested that the T-C polymorphism of CYP17 converting the sequence CACT into CACC may create such a site (8
, 9)
and provide a mechanism for higher level of expression of the variant A2 allele. However, this possibility has never been verified experimentally. | Materials and Methods |
|---|
|
|
|---|
Genotyping.
Genotyping of the CYP17, 5' UTR polymorphism was performed using forward primer 5'CATTCGCACCTCTGGAGTC3' and reverse primer 5'GGCTCTTGGGGTACTTG3' with PCR parameters, as described previously (8)
. PCR was performed in 25-µl reaction volumes on a Perkin Elmer 9600 thermocycler using 96-well microtiter plates. After the PCR reaction, restriction enzyme MspAI (2 units/reaction; Promega) and 10 x restriction enzyme buffer were added using a multichannel pipette directly to the microtiter plates to a final volume of 50 µl/well. Plates were incubated at 37°C overnight, and 10 µl of the restriction mix of all 96 samples were analyzed by standard electrophoresis on a single agarose gel, 3% NuSieve3:1 (FMC).
EMSA.
The following DNA probes were used in this study: Sp-1-consensus: 5'GATCATATCTGCGGGGCGGGGCAGACACAG3'; CYP17-A120mer: 5'CTTCTACTCCACTGCTGTCT3'; CYP17-A220mer: 5'CTTCTACTCCACCGCTGTCT3'; CYP17-A1100mer:5'GTTGCCACAGCTCTTCTACTCCACTGCTGTCTATCTTGCCTGCCGGCACCCAGCCACCATGTGGGAGCTCGTGGCTCTCTTGCTGCTTACCCTAGCTTA3'; CYP17-A2100mer:5'GTTGCCACAGCTCTTCTACTCCACCGCTGTCTATCTTGCCTGCCGGCACCCAGCCACCATGTGGGAGCTCGTGGCTCTCTTGCTGCTTACCCTAGCTTA3';
-globCCACC: 5'ACCTGACTCCACCCCTGAGG3' from Ref. 12
;
-globCCACT: 5'ACCTGACTCCACTCCTGAGG3' mutated.
Gel mobility shift assay was performed as described (15) . Oligos for EMSA had been end-labeled with T4 polymucloetide kinase (Pharmacia Biotech, Uppsala, Sweden), annealed, and purified as described (15) . One unit of recombinant Sp-1 protein (1 µl; Promega) was mixed with 1 pmol purified 32P end-labeled DNA probe, 0.5 unit poly(dI-dC) (Pharmacia Biotech), and reaction buffer H, according to Oelgeschlager et al. (15) , in a final volume of 20 µl. The binding reaction was allowed to proceed for 30 min either at room temperature or on ice. The reaction mixture was then run on a 5% polyacrylamide gel (1:37,5; BioRad) for approximately 1.5 h at 16°C. Protein-DNA complexes were visualized by autoradiography with intensifying screen overnight at -70°C.
| Results |
|---|
|
|
|---|
globin promoter, containing the CACC box (12)
, identical to the one found on the A2 allele of CYP17 (CACC), did bind Sp-1 under our experimental conditions (Fig. 1
globin promoter leading to the formation of a CACT motif, in analogy to the A1 allele of CYP17, abrogated this binding (Fig. 2
|
|
Thus, given these experimental conditions, under which we were able to reproduce the Sp-1 binding to the
globin promoter area from Yu et al. (12)
, we failed to observe an interaction between Sp-1 and the polymorphic CYP17 5' UTR sequence. A comparison of the 20-nucleotide long sequence of the human
-globin promoter with that of CYP17 ' UTR (Fig. 3)
reveals a stretch of 12 nucleotides (ACTCCACCC/GCTG) of which 11, including the CACC box, are identical.
|
|
| Discussion |
|---|
|
|
|---|
-globin gene was demonstrated. The fact that a substitution of the last C in the CACC box in the
-globin gene with a T abrogates the binding suggests that the CACC box is a necessary, although not sufficient determinant of Sp-1 binding. A comparison of the 20-nucleotide sequence of the human
globin promoter with that of the CYP17 5' UTR shows that the C immediately after the CACC box in
-globin gene, which is a G at the same position in sequence of CYP17, is the most likely candidate to contribute to the observed difference. Because multimer links of Sp-1 had been described to act in synergism for which DNA looping is essential (11)
, the protein-DNA complex formation of a larger motif of 100 nucleotides, including both the polymorphic site and the promoter region, was studied. No complex formation of Sp-1 with these long stretches, containing further putative Sp-1 boxes, of either of the polymorphic sequences was observed. The A2 allele of CYP17 has previously been found to be more frequent among postmenopausal women with advanced breast cancer compared with controls (8) . In this study, a nonsignificant trend was observed for a higher frequency of the A2A2 genotype among patients with age at diagnosis above 55 years versus patients with age at diagnosis below 45 years of age. When stratifying the patients similarly to previous studies (8) , the same nonsignificant trend was observed for postmenopausal patients with higher stage of the disease (stage III and IV) versus premenopausal patients with stage I and II disease. The A2A2 genotype is infrequent, which leads to small size of the compared groups and low statistical power. In addition, a very small portion of the patients in our cohort was with distant metastases (3.5%). If the A2 allele is associated with a metastatic phenotype, as shown by Feigelson et al. (8) , it would not have been detected in our study. Additional studies are necessary to clarify the association of the A2 allele with metastatical breast cancer. Elevated estrogen levels throughout the premenopausal period was a suggested explanation of the observed association between the A2 allele and a higher risk of advanced breast cancer in elderly patients (8) . It was unclear why elevated estrogen levels should not confer a high-risk phenotype already earlier in life. While this manuscript was in preparation, other studies reported no association between the CYP17 genotype and risk of breast cancer (16, 17, 18) . However, these studies, discuss repeatedly the possible creation of Sp-1 site in the A2 genotype, without testing this experimentally. We report a negative result. Additional studies are needed to find out whether the A2 allele confers specifically a higher expression level of CYP17.
Cytochrome P450c17 is encoded by a single gene (CYP17) in mammals (6)
. The enzyme has a bifunctional active site: one catalytic center performs the 17
-hydroxylation of pregnenolone and progesterone and another, the 17,20-lyase activity, is responsible for the conversions of 17
-hydroxypregnenolone to dihydroepiandrosterone and 17
-hydroxyprogesterone to androstenedione, precursors of testosterone and estrogens (17
, 18)
. In the adrenal glands the bulk of 17
-hydroxypregnenolone and 17OH progesterone is used in glucocorticoid production with minor fractions ending as difydroepiandrosterone and androstenedione (19)
. A single event of upregulation of transcription by Sp-1 binding, which was discussed as a possible phenotype of the T to C polymorphism of CYP17, would be expected to lead to up-regulation of both activities and have as a consequence overproduction of glucocorticoids. An interesting example is the failure of an aromatase inhibitor, aminoglutethimide, to block ovarian hormone production due to compensatory increase in the gonadotropin levels (20)
. The adrenal CYP17 expresses considerable 17
-hydroxylase activity, but little 17,20 lyase activity, suggesting tissue-specific regulation of gene expression (2)
. Differential regulation of both activities is further supported by evidence that the 17,20 lyase activity, which yields precursors to testosterone and estradiol, is developmentally stimulated during puberty (19)
. Ovarian theca cells express high levels of 17, 20 lyase activity during the reproductive period, suggesting tissue specific regulation of CYP17. It would be of interest to search for interactions of the polymorphism in the 5' flanking area of CYP17 with tissue-specific transcription factors other than the relatively ubiquitous Sp-1, which are present in the ovarian theca cells, but absent in the adrenal tissues.
We report that the T-C polymorphism does not create a binding site for Sp-1. There was no observed difference in distribution of the different alleles among 201 healthy individuals and 510 breast cancer patients. Among the breast cancer patients, allelic distribution was not associated to age at onset of disease, tumor grade, lymph node status, stage, or expression of the estrogen and progesterone receptors.
| FOOTNOTES |
|---|
1 Supported by the Norwegian Cancer Society and the Norwegian Research Council of Science and the Humanities. ![]()
2 To whom requests for reprints should be addressed, at Institute for Cancer Research, the Norwegian Radium Hospital, Montebello 0310, Oslo, Norway. Phone: 47-22-93-44-17; Fax: 47-22-93-44-40; E-mail: nedelcheva.vessela{at}dnr.uio.no ![]()
3 The abbreviations used are: UTR, untranslated region; EMSA, electromobility shift assay. ![]()
Received 3/ 1/99. Accepted 4/29/99.
| REFERENCES |
|---|
|
|
|---|
-hydroxylase/17,20 lyase), and P450c21 (21-hydroxylase) in the human fetus. J. Clin. Endocrinol. Metab., 63: 1145-1150, 1986.
-globin gene binds Sp1 and is a functional promoter element in vitro and in vivo. J. Biol. Chem., 14: 8907-8915, 1991.
This article has been cited by other articles:
![]() |
D. W. Bell, B. W. Brannigan, K. Matsuo, D. M. Finkelstein, R. Sordella, J. Settleman, T. Mitsudomi, and D. A. Haber Increased Prevalence of EGFR-Mutant Lung Cancer in Women and in East Asian Populations: Analysis of Estrogen-Related Polymorphisms Clin. Cancer Res., July 1, 2008; 14(13): 4079 - 4084. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. C. Sakoda, C. Blackston, J. A. Doherty, R. M. Ray, M. G. Lin, H. Stalsberg, D. L. Gao, Z. Feng, D. B. Thomas, and C. Chen Polymorphisms in Steroid Hormone Biosynthesis Genes and Risk of Breast Cancer and Fibrocystic Breast Conditions in Chinese Women Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1066 - 1073. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, M. D. Gammon, S. L. Teitelbaum, J. A. Britton, M. B. Terry, S. Shantakumar, S. M. Eng, Q. Wang, I. Gurvich, A. I. Neugut, et al. Estrogen-biosynthesis gene CYP17 and its interactions with reproductive, hormonal and lifestyle factors in breast cancer risk: results from the Long Island Breast Cancer Study Project Carcinogenesis, April 1, 2008; 29(4): 766 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. W. Setiawan, F. R. Schumacher, C. A. Haiman, D. O. Stram, D. Albanes, D. Altshuler, G. Berglund, J. Buring, E. E. Calle, F. Clavel-Chapelon, et al. CYP17 Genetic Variation and Risk of Breast and Prostate Cancer from the National Cancer Institute Breast and Prostate Cancer Cohort Consortium (BPC3) Cancer Epidemiol. Biomarkers Prev., November 1, 2007; 16(11): 2237 - 2246. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Henningson, U. Johansson, A. Borg, H. Olsson, and H. Jernstrom CYP17 genotype is associated with short menstrual cycles, early oral contraceptive use and BRCA mutation status in young healthy women Mol. Hum. Reprod., April 1, 2007; 13(4): 231 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Olson, E. V. Bandera, and I. Orlow Variants in Estrogen Biosynthesis Genes, Sex Steroid Hormone Levels, and Endometrial Cancer: A HuGE Review Am. J. Epidemiol., February 1, 2007; 165(3): 235 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Jasienska, M. Kapiszewska, P. T. Ellison, M. Kalemba-Drozdz, I. Nenko, I. Thune, and A. Ziomkiewicz CYP17 Genotypes Differ in Salivary 17-{beta} Estradiol Levels: A Study Based on Hormonal Profiles from Entire Menstrual Cycles. Cancer Epidemiol. Biomarkers Prev., November 1, 2006; 15(11): 2131 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Piller, E. Verla-Tebit, S. Wang-Gohrke, J. Linseisen, and J. Chang-Claude CYP17 Genotype Modifies the Association between Lignan Supply and Premenopausal Breast Cancer Risk in Humans J. Nutr., June 1, 2006; 136(6): 1596 - 1603. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Small, M. Marcus, S. L. Sherman, A. K. Sullivan, A. K. Manatunga, and H. S. Feigelson CYP17 genotype predicts serum hormone levels among pre-menopausal women Hum. Reprod., August 1, 2005; 20(8): 2162 - 2167. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. C. Onland-Moret, C. H. van Gils, M. Roest, D. E. Grobbee, and P. H.M. Peeters Cyp17, Urinary Sex Steroid Levels and Breast Cancer Risk in Postmenopausal Women Cancer Epidemiol. Biomarkers Prev., April 1, 2005; 14(4): 815 - 820. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Kok, N. C. Onland-Moret, K. M. van Asselt, C. H. van Gils, Y. T. van der Schouw, D. E. Grobbee, and P. H.M. Peeters No association of estrogen receptor {alpha} and cytochrome P450c17{alpha} polymorphisms with age at menopause in a Dutch cohort Hum. Reprod., February 1, 2005; 20(2): 536 - 542. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Dunn, D. L. Wickerham, and L. G. Ford Prevention of Hormone-Related Cancers: Breast Cancer J. Clin. Oncol., January 10, 2005; 23(2): 357 - 367. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sharp, A. H. Cardy, S. C. Cotton, and J. Little CYP17 Gene Polymorphisms: Prevalence and Associations with Hormone Levels and Related Factors. A HuGE Review Am. J. Epidemiol., October 15, 2004; 160(8): 729 - 740. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Somner, S. McLellan, J. Cheung, Y. T. Mak, M. L. Frost, K. M. Knapp, A. S. Wierzbicki, M. Wheeler, I. Fogelman, S. H. Ralston, et al. Polymorphisms in the P450 c17 (17-Hydroxylase/17,20-Lyase) and P450 c19 (Aromatase) Genes: Association with Serum Sex Steroid Concentrations and Bone Mineral Density in Postmenopausal Women J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 344 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sata, H. Yamada, A. Yamada, E. H. Kato, S. Kataoka, Y. Saijo, T. Kondo, J. Tamaki, H. Minakami, and R. Kishi A polymorphism in the CYP17 gene relates to the risk of recurrent pregnancy loss Mol. Hum. Reprod., November 1, 2003; 9(11): 725 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ntais, A. Polycarpou, and J. P. A. Ioannidis Association of the CYP17 Gene Polymorphism with the Risk of Prostate Cancer: A Meta-Analysis Cancer Epidemiol. Biomarkers Prev., February 1, 2003; 12(2): 120 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. McCann, K. B. Moysich, J. L. Freudenheim, C. B. Ambrosone, and P. G. Shields The Risk of Breast Cancer Associated with Dietary Lignans Differs by CYP17 Genotype in Women J. Nutr., October 1, 2002; 132(10): 3036 - 3041. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Feigelson, R. McKean-Cowdin, and B. E. Henderson Concerning the CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis Mutagenesis, September 1, 2002; 17(5): 445 - 446. [Full Text] [PDF] |
||||
![]() |
Z. Ye and J. M. Parry Concerning the CYP17 MSPA1 polymorphism and breast cancer risk: a meta-analysis Mutagenesis, September 1, 2002; 17(5): 447 - 448. [Full Text] [PDF] |
||||
![]() |
J. Simard, M. Dumont, P. Soucy, and F. Labrie Perspective: Prostate Cancer Susceptibility Genes Endocrinology, June 1, 2002; 143(6): 2029 - 2040. [Full Text] [PDF] |
||||
![]() |
N. Kado, J. Kitawaki, H. Obayashi, H. Ishihara, H. Koshiba, I. Kusuki, K. Tsukamoto, G. Hasegawa, N. Nakamura, T. Yoshikawa, et al. Association of the CYP17 gene and CYP19 gene polymorphisms with risk of endometriosis in Japanese women Hum. Reprod., April 1, 2002; 17(4): 897 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
M M de Jong, I M Nolte, G J te Meerman, W T A van der Graaf, J C Oosterwijk, J H Kleibeuker, M Schaapveld, and E G E de Vries Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility J. Med. Genet., April 1, 2002; 39(4): 225 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Stanford, E. A. Noonan, L. Iwasaki, S. Kolb, R. B. Chadwick, Z. Feng, and E. A. Ostrander A Polymorphism in the CYP17 Gene and Risk of Prostate Cancer Cancer Epidemiol. Biomarkers Prev., March 1, 2002; 11(3): 243 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ye and J. M. Parry The CYP17 MspA1 polymorphism and breast cancer risk: a meta-analysis Mutagenesis, March 1, 2002; 17(2): 119 - 126. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Kittles, R. K. Panguluri, W. Chen, A. Massac, C. Ahaghotu, A. Jackson, F. Ukoli, L. Adams-Campbell, W. Isaacs, and G. M. Dunston CYP17 Promoter Variant Associated with Prostate Cancer Aggressiveness in African Americans Cancer Epidemiol. Biomarkers Prev., September 1, 2001; 10(9): 943 - 947. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Lin, J. W. M. Martens, and W. L. Miller NF-1C, Sp1, and Sp3 Are Essential for Transcription of the Human Gene for P450c17 (Steroid 17{alpha}-hydroxylase/17,20 lyase) in Human Adrenal NCI-H295A Cells Mol. Endocrinol., August 1, 2001; 15(8): 1277 - 1293. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Haiman, M. J. Stampfer, E. Giovannucci, J. Ma, N. E. Decalo, P. W. Kantoff, and D. J. Hunter The Relationship between a Polymorphism in CYP17 with Plasma Hormone Levels and Prostate Cancer Cancer Epidemiol. Biomarkers Prev., July 1, 2001; 10(7): 743 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Goodman, K. McDuffie, C. Guo, K. Terada, and T. A. Donlon CYP17 Genotype and Ovarian Cancer: A Null Case-Control Study Cancer Epidemiol. Biomarkers Prev., May 1, 2001; 10(5): 563 - 564. [Full Text] |
||||
![]() |
C. A. Haiman, S. E. Hankinson, G. A. Colditz, D. J. Hunter, and I. De Vivo A Polymorphism in CYP17 and Endometrial Cancer Risk Cancer Res., May 1, 2001; 61(10): 3955 - 3960. [Abstract] [Full Text] |
||||
![]() |
N. E. Allen, M. S. Forrest, and T. J. Key The Association between Polymorphisms in the CYP17 and 5{{alpha}}-Reductase (SRD5A2) Genes and Serum Androgen Concentrations in Men Cancer Epidemiol. Biomarkers Prev., March 1, 2001; 10(3): 185 - 189. [Abstract] [Full Text] |
||||
![]() |
H. S. Feigelson, R. McKean-Cowdin, G. A. Coetzee, D. O. Stram, L. N. Kolonel, and B. E. Henderson Building a Multigenic Model of Breast Cancer Susceptibility: CYP17 and HSD17B1 Are Two Important Candidates Cancer Res., January 1, 2001; 61(2): 785 - 789. [Abstract] [Full Text] |
||||
![]() |
K. Mitrunen, N. Jourenkova, V. Kataja, M. Eskelinen, V.-M. Kosma, S. Benhamou, H. Vainio, M. Uusitupa, and A. Hirvonen Steroid Metabolism Gene CYP17 Polymorphism and the Development of Breast Cancer Cancer Epidemiol. Biomarkers Prev., December 1, 2000; 9(12): 1343 - 1348. [Abstract] [Full Text] |
||||
![]() |
A. B. Spurdle, J. L. Hopper, G. S. Dite, X. Chen, J. Cui, M. R. E. McCredie, G. G. Giles, M. C. Southey, D. J. Venter, D. F. Easton, et al. CYP17 Promoter Polymorphism and Breast Cancer in Australian Women Under Age Forty Years J Natl Cancer Inst, October 18, 2000; 92(20): 1674 - 1681. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Habuchi, Z. Liqing, T. Suzuki, R. Sasaki, N. Tsuchiya, H. Tachiki, N. Shimoda, S. Satoh, K. Sato, Y. Kakehi, et al. Increased Risk of Prostate Cancer and Benign Prostatic Hyperplasia Associated with a CYP17 Gene Polymorphism with a Gene Dosage Effect Cancer Res., October 1, 2000; 60(20): 5710 - 5713. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |