| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Molecular Oncology, Hematology/Oncology Medicine [L. Y., J. S., V. V., H-p. X.], Department of Surgery [D. D. R.], Department of Laboratories [J. B.], and Division of Gynecologic Oncology [J. L., D. G.], North Shore-Long Island Jewish Health System, New York University School of Medicine, Manhasset, New York 11030
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
As a result of using this modified technique, two DNA fragments, BR50 and BR254, were isolated that detected DNA hypomethylation in breast cancer. Additional studies verified that both fragments also detected hypomethylation in ovarian cancer, and BR254 was amplified in 1 of 10 breast cancer biopsies. On the basis of these findings, we considered both fragments good candidates to search for genes that might be related to various malignancies. This report will focus on presenting the detailed studies related to BR50, which covers its own isolation as a differentially methylated DNA fragment, to its utilization in the discovery of a novel gene, TSP50.
Investigation of the TSP50 gene has found that it encodes a protease-like protein. Northern analysis of multiple human tissue RNA expression panels showed that TSP50 is a tissue-specific gene, which was heavily expressed in human testes. There were almost no visible amounts of TSP50 transcript displayed in the other 15 types of human tissues in the panels. This result indicates that the TSP50 gene holds a special physiological function(s) in human testes. The DNA methylation status of the downstream region of the gene in normal human testes and eight other tissues was also examined. Apparently, DNA methylation silences the TSP50 gene expression in those eight normal tissues, whereas DNA demethylation in human testes could be a key element responsible for gene expression. Furthermore, RT-PCR was performed to examine differential expression in breast cancer and matched normal control tissues. We found that
28% of the cancer samples tested expressed the TSP50 gene, whereas the corresponding controls did not. Whether there is a relationship between gene expression and cancer development is presently under investigation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Modified RDA.
One to two µg of DNA (tester) isolated from human breast cancer biopsies and their matched normal DNA (driver) were cleaved with MspI (20 units/µl; Boehringer Mannheim) and MseI (20 units/µl; New England Biolabs, Inc.) in a 50-µl reaction for 3 h. To prepare tester and driver master amplicons, the MspI- and MseI-digested tester and driver genomic DNAs were ligated to 1.5 µg of MSA24-mer and 0.75 µg of MSA12-mer (Table 1)
; these were the first pair of oligonucleotide linkers that only recognize the ends generated by MspI. The procedures for amplicon preparation were performed as described (14)
. The DNA amplicons were then purified by phenol, phenol/chloroform extraction. To remove the first set of linkers from the driver amplicon, 80 µg of driver amplicon DNA were digested with the MspI enzyme (10 units/µl). To change the tester master amplicon DNA linkers, 5 µg of tester master amplicon were digested with MspI (20 units/µl) and ligated to 0.6 µg of MSB24-mer and 0.3 µg of MSB12-mer (Table 1)
; these were the second set of oligonucleotide linkers. Subtractive hybridization was performed as described (14)
. The first round of difference products (DP1) were amplified as described (14)
. To prepare the second round of subtractive hybridization, 3 µg of DP1 were digested with the restriction endonuclease MspI (20 units/µl). To put a new set of linkers on DP1, 0.1 µg of DP1 was mixed with 0.6 µg of MSC24-mer and 0.3 µg of MSC12-mer (Table 1)
. Another round of subtractive hybridization/PCR amplification was repeated. The second round of difference products (DP2) usually contained several individual DNA fragments when electrophoresed on a 2% agarose gel. The individual DNA fragments were purified by DNA gel extraction kit (Qiagen, Inc.) and subcloned into pUC118 vector, which was linearized by the restriction endonuclease AccI and transformed into Escherichia coli (DH5
). Twelve cloned inserts were chosen to be amplified, from which different-sized probes were selected for master amplicon Southern blot. The candidate probes were then further tested by human genomic DNA Southern blot.
|
Genomic DNA Southern Blot.
Genomic DNAs were digested with a desired restriction enzyme (20 units/µl) and electrophoresed on 1.5% agarose gels, which were then transferred to Hybond N- membranes (Amersham). These membranes were exposed to UV light to immobilize the DNA. Probes for the Southern blot were labeled with High Prime DNA labeling kits (Boehringer Mannheim) following the instructions of the manufacturer. The procedure for hybridization and blot wash were the same as in the Amplicon DNA Southern blot section.
Northern Analysis.
Two Human Multiple Tissue Northern blot panels, MTN and MTN II, were purchased from Clontech, Inc. The MTN blot contains
2 µg of poly(A)+ RNA per lane from eight different human tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas). The MTN II blot contains the same amounts of mRNA from an additional eight different human tissues (spleen, thymus, prostate, testes, ovary, small intestine, colon, and peripheral blood leukocyte). The labeling and detection of the probes were the same as above.
DNA Sequence and Chromosome Assignment.
The pUC118 plasmid containing the candidate DNA fragment was sequenced using the Ampli-Cycle sequencing kit (Perkin-Elmer), under conditions described by the manufacturer. Chromosome assignment for the candidate DNA fragment was determined by genomic Southern blot of the HindIII digested monochromosomal human/rodent somatic cell hybrid mapping panel #2 (NIGMS Human Genetic Mutant Cell Repository) while it was used as a probe. Fine chromosome mapping was performed with GeneBridge 4 Radiation Hybrid Panel (Research Genetics, Inc.) by PCR amplification (21)
.
Human Genomic DNA Library Screening.
A human placenta genomic phage library, EMBL3 SP6/T7 (Clontech, Inc.), was used for cloning a longer genomic fragment containing the candidate fragment. Phage infection procedure was based on the instructions supplied by the manufacturer. Plaques (2 x 106) were evenly distributed on 20 plates (150 x 15 mm), then transferred onto Hybond N- membranes. The treatment of the membranes, preparation of the probe, and the blot wash were the same as that described in the Genomic DNA Southern blot section. The phage DNA, with human DNA insert, was purified by the Lambda TRAP Plus kit (Clontech, Inc.) following the instructions of the manufacturer. The individual insert was released by restriction enzyme SstI cleavage from the phage DNA arms, then subcloned into pUC118 plasmid.
Human cDNA Library Screening.
A human testes
gt11 cDNA library (Human Testis cDNA Library; Clontech, Inc.) was used to obtain an intact gene following the instructions of the manufacturer. Plaques (2 x 105) evenly distributed on six plates (150 x 15 mm) were transferred onto Hybond N- membranes. Southern analysis was performed as before. The phage DNA, with human cDNA insert, was purified by the
Quick! Spin kit (BIO 101, Inc.) following the instructions of the manufacturer. The individual insert was released by restriction enzyme EcoRI cleavage from the phage DNA arms, then subcloned into pUC118 plasmid.
RT-PCR.
Total RNAs were isolated from paired breast cancer and normal tissues by RNA isolation kit, RNA STAT-60 (TEL-TEST, Inc.). The first-strand cDNA was synthesized by SuperScript Preamplification system kit (Life Technologies, Inc.). Oligomers E (ACCAGAGCGTCCAGTGTGTCC, sense) and F (TGGGACTTGATGATCTGAACC, antisense) were used to synthesize the TSP50 gene. The predicted size was 699 bp. ß-actin was used as an internal control, the sense and antisense primers of which were 5' -GACGACATGGAGAAGATCTGG-3' and 5' -TGTAGAGGTAGTCAGTCAGG-3'. The predicted size for ß -actin was 335 bp. The PCR reaction mixture was comprised of cDNA derived from 125 ng of RNA, 10 pmol of sense and antisense primers from both TSP50 and ß-actin, 200 µM of four deoxynucleotide triphosphate, and 0.125 unit of Taq DNA polymerase with reaction buffer (Perkin-Elmer) in a final volume of 25 µl. Thirty-eight cycles of PCR were carried out. Each cycle of PCR included 30 s of denaturation at 95°C, 60 s of annealing at 60°C, and 60 s of extension at 72°C. The PCR products were separated on a 2% agarose gel.
| RESULTS |
|---|
|
|
|---|
Probe BR50 was selected from the DP2 isolated from breast cancer patient no. 14s biopsy by the modified RDA technique (Fig. 1a)
because it hybridized a band of much greater intensity in the tester amplicon than that in the driver amplicon (Fig. 1b)
. To confirm the differences observed in the tester and driver amplicons, a Southern analysis was performed on patient no. 14s tumor and matched normal genomic DNAs. Six µg of each DNA were cleaved with the MspI enzyme and hybridized by probe BR50. The results showed that in the tumor DNA, the probe hybridized a lower band,
1 kbp long, of much greater intensity than an upper band, which was
2 kbp in length. In the normal DNA, just the opposite occurred (Fig. 2)
. Because the sizes of the upper and lower bands in the tumor and normal control DNAs were the same, the only reasonable explanation causing uneven hybridization intensities is DNA hypomethylation in the tumor cells. To examine whether the event also existed in other breast cancer patients, paired tumor and normal DNAs isolated from additional breast cancer biopsies were cleaved with MspI and subjected to Southern analysis. The results showed that of 10 samples tested, 4 had similar hybridization patterns to those of patient no. 14 (Fig. 2)
. It is notable that in the normal DNAs of patient nos. 3, 4, and 5, more than one upper band was evident. We believe this can be attributed to partial DNA demethylation, instead of incomplete enzymatic digestion. This is because the Southern membrane was reblotted by a control probe, which was a background probe isolated along with probe BR50, and only a single hybridized band was displayed in each lane (Fig. 2)
.
|
|
|
|
50% identifiable to several mammalian proteases, such as serine proteases and tryptases. The BR50-45 sequence was found 142 bp upstream of the BR50 sequence.
Because we did not know the exact positions of the two exons in the 17-kbp fragment, it was possible that other exon(s) might lay between them. To gain a longer coding sequence, we designed four oligomers (A, B, C, and D), based on the sequence information of both exons, to perform PCR. Oligomer A (5'-CCTGGATGGTCAGCGTG-3') and B (5'-CTGGGAGGCAATGATGGT-3'), which were on the complimentary strand, were based on the sequence information of BR-44; and C (5'-CTGGAGAGCCCTTGGTCT-3') and D (5'-CAGTGTTGGTAGGAGGAG-3'), which were on the complimentary strand, were based on the sequence information of BR-45. A strategy using four different combinations of oligomer pairs was used to perform PCR by using the Human Universal cDNA Library Panel (Clontech, Inc.). A PCR product, which was about 700 bp in length, was generated from one oligomer combination (A/D, 5'-CCTGGATGGTCAGCGTG-3'/5' -CAGTGTTGGTAGGAGGAG-3'). This PCR product was directly sequenced. Combining the sequence information of the PCR product and the two exons, we obtained a cDNA fragment that contained 974 bps. The DNA homologue search of the NIH GenBank revealed again that it coded for a protease-like protein, and the overall identity was
40%.
The Candidate Gene Is Highly and Specifically Expressed in Human Testes.
To obtain a full-length cDNA, it is critical to use the right cDNA library where the gene of interest is expressed. Thus, two Human Multiple Tissue Northern blot panels, MTN and MTN II, containing 16 different tissue mRNAs (Clontech, Inc.), were used to test the expression of the candidate gene by using the 700-bp cDNA PCR product as a probe. The results showed that there were no visible transcripts of this gene in the eight mRNAs (heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas) included in the MTN panel (data not shown). In the MTN II panel, a 1.7-kbp band was heavily hybridized by the probe exclusively in the testes mRNA as compared with the control probe, which was the human rab6 gene (Fig. 5)
. These results suggested that the gene that we were searching for is a tissue-specific gene. We have named the gene TSP50. At this moment, the biological function(s) of the gene in human testes remains unknown.
|
DNA Methylation Status of the TSP50 Gene in Human Testes and Other Normal Tissues.
Our studies have proven that TSP50 is a tissue-specific gene, and the methylation patterns in its 3' region were altered in some breast and ovarian cancers. It is also known that many tissue specific genes are methylated, and this methylation may regulate their expression (22, 23, 24)
. To explore the possible relationship between TSP50 gene expression and DNA methylation in different normal human tissues, Southern analysis was performed. The normal tissues tested included the testes, where TSP50 was expressed, and bladder, blood, breast, colon, lung, kidney, placenta, and ovary samples, where TSP50 was apparently not expressed. To perform the Southern analysis, BR50 was used as a probe. DNAs isolated from the nine tissues were digested by MspI and HpaII, which is an isoschizomer of the MspI enzyme and the most popular enzyme used to study DNA methylation patterns (25)
. HpaII digestion showed that in the testes DNA, two bands, probably released from each allele by enzyme cleavage, were hybridized by the probe. However, in the DNAs of other tissues, the corresponding bands were either not hybridized or hybridized to a much smaller degree (Fig. 6a)
. For MspI cleavage, both bands were released in different tissues to various extents (Fig. 6b)
. Both blots used a genomic fragment that did not detect differential DNA methylation as a control to determine complete enzymatic digestion (Fig. 6)
. These results demonstrated that the TSP50 gene was differentially methylated in various human tissues. In general, DNA demethylation in the testes is correlated with high levels of gene expression. Conversely, DNA methylation is correlated with gene silencing in the bladder, blood, breast, colon, lung, kidney, placenta, and ovary tissues.
|
|
| DISCUSSION |
|---|
|
|
|---|
It has been reported that aberrant DNA methylations occur constantly in human tumors (9, 10, 11, 12 , 24 , 26) . DNA hypomethylations could activate oncogenes, whereas DNA hypermethylation could inactivate recessive oncogenes. Both events could result in neoplastic growth (27, 28, 29, 30, 31, 32, 33, 34, 35) . The correlation between aberrant DNA methylations and malignancies suggests that differentially methylated fragments in tumors isolated by a modified RDA technique could be a valuable tool in the search for genes that might be related to cancer development. BR50 was considered to hold such value because it not only detected DNA hypomethylations in the original breast cancer tissues from which it was isolated but also detected DNA hypomethylations in other breast and ovarian cancer samples.
Our first step in processing the gene search was to screen a human genomic phage library. A 17-kbp DNA fragment was isolated, and sequence analysis suggested that this fragment contained at least two exons that were homologous to mammalian proteases. The sequencing information of the exons led to the discovery of a 974-bp gene fragment from a human cDNA library panel by PCR amplification. To obtain a full-length gene, a Northern evaluation on 16 different types of human RNAs was performed. The results demonstrated that the target gene was specifically expressed in human testes tissue. This information secured the isolation of an intact gene, TSP50, by screening a human testes cDNA library. The sequence analysis revealed that the TSP50 gene encodes a protein that shares
40% identity with mammalian proteases, such as human tryptase or mouse serine protease. This would suggest that the product of the TSP50 gene is a protease. However, at this point, we do not know the physiological function(s) of this protease. One may assume, though, that it could be a component in the human reproductive pathway due to it being solely expressed in the testes.
It is common knowledge that the expression of many tissue-specific genes is regulated by DNA methylations, which usually modify the promoter, or sometimes, 3' regions (3 , 4 , 22, 23, 24 , 36) . Our preliminary results, although only obtained from analyzing the DNA methylation status of the 3' flanking region of the gene, have proven that TSP50 is one of those tissue-specific genes. It will be interesting to discover whether the promoter region of the gene is also methylated when the corresponding sequence information is available. The HpaII and MspI methylation-sensitive Southern analysis of the 3' region of the TSP50 gene demonstrated that, in HpaII-digested DNAs, probe BR50 hybridized two bands in the testes tissue but none in the other samples. The lower band, which was the same size as the probe, represented the unmethylated DNA pattern, whereas the upper band obviously contained the internal HpaII recognition site(s), which remained methylated. In MspI-digested DNAs, the upper band was dominant in most tissues, whereas in the testes, the lower band was dominant. These results suggest that the GGCCGG end of BR50 was methylated in other tissues but not in the testes. The DNA methylation patterns observed in both blots are probably allelic orientated. It seems that DNA hypomethylation was accompanied by the expression of the gene in the testes, and conversely, DNA hypermethylation was accompanied by the silencing of the gene in other tissues. The correlation between DNA methylation and gene expression provided additional proof that DNA methylation could be an important mechanism in governing the expression of the genes in various differentiated human cells (12 , 37 , 38) . In addition, the differential expression of the TSP50 gene has been tested in 18 paired breast cancer biopsies. Our findings have shown that this gene was activated in five cancer samples. In the near future, more samples from different types of cancer will be examined, and the possibility that the TSP50 gene product might be one of the factors that stimulate human cancer will be further explored.
Recently, by using the same technique, DNA fragments that represent DNA amplifications, deletions, and rearrangements were also obtained (data not shown). Hopefully, this technique will lead to the discovery of additional novel genes that may be related to cancer development. On the basis of our experience, the process of isolating the TSP50 gene was made considerably easier by the modified technology, where the MspI enzyme was used as the master enzyme. The ability of MspI to recognize GC-rich sequences and its sensitivity to DNA methylation (17
, 18)
apparently accelerated our gene search. Furthermore, the double enzyme cleavage strategy provides another unique and efficient feature for this technique because
40% of a human genome can theoretically be analyzed by a single master enzyme when it is combined with a different partner enzyme.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by Grant DAMD17-97-7070 from the Department of Defense Breast Cancer Research Program, Cancer Research Grant 09289 from North Shore-Long Island Jewish Health System, and the Greenberg Foundation. ![]()
2 To whom requests for reprints should be addressed, at Molecular Oncology, Research Building, North Shore-Long Island Jewish Health System, 350 Community Drive, Manhasset, NY 11030. ![]()
3 The abbreviations used are: RDA, representational difference analysis; RT-PCR, reverse transcription-PCR; DP, difference product; TSP, testes-specific protease. ![]()
4 GenBank accession numbers: BR50, U78781; TSP50, AF100707. ![]()
Received 10/28/98. Accepted 5/ 3/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Jiang, A. Dunbar, L. P. Gondek, S. Mohan, M. Rataul, C. O'Keefe, M. Sekeres, Y. Saunthararajah, and J. P. Maciejewski Aberrant DNA methylation is a dominant mechanism in MDS progression to AML Blood, February 5, 2009; 113(6): 1315 - 1325. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Xu, J. Shan, V. Jurukovski, L. Yuan, J. Li, and K. Tian TSP50 Encodes a Testis-Specific Protease and Is Negatively Regulated by p53 Cancer Res., February 1, 2007; 67(3): 1239 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wei, Y. Liu, S. Yang, J. Xu, H. Kong, B. Han, Y. Bao, Y. Wu, W. Yin, W. Li, et al. Screening of Single-Chain Variable Fragments against TSP50 from a Phage Display Antibody Library and Their Expression as Soluble Proteins J Biomol Screen, August 1, 2006; 11(5): 546 - 552. [Abstract] [PDF] |
||||
![]() |
K. Tian, V. Jurukovski, X.-P. Wang, M. H. Kaplan, and H. Xu Epigenetic Regulation of WTH3 in Primary and Cultured Drug-Resistant Breast Cancer Cells Cancer Res., November 1, 2005; 65(21): 10024 - 10031. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tian, V. Jurukovski, L. Yuan, J. Shan, and H. Xu WTH3, which Encodes a Small G Protein, Is Differentially Regulated in Multidrug-Resistant and Sensitive MCF7 Cells Cancer Res., August 15, 2005; 65(16): 7421 - 7428. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Garnis, C. Baldwin, L. Zhang, M. P. Rosin, and W. L. Lam Use of Complete Coverage Array Comparative Genomic Hybridization to Define Copy Number Alterations on Chromosome 3p in Oral Squamous Cell Carcinomas Cancer Res., December 15, 2003; 63(24): 8582 - 8585. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Shridhar, A. Sen, J. Chien, J. Staub, R. Avula, S. Kovats, J. Lee, J. Lillie, and D. I. Smith Identification of Underexpressed Genes in Early- and Late-Stage Primary Ovarian Tumors by Suppression Subtraction Hybridization Cancer Res., January 1, 2002; 62(1): 262 - 270. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shan, L. Yuan, Q. Xiao, N. Chiorazzi, D. Budman, S. Teichberg, and H.-p. Xu TSP50, A Possible Protease in Human Testes, Is Activated in Breast Cancer Epithelial Cells Cancer Res., January 1, 2002; 62(1): 290 - 294. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |