Cancer Research Annual Meeting 2010  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 3308-3312, July 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Q.-R.
Right arrow Articles by Mixson, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Q.-R.
Right arrow Articles by Mixson, A. J.
[Cancer Research 59, 3308-3312, July 15, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Liposomes Complexed to Plasmids Encoding Angiostatin and Endostatin Inhibit Breast Cancer in Nude Mice1

Qing-Rong Chen, Dhruv Kumar, Sanford A. Stass and A. James Mixson2

Department of Pathology and Greenebaum Cancer Center, University of Maryland, Baltimore, Maryland 21201 [Q-R. C., S. A. S., A. J. M.], and Department of Pathology, Sinai Hospital of Baltimore, Baltimore Maryland 21215 [D. K.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Gene therapy transfer of angiostatin and endostatin represents an alternative method of delivering angiogenic polypeptide inhibitors. We examined whether liposomes complexed to plasmids encoding angiostatin or endostatin inhibited angiogenesis and the growth of MDA-MB-435 tumors implanted in the mammary fat pads of nude mice. We determined that plasmids expressing angiostatin (PCI-Angio) or endostatin (PCI-Endo) effectively reduced angiogenesis using an in vivo Matrigel assay. We then investigated the efficacy of these plasmids in reducing the size of tumors implanted in the mammary fat pad of nude mice. Both PCI-Angio and PCI-Endo significantly reduced tumor size when injected intratumorally (P < 0.05). Compared to the untreated control group, the mice treated with PCI-Angio and PCI-Endo exhibited a reduction in tumor size of 36% and 49%, respectively. In addition, we found that i.v. injections of liposomes complexed to PCI-Endo reduced tumor growth in the nude mice by nearly 40% when compared to either empty vector (PCI) or untreated controls (P < 0.05). These findings provide a basis for the further development of nonviral delivery of antiangiogenic genes.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Angiogenesis, the growth of new microvessels, is not only essential for a number of physiological processes but also occurs in many pathological conditions including tumor growth. Studies have shown that tumor growth is dependent on angiogenesis (1) . This provides the rationale for antiangiogenic therapy in cancer. Several angiogenesis inhibitors that inhibit tumor growth are now in clinical trials. Angiostatin and endostatin are two recently reported potent endogenous angiogenesis inhibitors (2 , 3) . Both of these inhibitors are proteolytic polypeptides derived from their parent proteins. Angiostatin is a Mr 38,000 protein whose sequence is identical with the first four triple-loop (kringle) structures of plasminogen. Endostatin is a Mr 20,000 COOH-terminal fragment of collagen XVIII. However, neither plasminogen nor collagen XVIII inhibits angiogenesis. Angiostatin and endostatin specifically inhibit endothelial proliferation without a direct effect on the tumor cell or nonneoplastic cell growth. They cause human carcinomas to regress in mice to a microscopic dormant state, with inhibition of virtually all neovascularization (3 , 4) . Furthermore, there is no observed toxicity with these inhibitors.

Antiangiogenic therapy with angiostatin and endostatin in cancer requires prolonged administration of recombinant protein in vivo. In addition, production of these functional polypeptides has proved difficult, perhaps due to physical properties and variations in the purification procedure by different laboratories. Gene therapy transfer of these polypeptides represents an alternative method to deliver these agents (5, 6, 7) . A few groups have shown that antiangiogenic gene therapy with viral vectors is a potentially useful approach to inhibit tumor growth in mouse models (7, 8, 9, 10, 11) . Although viral vectors are commonly used as carriers for gene transfer due to their high in vitro transfection efficiency, safety issues and the toxicity of these viral vectors will likely preclude their i.v. use in humans in the near future. In contrast, systemically delivered liposome:DNA complexes have been shown to have low toxicity (12, 13, 14, 15) . In this study, we investigated whether intratumoral and i.v. delivery of cationic liposomes complexed to angiostatin and endostatin plasmids inhibited angiogenesis and breast cancer in a nude mouse model.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
PCI-Angio3 and PCI-Endo Constructs
The angiostatin coding sequence was obtained by amplifying murine plasminogen cDNA with primers 5'-TTAGGGTCGACATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCTTTTCTAGGGGTGTGTATCTGTCAGAATGTAAG-3' and 5'-GAATGTCGACTCACCAAGGGCCCTTGTCACCATCC-3'. The amplified angiostatin fragment contained a genetically engineered ATG start site, a signal peptide, and a TAA stop codon. The amplified angiostatin cDNA was digested with SalI, purified, and inserted into the SalI site of the PCI vector (Promega, Madison, WI). The nucleotide sequence that encodes the signal peptide is derived from the human monocyte chemoattractant protein 1 (16) . To construct the PCI-Endo, primers with SalI restriction sites were used to amplify nucleotides 2869–3399 of murine collagen XVIII. The 5' primer also contained a signal peptide and an ATG start codon (TTAGGGTCGACATGAAGTGGGTAACCTTTCTCCTCCTCCTCTTCATCTCCGGTTCTGCCTTTTCTAGGGGTCATACTCATCAGGACTTTCAGC). The 3' primer (TTAGGGTCGACTTATTTGGAGAAAGAGGTCATGAAGCTATTCTCAATGCACAGGACGATGTAGC) contained a TAA stop codon. The amplified endostatin product and the PCI vector were digested with SalI, purified on a 1% agarose gel, and then ligated to one another. The sequence and orientation of PCI-Angio and PCI-Endo were verified.

PCI-Angio-CAT and PCI-Endo-CAT Constructs
The CAT coding sequence was inserted in-frame into unique restriction sites of either PCI-Angio (NsiI) or PCI-Endo (ApaI). These restriction sites were placed on the 5' and 3' ends of the amplified CAT product, and the 3' end of the CAT product also contained a stop codon site. The primers 5'-TTTAGGATGCATGGAGGAAAAAATCACTGGATATACC-3' and 5'-TTATCCATGCATTTACGCCCCGCCCTGCCACTCATCGC-3' amplified the CAT gene, and this amplified product was inserted into PCI-Angio. Similarly, the primers 5'-TTATCTGGGCCCTTACGCCCCGCCCTGCCACTCACGC-3' and 5'-TTTAGTGGGCCCTAGAGAAAAAAATCACTGGATATACC-3 amplified the CAT gene, and this PCR product was inserted into PCI-Endo.

Cell Culture
Breast cancer cell line MDA-MB-435 and CHO cells were maintained in DMEM containing 10% FCS and 20 mM glutamine.

In Vitro Transfection and Conditioned Media Preparation
Transfection of cells was done in 10-cm plates with 60 µl of Superfect (Qiagen, Chatworth, CA) mixed with 10 µg of plasmid as described by the Qiagen protocol. Thirty-six h after transfection, the cells were rinsed with PBS and incubated for 3 h in serum-free DMEM. The cells were then rinsed extensively and incubated in serum-free Iso-Cho medium (Irvine Scientific Inc., Santa Ana, CA) for 24 h. The conditioned media were collected, cleared of cell debris, and concentrated 20-fold with Amicon membranes (Amicon Inc., Beverly, MA) with a Mr 10,000 cut-off. Total protein was determined using a Coomassie Plus protein assay kit (Pierce, Rockford, IL).

In Vitro Transcription and Translation
The experiments were performed as described in the Promega TNT technical bulletin. In brief, 1 µg of each plasmid was mixed with the reaction buffer, wheat germ extract, T7 polymerase, amino acid mixture, and [3H]leucine (100–200 Ci/mmol) for 90 min at 30°C. The products of translation were denatured and separated by electrophoresis on a 12% polyacrylamide gel. Before gel drying, the gel was fixed for 30 min and then soaked with Amplify (Amersham) for 30 min. The gel was exposed to Kodak X-ray film for 7 days at -70°C.

Western Blot Analysis
Total protein (10 µg) from conditioned media was resuspended in loading buffer, boiled for 3–5 min, run on a 12% SDS-PAGE, and blotted to a polyvinylidene difluoride membrane (Hybond-PVDF; Amersham). The membrane was blocked overnight with 5% skim milk in PBS (-Mg, -Ca) containing 0.1% Tween at 4°C and further incubated for 2 h with polyclonal rabbit anti-CAT antibody (5'-3' Inc., Boulder, CO) at a dilution of 1:750. After incubation with secondary anti-rabbit horseradish peroxidase-conjugated antibody (Amersham; 1:2000 dilution) for 1 h, immunoreactive bands were stained by an enhanced chemiluminescence Western blot analysis system (Amersham).

In Vitro Endostatin Quantification
Endostatin in the culture media was measured with a murine endostatin enzyme immunoassay kit (Accucyte, College Park, MD). Unconcentrated media (100 µl) collected from CHO or MDA-MB-435 cells transfected with PCI or PCI-Endo were used for this assay.

In Vivo Angiogenesis Assay
Conditioned media from the CHO cells transfected with PCI-Angio, PCI-Endo, or PCI (control) were concentrated 20-fold. Matrigel (380 µl; Collaborative Biomedical Products, Bedford, MA) with or without 0.1 µg of bFGF (R&D Systems, Minneapolis, MN) were then mixed with 50 µl of concentrated conditioned media. A total of 0.4 ml of this Matrigel was injected into each mouse. There were six treatment groups with three mice in each treatment group, and the experiment was performed twice. One week after the initial injection, the Matrigel plug was removed and bisected. Hemoglobin in one half of the Matrigel plug was measured using the Drabkin method (Drabkin reagent kit 525; Sigma, St. Louis, MO) as described previously (17) . The other half of the Matrigel plug was fixed in 4% formaldehyde and stained with H&E to determine blood vessel density. Similarly, we measured the hemoglobin and blood vessel density in Matrigel with media obtained from transfected MDA-MB-435 cells.

Preparation of Liposome:Plasmid Complexes
Preparation of the liposome:plasmid complexes has been described previously (12 , 15) . In brief, DH5{alpha} bacteria (Life Technologies, Inc., Gaithersburg, MD) containing the plasmids were grown in Superbroth to mid-log phase. The plasmids were then purified with Qiagen columns. An analytical gel of each plasmid (cut and uncut) was done to ensure that there was no contamination with other nucleic acids. Liposomes were composed of 1,2-dioleoyl-3-tri-methylammonium-propane and cholesterol (Avanti, Birmingham, AL) in a 9:1 ratio. After hydration of the lipids, the liposomes were sonicated until clear with a Branson 1210 bath sonicator in the presence of argon. The liposomes were then extruded through 50 nm of polycarbonate membranes with LipsoFast-Basic (Avestin Inc., Ottawa, Canada). Each intratumoral injection of the liposome:DNA complex consisted of 33 nmol of liposome and 2.9 µg of DNA. Each i.v. injection consisted of 200 nmol of liposome and 15 µg of DNA.

Injection Schedule of Breast Tumor Cells and Liposome:DNA Complexes into Mice
After administering anesthetic, female athymic nude mice received injections of 2.5 x 105 MDA-MB-435 tumor cells bilaterally into the mammary fat pads with a stepper (Tridak) and a 27.5-gauge needle. Six days after injection of the tumor cells, the mice received injections of the liposome:plasmid complexes. The time interval between each injection was dependent on whether the mice received intratumoral or i.v. injections. The tumors were measured before each injection and 7 days after the last injection with skin calipers.

Intratumoral Injections with PCI-Angio and PCI-Endo.
Six days after the injection of cells, the mice were randomly divided into four treatment regimens: (a) untreated; (b) empty vector; (c) liposome:PCI-Angio; and (d) liposome:PCI-Endo. Each treatment group contained 10 mice; each mouse received three intratumoral injections 7 days apart. Each injection consisted of liposomes (33 nmol) complexed to 2.9 µg of a plasmid that encoded angiostatin, endostatin, or a control plasmid.

i.v. Injections with PCI-Endo.
After injection of 15 µg of PCI-Endo complexed to 200 nmol of a cationic liposome into mice, endostatin was measured in the serum 24–48 h later. Endostatin levels were measured in two tumor-bearing mice at each time point, whereas untreated mice were used as controls.

To evaluate the antitumor efficacy of systemically delivered PCI-Endo, 30 mice were inoculated with tumor cells and divided into three groups: (a) untreated; (b) liposome:PCI; and (c) liposome:PCI-Endo treatment groups. The first liposome:plasmid injection was given 6 days after the tumor cell inoculation and every 10 days thereafter for a total of six liposome:plasmid DNA treatments via the tail vein. Each injection consisted of liposomes (200 nmol) complexed to 15 µg of a plasmid that encoded endostatin or a control plasmid.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
We initially cloned murine angiostatin and endostatin cDNAs into the PCI vector, generating PCI-Angio and PCI-Endo, respectively. In vitro transcription and translation analysis confirmed the expression of angiostatin or endostatin gene products from PCI-Angio or PCI-Endo (Fig. 1A)Citation . Fusion proteins of CAT with angiostatin or endostatin were then constructed to ensure that the promoter, the start codon, and the signal peptide of the PCI-Angio and PCI-Endo constructs were functionally intact. Initially, we chose to transfect CHO cells with our constructs due to their high transfection efficiency. Western blotting analysis of conditioned media from CHO cells transfected with PCI-Angio-CAT and PCI-Endo-CAT showed clearly detectable levels of Angio-CAT and Endo-CAT proteins, respectively (Fig. 1B)Citation . Cell lysates from transfected CHO cells expressing the CAT protein were used as a positive control. The gel mobility differences between Angio-CAT, Endo-CAT, and CAT corresponded to their predicted molecular weights. This experiment showed that CHO cells that have been transfected with the PCI-Angio-CAT or PCI-Endo-CAT plasmids efficiently secreted the fusion proteins into the culture media. Because construction of the fusion proteins did not disturb the signal peptide sequences of PCI-Angio or PCI-Endo vectors, this experiment suggests that angiostatin and endostatin are also secreted efficiently into the media.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression of angiostatin and endostatin. A, the translational products of PCI-Angio (Lane 1) and PCI-Endo (Lane 2) were separated by electrophoresis on a 12% denaturing gel as described in the "Materials and Methods." B, secretion of angiostatin-CAT and endostatin-CAT. Western analysis of total protein (10 µg) from conditioned media of CHO cells transfected with PCI (Lane 1), PCI-Angio-CAT (Lane 2), or PCI-Endo-CAT (Lane 3) was performed on a 12% SDS-PAGE gel. Cell lysate from CHO cells transfected with PCI-CAT was used as control (Lane 4). C, secretion of endostatin by CHO or MDA-MB-435 cells transfected with PCI-Endo. An enzyme immunoassay kit was used to measure the amount of endostatin in the unconcentrated conditioned media.

 
To verify this, conditioned media from MDA-MB-435 or CHO cells transfected with PCI-Endo were analyzed for the presence of endostatin. Endostatin levels were 610 and 724 ng/mg cell protein in MDA-MB-435 (Fig. 1C)Citation and CHO cells, respectively. In cells transfected with PCI-Angio, we were unable to detect angiostatin directly due to the lack of a specific antimouse angiostatin antibody.

To ensure that angiostatin and endostatin derived from our plasmids are antiangiogenic, we tested their ability to reduce angiogenesis with an in vivo assay. Matrigel impregnated with bFGF was used to induce neovascularization. Measurement of the hemoglobin content of the gel indicated the formation of a functional vasculature at the site of angiogenesis in the presence of bFGF (17) . Furthermore, sections of the gel examined with H&E showed endothelial-like cells and neovessels with RBCs in the lumen, indicative of angiogenesis. Addition of the media conditioned by PCI-Angio- or PCI-Endo-transfected CHO cells in the Matrigel/bFGF mixture showed marked inhibition of neovascularization as measured by both hemoglobin content (Fig. 2A)Citation and examination of the gel for infiltrating vessels (Fig. 2B)Citation . Similarly, media from MDA-MB-435 cells transfected with PCI-Angio or PCI-Endo inhibited angiogenesis in an in vivo Matrigel assay (data not shown). These observations are consistent with the antiangiogenic effect of angiostatin and endostatin described previously (2 , 3) .



View larger version (81K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Inhibition of neovascularization in Matrigel using the concentrated conditioned media. The concentrated conditioned media from the CHO cells transfected with PCI control, PCI-Angio, or PCI-Endo were mixed with 50 µl of Matrigel with or without bFGF (0.1 µg). A total of 0.4 ml of this Matrigel was injected into each mouse. At 7 days after the initial injection, the Matrigel plug was removed and bisected. A, hemoglobin in the Matrigel plug was measured using the Drabkin method and normalized by the weight of Matrigel. Data represent the mean hemoglobin values from three mice with SE as indicated; + FGF, {blacksquare}; -FGF, {square}; PCI-Endo + FGF or PCI-Angio + FGF versus PCI vector + FGF, *, P < 0.05. B, Histology of recovered gel. Samples were prepared for histology after the injection of Matrigel containing bFGF. Representative fields show inhibition of angiogenesis by PCI-Endo and PCI-Angio supernatants relative to PCI control. Bar, 50 µm.

 
To investigate the effect of PCI-Angio or PCI-Endo on tumor growth, a liposome:DNA complex was injected into pre-established human MDA-MB-435 breast carcinomas grown in athymic mice. The liposome:DNA complex consisted of 33 nmol of liposome and 2.9 µg of DNA. As shown in Fig. 3Citation , tumors from the PCI-Angio and PCI-Endo groups were smaller than those from the untreated group at days 21 and 28 (P < 0.05). The PCI-Endo group was significantly different from the PCI control at day 28 (P < 0.05). After the third injection (day 28), the mice treated with PCI-Angio and PCI-Endo showed a 36% and 49% reduction, respectively, in tumor size compared to the untreated group. These results indicate that local angiostatin and endostatin gene therapy with liposomes as a carrier effectively inhibits tumor growth in vivo. These treatment groups differed from the control groups, despite the finding that the transfection efficiency of an intratumoral injection of a liposome complexed to a CAT marker gene was 5% (data not shown).



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. PCI-Angio and PCI-Endo inhibit tumor growth. Six days after inoculation of MDA-MB-435 cells into the mammary fat pad, 40 mice were separated into four groups: (a) untreated ({triangledown}); (b) PCI empty vector (•); (c) liposome: PCI-Endo ({blacktriangledown}); or (d) liposome:PCI-Angio ({circ}). Tumors were measured before each injection and 7 days after the last injection. Mice received three intratumoral injections of the liposome plasmid complexes. After the second injection (day 21), both the PCI-Endo and the PCI-Angio groups were statistically different from the untreated controls (*, P < 0.05), whereas after the third injection (day 28), the PCI-Endo group was different from the PCI control (**, P < 0.05).

 
Because the intratumoral injection with PCI-Endo appeared to be more effective than PCI-Angio, we investigated whether the i.v. administration of PCI-Endo would inhibit tumor growth. To ensure that endostatin was expressed in vivo, we measured serum levels 1 and 2 days after i.v. injections. The endostatin levels at 24 and 48 h after injection were 10.8 and 33 ng/ml, respectively. The ability to measure serum endostatin levels in vivo quickly without sacrificing the animal should facilitate the development of nonviral carriers and plasmids with increased expression. We then determined whether endostatin administered i.v. decreased tumor growth (Fig. 4)Citation . After the third injection, there was a significant reduction in tumor size of mice treated with plasmids encoding endostatin compared to untreated controls (P < 0.05). By the sixth injection, there was a 40% reduction in the liposome:PCI-Endo-treated group compared to either the liposome:PCI-treated or the untreated groups (P < 0.05).



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Systemic injection of liposome:DNA complexes into nude mice bearing MDA-MB-435 tumors. Tumor volume (mm3) was measured in the groups [untreated ({circ}), PCI (•), and PCI-Endo ({blacktriangledown})] at each treatment injection time. By the third injection, there was a significant difference between PCI-Endo and the untreated control group, and by the fifth injection, there was a difference between the PCI-Endo and the PCI groups. *, PCI-Endo versus untreated, P < 0.05; **, PCI-Endo versus PCI, P < 0.05.

 
To achieve further tumor reduction, further advancements in nonviral delivery systems will need to be accomplished. Our report demonstrates that the liposome:endostatin plasmid complexes inhibit the tumor when given i.v., although several laboratories have shown that the vast majority of the liposome:plasmid complexes target the lung (18) . As a result, tumors and their vessels located outside the lung are transfected inefficiently by liposome:plasmid complexes (15) . Increased specificity of these liposome:DNA complexes may allow more endostatin to be expressed in the peritumoral area and limit the effect of endostatin on normal physiological angiogenic processes. Coupling peptides, which target the tumor endothelial cells, to the liposomes and changing the liposome composition may further increase the specificity of this therapy (19) .

In summary, gene therapy is one attractive option to deliver the angiogenic polypeptide inhibitors angiostatin and endostatin. We have demonstrated that cationic liposomes complexed to plasmids that encoded angiostatin and endostatin inhibited the growth of human breast cancer implanted in the mouse model with either intratumoral or i.v. administration. This report should provide a basis for further development of nonviral delivery of antiangiogenic genes.


    ACKNOWLEDGMENTS
 
We thank Drs. Antonino Passaniti and Lynne Abruzzo for careful reading and useful comments concerning the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the NIH Grant CA70394 and the Karl C. Dod Charitable Trust. Back

2 To whom request for reprints should be addressed, at Department of Pathology, University of Maryland at Baltimore, Room 7-59, Building MSTF, 10 South Pine Street, Baltimore, MD 21201. Phone: (410) 706-3223; Fax: (410) 706-8414. Back

3 The abbreviations used are: PCI-Angio, plasmid expressing angiostatin; PCI-Endo, plasmid expressing endostatin; CAT, chloramphenicol acetyltransferase; CHO, Chinese hamster ovary; bFGF, basic fibroblast growth factor. Back

Received 5/ 4/99. Accepted 5/28/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Folkman J. Antiangiogenic therapy DeVita V. T., Jr. Hellman S. Rosenberg S. A. eds. . Cancer: Principles & Practice of Oncology, : 3075-3085, Lippincott-Raven Philadelphia 1997.
  2. O’Reilly M. S., Holmgren L., Shing Y., Chen C., Rosenthal R. A., Moses M., Lane W. S., Cao Y., Sage E. H., Folkman J. Angiostatin: a novel angiogenesis inhibitor that mediates the suppression of metastases by a lewis lung carcinoma. Cell, 79: 315-328, 1994.[Medline]
  3. O’Reilly M. S., Boehm T., Shing Y., Fukai N., Vasios G., Lane W. S., Flynn E., Birkhead J. R., Olsen B. R., Folkman J. Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell, 88: 277-285, 1997.[Medline]
  4. O’Reilly M. S., Holmgren L., Chen C., Folkman J. Angiostatin induces and sustains dormancy of human primary tumors in mice. Nat. Med., 2: 689-692, 1996.[Medline]
  5. Cao Y., O’Reilly M. S., Marshall B., Flynn E., Ji R. W., Folkman J. Expression of angiostatin cDNA in a murine fibrosarcoma suppresses primary tumor growth and produces long-term dormancy of metastases. J. Clin. Investig., 101: 1055-1063, 1998.[Medline]
  6. Folkman J. Antiangiogenic gene therapy. Proc. Natl. Acad. Sci. USA, 95: 9064-9066, 1998.[Free Full Text]
  7. Tanaka T., Cao Y., Folkman J., Fine H. A. Viral vector-targeted antiangiogenic gene therapy utilizing angiostatin complementary DNA. Cancer Res., 58: 3362-3369, 1998.[Abstract/Free Full Text]
  8. Goldman C. K., Kendall R. L., Cabrera G., Soroceanu L., Heike Y., Gillespie G. Y., Siegal G. P., Mao X., Bett A. J., Huckle W. R., Thoma K. A., Curiel D. T. Paracrine expression of a native soluble vascular endothelial growth factor receptor inhibits tumor growth, metastasis, and mortality rate. Proc. Natl. Acad. Sci. USA, 95: 8795-8800, 1998.[Abstract/Free Full Text]
  9. Lin P., Buxton J. A., Acheson A., Radziejewski C., Maisonpierre P. C., Yancopoulos G. D., Channon K. M., Hale L. P., Dewhirst M. W., George S. E., Peters K. G. Antiangiogenic gene therapy targeting the endothelium-specific receptor tyrosine kinase Tie2. Proc. Natl. Acad. Sci. USA, 95: 8829-8834, 1998.[Abstract/Free Full Text]
  10. Griscelli F., Li H., Griscelli A. B., Soria J., Opolon P., Soria C., Perricaudet M., Yeh P., Lu H. Angiostatin gene transfer: inhibition of tumor growth in vivo by blockage of endothelial cell proliferation associated with a mitosis arrest. Proc. Natl. Acad. Sci. USA, 95: 6367-6372, 1998.[Abstract/Free Full Text]
  11. Kong H. L., Hecht D., Song W., Kovesdi I., Hachett N. R., Yayon A., Crystal R. G. Regional suppression of tumor growth by in vivo transfer of a cDNA encoding secreted form of the extracellular domain of the flt-1 vascular endothelial growth factor receptor. Hum. Gene Ther., 9: 823-833, 1998.[Medline]
  12. Lesson-Wood L. A., Kim W. H., Kleinman H. K., Weintraub B. D., Mixson A. J. Systemic gene therapy with p53 reduces growth and metastases of a malignant human breast cancer in nude mice. Hum. Gene Ther., 6: 395-405, 1995.[Medline]
  13. Nabel E. G., Gordon D., Yang Z. H., Xu L., San H., Plautz G. E., Wu B. Y., Juang L., Nabel G. J. Gene transfer in vivo with DNA-liposome complexes: lack of autoimmunity and gonadal localization. Hum. Gene Ther., 3: 649-656, 1992.[Medline]
  14. Stewart M. J., Plautz G. E., Buono L. D., Yang Z. Y., Xu L., Gao X., Huang L., Nabel E. G., Nabel G. J. Gene transfer in vivo with DNA-liposome complexes: safety and acute toxicity in mice. Hum. Gene Ther., 3: 267-275, 1992.[Medline]
  15. Xu M., Kumar D., Srinivas S., Detolla L. J., Yu S. F., Stass S. A., Mixson A. J. Parenteral gene therapy with p53 inhibits human breast tumors in vivo through a bystander mechanism without evidence of toxicity. Hum. Gene Ther., 8: 177-185, 1997.[Medline]
  16. Sargent T. D., Yang M., Bonner J. Nucleotide sequence of cloned rat serum albumin messenger RNA. Proc. Natl. Acad. Sci. USA, 78: 243-246, 1981.[Abstract/Free Full Text]
  17. Passaniti A., Taylor R. M., Pili R., Guo Y., Long P. V., Haney J. A., Pauly R. R., Grant D. S., Martin G. R. A simple, quantitative method for assessing angiogenesis and antiangiogenic agents using reconstituted basement membrane, heparin, and fibroblast growth factor. Lab. Investig., 67: 519-528, 1992.[Medline]
  18. Thurston G., McLean J. W., Rizen B., Haskel A., Murphy T. J., Hanahan D., McDonald D. M. Cationic liposomes target angiogenic endothelial cells in tumors and chronic inflammation in mice. J. Clin. Investig., 101: 1410-1413, 1998.
  19. Arap W., Pasqualini R., Ruoslahti E. Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science (Washington DC), 279: 377-381, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
B. Schaffhauser, T. Veikkola, K. Strittmatter, H. Antoniadis, K. Alitalo, and G. Christofori
Moderate antiangiogenic activity by local, transgenic expression of endostatin in Rip1Tag2 transgenic mice
J. Leukoc. Biol., October 1, 2006; 80(4): 669 - 676.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
X.-P. Li, C. Y.S. Li, X. Li, Y. Ding, L. L.Y. Chan, P.-H. Yang, G. Li, X. Liu, J. S. Lin, J. Wang, et al.
Inhibition of human nasopharyngeal carcinoma growth and metastasis in mice by adenovirus-associated virus-mediated expression of human endostatin
Mol. Cancer Ther., May 1, 2006; 5(5): 1290 - 1298.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Q. Zhang, M. Nie, J. Sham, C. Su, H. Xue, D. Chua, W. Wang, Z. Cui, Y. Liu, C. Liu, et al.
Effective Gene-Viral Therapy for Telomerase-Positive Cancers by Selective Replicative-Competent Adenovirus Combining with Endostatin Gene
Cancer Res., August 1, 2004; 64(15): 5390 - 5397.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. I. Kim, K. S. Kim, H. S. Kim, D. S. Kim, Y. Jang, K. H. Chung, and Y. S. Park
Inhibitory Effect of the Salmosin Gene Transferred by Cationic Liposomes on the Progression of B16BL6 Tumors
Cancer Res., October 1, 2003; 63(19): 6458 - 6462.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
A. Reijerkerk, L. O. Mosnier, O. Kranenburg, B. N. Bouma, P. Carmeliet, T. Drixler, J. C.M. Meijers, E. E. Voest, and M. F.B.G. Gebbink
Amyloid Endostatin Induces Endothelial Cell Detachment by Stimulation of the Plasminogen Activation System
Mol. Cancer Res., June 1, 2003; 1(8): 561 - 568.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Saimura, E. Nagai, K. Mizumoto, N. Maehara, Y. A. Minamishima, M. Katano, K. Matsumoto, T. Nakamura, and M. Tanaka
Tumor Suppression through Angiogenesis Inhibition by SUIT-2 Pancreatic Cancer Cells Genetically Engineered to Secrete NK4
Clin. Cancer Res., October 1, 2002; 8(10): 3243 - 3249.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
F. A. Scappaticci
Mechanisms and Future Directions for Angiogenesis-Based Cancer Therapies
J. Clin. Oncol., September 15, 2002; 20(18): 3906 - 3927.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C. Ye, C. Feng, S. Wang, X. Liu, Y. Lin, and M. Li
Antiangiogenic and Antitumor Effects of Endostatin on Follicular Thyroid Carcinoma
Endocrinology, September 1, 2002; 143(9): 3522 - 3528.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Q.-R. Chen, L. Zhang, P. W. Luther, and A. J. Mixson
Optimal transfection with the HK polymer depends on its degree of branching and the pH of endocytic vesicles
Nucleic Acids Res., March 15, 2002; 30(6): 1338 - 1345.
[Abstract] [Full Text] [PDF]


Home page
Neuro Oncol DukeHome page
D. R. Sorensen, T.-A. Read, T. Porwol, B. R. Olsen, R. Timpl, T. Sasaki, P. O. Iversen, H. B. Benestad, B. K. L. Sim, and R. Bjerkvig
Endostatin reduces vascularization, blood flow, and growth in a rat gliosarcoma
Neuro-oncol, January 1, 2002; 4(1): 1 - 8.
[Abstract] [PDF]


Home page
JNCI J Natl Cancer InstHome page
A. L. Feldman, H. R. Alexander, S. M. Hewitt, D. Lorang, C. E. Thiruvathukal, E. M. Turner, and S. K. Libutti
Effect of Retroviral Endostatin Gene Transfer on Subcutaneous and Intraperitoneal Growth of Murine Tumors
J Natl Cancer Inst, July 4, 2001; 93(13): 1014 - 1020.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Indraccolo, M. Morini, E. Gola, F. Carrozzino, W. Habeler, S. Minghelli, L. Santi, L. Chieco-Bianchi, Y. Cao, A. Albini, et al.
Effects of Angiostatin Gene Transfer on Functional Properties and in Vivo Growth of Kaposi's Sarcoma Cells
Cancer Res., July 1, 2001; 61(14): 5441 - 5446.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Mori, A. Ando, P. Gehlbach, D. Nesbitt, K. Takahashi, D. Goldsteen, M. Penn, C. T. Chen, K. Mori, M. Melia, et al.
Inhibition of Choroidal Neovascularization by Intravenous Injection of Adenoviral Vectors Expressing Secretable Endostatin
Am. J. Pathol., July 1, 2001; 159(1): 313 - 320.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. L. Feldman, S. K. Libutti, and A. J. Mixson
Correspondence re: Q-R. Chen et al., Liposomes Complexed to Plasmids Encoding Angiostatin and Endostatin Inhibit Breast Cancer in Nude Mice. Cancer Res., 59: 3308-3312, 1999.
Cancer Res., March 1, 2001; 60(5): 1463 - 1464.
[Full Text]


Home page
Cancer Res.Home page
I. Ding, J. Z. Sun, B. Fenton, W. M. Liu, P. Kimsely, P. Okunieff, and W. Min
Intratumoral Administration of Endostatin Plasmid Inhibits Vascular Growth and Perfusion in MCa-4 Murine Mammary Carcinomas
Cancer Res., January 1, 2001; 61(2): 526 - 531.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
A. K. Khanna and J. D. Hosenpud
In Vitro and In Vivo Transfection of p21 Gene Enhances Cyclosporin A-Mediated Inhibition of Lymphocyte Proliferation
J. Immunol., August 15, 2000; 165(4): 1882 - 1888.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Zhang, D. Yu, M. Hu, S. Xiong, A. Lang, L. M. Ellis, and R. E. Pollock
Wild-Type p53 Suppresses Angiogenesis in Human Leiomyosarcoma and Synovial Sarcoma by Transcriptional Suppression of Vascular Endothelial Growth Factor Expression
Cancer Res., July 1, 2000; 60(13): 3655 - 3661.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. G. Sacco, M. Caniatti, E. M. Catò, A. Frattini, G. Chiesa, R. Ceruti, F. Adorni, L. Zecca, E. Scanziani, and P. Vezzoni
Liposome-delivered Angiostatin Strongly Inhibits Tumor Growth and Metastatization in a Transgenic Model of Spontaneous Breast Cancer
Cancer Res., May 1, 2000; 60(10): 2660 - 2665.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
A. L. Feldman, N. P. Restifo, H. R. Alexander, D. L. Bartlett, P. Hwu, P. Seth, and S. K. Libutti
Antiangiogenic Gene Therapy of Cancer Utilizing a Recombinant Adenovirus to Elevate Systemic Endostatin Levels in Mice
Cancer Res., March 1, 2000; 60(6): 1503 - 1506.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Kuo, F. Farnebo, E. Y. Yu, R. Christofferson, R. A. Swearingen, R. Carter, H. A. von Recum, J. Yuan, J. Kamihara, E. Flynn, et al.
Comparative evaluation of the antitumor activity of antiangiogenic proteins delivered by gene transfer
PNAS, April 10, 2001; 98(8): 4605 - 4610.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. V. Sauter, O. Martinet, W.-J. Zhang, J. Mandeli, and S. L. C. Woo
Adenovirus-mediated gene transfer of endostatin in vivo results in high level of transgene expression and inhibition of tumor growth and metastases
PNAS, April 25, 2000; 97(9): 4802 - 4807.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Q.-R.
Right arrow Articles by Mixson, A. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Q.-R.
Right arrow Articles by Mixson, A. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online