| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Department of Molecular Biotherapy Research, Cancer Chemotherapy Center, Japanese Foundation for Cancer Research, Tokyo 170-8455 [N. S., Y. Y., M. O., W-p. Z., H. H.]; Department of Neurosurgery, Tokyo University, Tokyo 113 [N. S., A. A., T. K.]; Department of Anatomy and Histology, Fukushima Medical College, Fukushima 960-1295 [R. T.]; and CREST (Core Research for Evolutional Science and Technology), Kawaguchi 332-0012 [T. K.], Japan
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Because the total dose of Adv for the treatment of gliomas is restricted due to the toxicity of Adv to the brain (11) , augmentation of transduction efficiency and more specific infection of this Adv (Adv-E1AdB) to gliomas are required. Recently, using an adenoviral vector with a fiber mutant, F/K20, which has a stretch of 20 lysine residues added at the COOH-terminus of the fiber, the transduction efficiency to gliomas was increased by more than 10 times compared with that of the adenoviral vector with the wt fiber (12) . In this study, to improve the cytopathic effect of Adv-E1AdB with wt fiber (Adv-E1AdB-F/wt), we constructed Adv-E1AdB with F/K20 (Adv-E1AdB-F/K20) and examined its antitumoral effect.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
Construction of Recombinant Adv.
Here we cite the reported nucleotide numbers (nt) in the Ad5 genome (GenBank M73260) to define the position of the restriction enzyme sites. An Ad5 mutant with an E3 deletion, lacking 1879 bp from nt28592 to nt30470 (Ad5dlX; Ref. 14
), was used for vector construction. The 3471 bp SacII fragment (nt354 to nt3824) from Ad5dlX was subcloned into the SacII site of pBluescript SKII+ (Stratagene), resulting in pSKII+[S-S]. The 985-bp SacII/XbaI fragment (nt354 to nt1339) from pSKII[S-S] was subcloned into the SacII/XbaI sites of pBluescript SKII+, resulting in pSKII+[S-Xb]. The AflIII site (nt458) of pSKII+[S-Xb] was blunted and ligated with a ClaI linker pdCATCGATG, resulting in pSKd+[A-Xb]c. The 1861-bp PvuII fragment (nt623 to nt2484) from pSKII+[S-S] was subcloned into the SmaI site of pCI (Promega), resulting in pCI+[P-P]. The 1396-bp XbaI/BamHI fragment from pCI+[P-P], which contains the XbaI/PvuII (nt881 to nt2484) from Ad5 and the SV40 late poly(A) addition signal, was subcloned into the XbaI/BamHI sites of pSKd+[A-Xb]c, resulting in pSKd+[A-P]c.
An E1B176R DNA fragment with a CGA to TGA mutation at the 3rd codon of the E1B55K open reading frame was obtained by PCR, using the template pSKII+[S-S] and the following primers, the sequences of which are: 5'CGGAATTCACCATGGAGGCTTGGGAGTGTTTGGAAG3' and 5'CAGCAGGTACCCCCCGCTCAGATGGGTTTCTTCACTCCATTTATCCTTTA3'. The 
300-bp PCR product was digested with EcoRI/KpnI and subcloned into the EcoRI/KpnI sites of pBluescript SKII+, resulting in pSKII+E1B176R (TGA55K). The sequence of the fragment was confirmed to be identical with the expected sequence by DNA sequencing. The 278-bp SacI/KpnI fragment from pSKII+E1B176R (TGA-55K) was subcloned into the SacI/KpnI sites (corresponding to nt1770 and nt2048 of Ad5, respectively) of pSKd+[A-P]c, resulting in pSKd+[A-P] (TGA55K). The ClaI fragment from pSKd+[A-P] (TGA55K) containing E1A, E1B19K, and SV40 poly(A) addition signal sequences, which was designated E1AdB, was subcloned into the ClaI site of pAx-cw (14)
, resulting in pAxE1AdB. In summary, the pAxE1AdB contains a C to T point mutation at nt2025, and the 240-bp late poly(A) addition signal from SV40 in place of the 844-bp deletion from the PvuII (nt2484) to the BglII (nt3328) site in the E1B55 region.
Recombinant Adv was constructed essentially according to the procedure described previously (14) , using Ad5dlX DNA-TPC and pAx cosmid. Briefly, the Adv AxE1AdB was generated by cotransfection of 293 cells with the pAxE1AdB cosmid DNA together with the Ad5dlX DNA-TPC, which had been digested with NsiI. After plaque purification and restriction enzyme mapping, AxE1AdB adenoviral clones without the artificial ClaI site at the left-side end of the inserted E1A were used. The TGA stop codon at the 3rd codon of E1B55K in these AxE1AdB adenoviral clones was confirmed by DNA sequencing.
The generation of fiber-mutant Adv vectors was carried out essentially as described previously (12) . Briefly, the fiber-mutant construct in the plasmid that consisted of the right-side two-thirds of the Ad5 genome (pTR), was cotransfected with Ad5 DNA-TPC, efficiently yielding the recombinant Adv with the fiber mutant that has a linker and a stretch of 20 lysine residues added at the COOH-terminus of the fiber. The DNA-TPC from the mutant Adv was then used to produce a second-step recombinant Adv with deletion of E1B55K to generate Adv-E1AdB-F/K20. Adv-lacZ-F/K20 and Adv-lacZ-F/wt were constructed as described previously (12) . The transduction efficiency of Adv with wt fiber and Adv with F/K20 was compared by infection with Adv-lacZ-F/K20 and Adv-lacZ-F/wt. Staining with X-Gal (5-bromo-4-chloro-3-indoyl-b-D-galactopyranoside) was performed as described previously (15) .
Assay for Replication.
Twenty thousand U-373 MG cells were infected with Adv-lacZ, Adv-E1AdB-F/wt, or Adv-E1AdB-F/K20 at a MOI of 30. On day 6, the degree of replication of Adv was quantitated by measuring the titer of Adv by a standard plaque formation assay using 293 cells.
MTT Assay.
Two thousand U-373 MG cells/well in 96-well microtiter plates were infected with Adv-E1AdB-F/K20, Adv-E1AdB-F/wt, or Adv-lacZ-F/K20 at MOI of 0.4, 2, 10, 50, and 250 (n = 8). On day 5, the percentage of surviving cells was measured using a modification of the MTT assay (16)
. Briefly, 100 µl of 0.5 mg/ml MTT (M-2128; Sigma Chemical Co.) solution was added to each well. The U-373 MG cells were incubated for 1 h at 37°C, and then 100 µl of 100% isopropanol and 0.04N HCl were added. Colorimetry was performed using the microplate reader (Model 3550; Bio-Rad, Hercules, CA). For each MOI, more than two experiments were performed, each representing the average of eight wells. Cell survival was expressed as the mean ± SE of the percentage of surviving cells relative to that in the control groups without infection.
Human Glioma Therapy Model in Nude Mice.
U-373 MG tumor xenografts of 2.5 mm in diameter, from mice bearing U-373 MG tumors, were transplanted s.c. into BALB/cAnNCjr-nu/nu mice. Tumors with diameters of 5–10 mm developed 14 days after transplantation. The mice were divided into three groups (n = 6/group) and received intratumoral injection of Adv-E1AdB-F/K20, Adv-E1AdB-F/wt, or Adv-lacZ-F/K20 at 6 x 106 pfu in a 50-µl volume using a 26-gauge needle, on days 0, 1, and 2. The tumor diameter was measured twice a week, and the volume (product of 0.4 x length x width x width) was calculated. Tumor volumes are expressed as the mean ± SE. Statistical analysis was performed using ANOVA, followed by Fisher’s exact test, and P < 0.05 was considered to be statistically significant.
Immunohistochemistry.
Immunohistochemical analysis for the presence of Adv hexon protein was done by one of two methods. The first method involved the use of acetone/methanol (1:1)-fixed cultured tumor cells on a Lab Tek Chamber slide (Nalge Nunc International, Naperville, IL) and the DAKO LSAB kit (DAKO Japan, Kyoto, Japan), according to the manufacturer’s instructions. Briefly, the primary antibody (MAB805; Chemicon International, Temecule, CA) was applied to the cultured cells at 1:400 dilution, and then a biotinylated goat antimouse secondary antibody was applied, followed by a streptavidin-horseradish peroxidase conjugate. The second method involved the use of formalin-fixed, paraffin-embedded tumor sections. The tumor sections were pretreated with 0.05% Pronase (S2013; DAKO Japan) for 10 min at room temperature after the removal of paraffin. The primary 1:400 diluted antibody (MAB805) was applied overnight at 4°C, followed by application of streptavidin-horseradish peroxidase conjugate. 3–3' Diaminobenzidine tetrahydrochloride and 3-amino-9-ethyl carbazole were used as the chromogens for the cultured cells and in vivo tumor tissues, respectively. Counterstaining was done with hematoxylin. The control stainings were performed using the isotype-matched mouse monoclonal antibody (IgG1
), instead of the primary.
|
RESULTS AND DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
. The MOI for transduction of 50% of the population (ED50) of Adv-lacZ-F/K20 and Adv-lacZ-F/wt was 17 and 1.8, respectively. Similarly, in other glioma cells (A-172, U251, and T98G), the ED50 of Adv-lacZ-F/K20 was 10 times higher than that of Adv-lacZ-F/wt (12)
. We also tested the transduction efficiency of Adv-lacZ-F/K20 and Adv-lacZ-F/wt in rat glioma cells (i.e., C6 and 9L), as well as differentiated rat PC-12 cells, which is used as a model of neurons (17)
. The transduction efficiency of Adv-lacZ-F/K20 in C6 and 9L cells, was three and four times higher than that of Adv-lacZ-F/wt in the respective cell lines, whereas the transduction efficiency of Adv-lacZ-F/K20 in differentiated PC-12 cells was about one-third that of Adv-lacZ-F/wt (data not shown). Although additional studies are needed to clarify the differential transduction efficiency in human neural tissues, these results suggest that the F/K20 mutation would preferentially support Adv infection to gliomas, but not neurons.
|
. On the other hand, only 2% of the U-373 MG cells infected with Adv-E1AdB-F/wt at the same MOI of 2, were stained (Fig. 1B, 2)
. None of the cells infected with Adv-lacZ-F/K20 was stained with the antihexon antibody (Fig. 1B, 1)
, suggesting that the presence of hexon-positive cells is associated with Adv replication. The results indicate that the percentage of cells that contained replicated Adv by infection with Adv-E1AdB-F/K20 at the end of the 4-day in vitro culture was 50 times higher than that by infection with Adv-E1AdB-F/wt.
Adv-E1AdB-F/K20 Showed More Drastic in Vitro and in Vivo Cytopathic Effect Compared with That of Adv-E1AdB-F/wt in U-373 MG Cells.
U-373 MG cells were infected with Adv-E1AdB-F/K20, Adv-E1AdB-F/wt, and Adv-lacZ-F/K20 at various MOI, and the cytopathic effect was analyzed by MTT assay 5 days after infection. The MOI for cell death of 50% of the population (ED50) of Adv-E1AdB-F/K20 was 0.77, whereas the ED50 of Adv-E1AdB-F/wt was 25 (Fig. 1C)
. Thus, the in vitro cytopathic effect of Adv-E1AdB-F/K20 is about 32 times stronger than that of Adv-E1AdB-F/wt. This enhanced cytopathic effect of Adv-E1AdB-F/K20 is most likely due to the enhanced infectivity of Adv-E1AdB-F/K20, which has been demonstrated by the antihexon immunostaining for Adv (Fig. 1B)
and the reporter lacZ gene expression (Fig. 1A)
.
The in vivo antitumoral effect of intratumoral injections of Adv-E1AdB-F/K20, Adv-E1AdB-F/wt, and Adv-lacZ-F/K20 was analyzed in nude mice bearing U-373 MG tumors. Intratumoral injection of Adv-E1AdB-F/K20 resulted in significant tumor growth inhibition compared with that in the tumors injected with Adv-E1AdB-F/wt (Fig. 2A
; P = 0.003) and with Adv-lacZ-F/K20 (Fig. 2A
; P = 0.03). Because the total pfu used in this study was as low as 1.8 x 107 pfu/mouse, which is one-thirtieth of the total pfu used in a previous study (6)
, Adv-E1AdB-F/wt did not inhibit tumor growth. Adv-E1AdB-F/K20 had a drastic antitumoral effect at a MOI at which Adv-E1AdB-F/wt did not show an antitumoral effect. Distinct virus replication was documented in the U-373 MG tumors injected with Adv-E1AdB-F/K20 by immunohistochemical staining for Adv hexon protein (Fig. 2B, 3 and 4)
, which was performed as early as on the 8th day after infection. Although <5% of the cells were hexon-positive 8 days after injection of Adv, the growth of tumors injected with Adv-E1AdB-F/K20 was completely inhibited up through 4 weeks after infection, suggesting that extensive in vivo replication of Adv-E1AdB-F/K20 occurred from the 8th day on. In addition, it is important to determine whether the direct cytopathic effect of virus replication or the bystander tumor-infiltrating immune cells mainly contributed to the therapeutic effect. Additional studies are necessary to document the time course of the intratumoral Adv replication and the invasion of immune cells. In the U-373 MG xenografts injected with Adv-E1AdB, hexon-positive cells were only very scarcely found (Fig. 2B, 2)
. Hexon-positive cells were not found in any of the U-373 MG xenografts injected with control Adv-lacZ-F/K20 (Fig. 2B, 1)
.
|
The high transduction efficiency obtained by the F/K20 mutant Adv is beneficial to the therapy of gliomas in various respects. First, an increase of transduction efficiency will augment the expression of transduced genes. In U-373 MG cells, the transduction efficiency of Adv-lacZ-F/K20 was nine times higher than that of Adv-lacZ-F/wt, and the cytopathic effect of Adv-E1AdB-F/K20 was 32 times stronger than that of Adv-E1AdB-F/wt. The high transduction efficiency of Adv-E1AdB-F/K20 led to high replication activity, which resulted in a remarkably augmented cytopathic effect of Adv-E1AdB-F/K20. It is to be noted that U-373 MG cells are deleted for p53, and it is possible that Adv-E1AdB-F/K20 may be more effective for killing glioma cells with loss of wild-type p53 function. Therefore, it would be interesting to evaluate the cytopathic effect of Adv-E1AdB-F/K20 in the gliomas with or without wild-type p53 function.
To obtain stronger cytotoxicity, a combination of proapoptotic gene expression with the E1AdB vector may be rewarding. Recently, we have shown that infection of Advs that encode proapoptotic genes, such as Fas ligand, induced a remarkable cytopathic effect in gliomas (22) . The coexpression of proapoptotic genes with Adv-E1AdB-F/K20 could lead to an enhanced antitumoral effect by working together with viral gene products to induce apoptosis of the host cells.
Another advantage is that enhancement of transduction efficiency reduces the total dose of Adv to obtain the same level of cytopathic effect. It has been reported that injection of Adv doses over 1010 pfu into the human brain is toxic (11) . Even if the damage of Adv infection is limited to only a small area of the brain, it might be fatal or severely disabling because the brain contains the important integral area of neural activity. Therefore, it is important to minimize the total dose of Adv administration as much as possible. It is highly advantageous to use Adv with F/K20 to reduce the toxicity of Adv infection because of its high transduction efficiency to gliomas. Promoters such as E2F (23) and myelin basic protein (24) have been reported to induce gene expression specifically in gliomas. Production of Adv-E1AdB-F/K20, in which the E1A gene is driven by one of these glioma-specific promoters, would be a promising approach to further restrict undesired viral replication. F/K20, the Adv fiber with the stretch of lysine residues, itself did not show any cytotoxic effect in fibroblasts such as WI38 cells (12) and nerve growth factor-treated PC-12 cells (data not shown), and infection of Adv-EIAdB did not damage normal adjacent tissues in head and neck cancers (10) , suggesting that the infection of Adv-E1AdB-F/K20 would be relatively safe to normal tissues. However, to evaluate the undesired effects of Adv-E1AdB-F/K20 for normal human brains, careful basic and clinical studies using this vector is further required.
Adv induces an immune response to the vector by neutralizing antibodies, which mainly consist of antifiber and antihexon antibodies (25 , 26) . Construction of an Adv with a different type of fiber such as F/K20, desirably in combination with a mutant hexon, might be useful to evade the immune response. Additional studies on the immune response to recombinant Adv capsid proteins are required to develop a vector system with which we can repeatedly administer the therapeutic Adv.
In summary, Adv-E1AdB-F/K20 has a significantly stronger cytopathic effect than Adv-E1AdB-F/wt. Although it remains to be determined whether Adv-E1AdB-F/K20 exerts any toxicity to normal brain tissues, this therapeutic approach would be highly promising for the treatment of gliomas.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by a special grant for Advanced Research on Cancer from the Ministry of Education, Science, Sports and Culture of Japan and grants from the Ministry of Health and Welfare of Japan. 
2 To whom requests for reprints should be addressed, at Cancer Chemotherapy Center, Cancer Institute, 1-37-1 Kami-Ikebukuro, Toshima-ku, Tokyo 170-8455, Japan. Phone: 81-3-3918-0111, ext. 4356; Fax: 81-3-3918-3716; E-mail: hhamada{at}jfcr.or.jp
3 The abbreviations used are: Adv, adenovirus; Adv-E1AdB, E1B 55-kDa gene-defective Adv; Adv-F/K20, Adv with a stretch of 20 lysine residues added at the fiber; Adv-F/wt, Adv with wild-type fiber; MOI, multiplicity(ies) of infection; ATCC, American Type Culture Collection; Ad5, wt human Adv type 5; DNA-TPC, DNA-terminal protein complex; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; pfu, plaque-forming unit; nt, nucleotide number.
Received 1/ 8/99. Accepted 5/17/99.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTS AND DISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  W. J. Van Houdt, H. Wu, J. N. Glasgow, M. L. Lamfers, C. M. Dirven, G. Y. Gillespie, D. T. Curiel, and Y. S. Haviv Gene delivery into malignant glioma by infectivity-enhanced adenovirus: In vivo versus in vitro models Neuro-oncol, July 1, 2007; 9(3): 280 - 290. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wakayama, M. Abei, R. Kawashima, E. Seo, K. Fukuda, H. Ugai, T. Murata, N. Tanaka, I. Hyodo, H. Hamada, et al. E1A, E1B Double-Restricted Adenovirus with RGD-Fiber Modification Exhibits Enhanced Oncolysis for CAR-Deficient Biliary Cancers Clin. Cancer Res., May 15, 2007; 13(10): 3043 - 3050. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. O. Kirby, A. Rivera, D. Rein, M. Wang, I. Ulasov, M. Breidenbach, M. Kataram, J. L. Contreras, C. Krumdieck, M. Yamamoto, et al. A Novel Ex vivo Model System for Evaluation of Conditionally Replicative Adenoviruses Therapeutic Efficacy and Toxicity Clin. Cancer Res., December 15, 2004; 10(24): 8697 - 8703. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Chu, D. E. Post, F. R. Khuri, and E. G. Van Meir Use of Replicating Oncolytic Adenoviruses in Combination Therapy for Cancer Clin. Cancer Res., August 15, 2004; 10(16): 5299 - 5312. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Toth, H. Djeha, B. Ying, A. E. Tollefson, M. Kuppuswamy, K. Doronin, P. Krajcsi, K. Lipinski, C. J. Wrighton, and W. S. M. Wold An Oncolytic Adenovirus Vector Combining Enhanced Cell-to-Cell Spreading, Mediated by the ADP Cytolytic Protein, with Selective Replication in Cancer Cells with Deregulated Wnt Signaling Cancer Res., May 15, 2004; 64(10): 3638 - 3644. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Fukuda, M. Abei, H. Ugai, E. Seo, M. Wakayama, T. Murata, T. Todoroki, N. Tanaka, H. Hamada, and K. K. Yokoyama E1A, E1B Double-restricted Adenovirus for Oncolytic Gene Therapy of Gallbladder Cancer Cancer Res., August 1, 2003; 63(15): 4434 - 4440. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Suzuki, R. Alemany, M. Yamamoto, and D. T. Curiel The Presence of the Adenovirus E3 Region Improves the Oncolytic Potency of Conditionally Replicative Adenoviruses Clin. Cancer Res., November 1, 2002; 8(11): 3348 - 3359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. S. Haviv, J. L. Blackwell, A. Kanerva, P. Nagi, V. Krasnykh, I. Dmitriev, M. Wang, S. Naito, X. Lei, A. Hemminki, et al. Adenoviral Gene Therapy for Renal Cancer Requires Retargeting to Alternative Cellular Receptors Cancer Res., August 1, 2002; 62(15): 4273 - 4281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Portella, S. Scala, D. Vitagliano, G. Vecchio, and A. Fusco ONYX-015, an E1B Gene-Defective Adenovirus, Induces Cell Death in Human Anaplastic Thyroid Carcinoma Cell Lines J. Clin. Endocrinol. Metab., June 1, 2002; 87(6): 2525 - 2531. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Tsukuda, R. Wiewrodt, K. Molnar-Kimber, V. P. Jovanovic, and K. M. Amin An E2F-responsive Replication-selective Adenovirus Targeted to the Defective Cell Cycle in Cancer Cells: Potent Antitumoral Efficacy but No Toxicity to Normal Cell Cancer Res., June 1, 2002; 62(12): 3438 - 3447. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. A. Ring Cytolytic viruses as potential anti-cancer agents J. Gen. Virol., March 1, 2002; 83(3): 491 - 502. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. J. Bauerschmitz, J. T. Lam, A. Kanerva, K. Suzuki, D. M. Nettelbeck, I. Dmitriev, V. Krasnykh, G. V. Mikheeva, M. N. Barnes, R. D. Alvarez, et al. Treatment of Ovarian Cancer with a Tropism Modified Oncolytic Adenovirus Cancer Res., March 1, 2002; 62(5): 1266 - 1270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Koch, J. Gatfield, C. Lober, U. Hobom, C. Lenz-Stoppler, J. Roth, and M. Dobbelstein Efficient Replication of Adenovirus Despite the Overexpression of Active and Nondegradable p53 Cancer Res., August 1, 2001; 61(15): 5941 - 5947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Doronin, M. Kuppuswamy, K. Toth, A. E. Tollefson, P. Krajcsi, V. Krougliak, and W. S. M. Wold Tissue-Specific, Tumor-Selective, Replication-Competent Adenovirus Vector for Cancer Gene Therapy J. Virol., April 1, 2001; 75(7): 3314 - 3324. [Abstract] [Full Text]
|
|
|
|
|
|
T. P. Cripe, E. J. Dunphy, A. D. Holub, A. Saini, N. H. Vasi, Y. Y. Mahller, M. H. Collins, J. D. Snyder, V. Krasnykh, D. T. Curiel, et al. Fiber Knob Modifications Overcome Low, Heterogeneous Expression of the Coxsackievirus-Adenovirus Receptor That Limits Adenovirus Gene Transfer and Oncolysis for Human Rhabdomyosarcoma Cells Cancer Res., April 1, 2001; 61(7): 2953 - 2960. [Abstract] [Full Text]
|
|
|
|
|
|
D. Wodarz Viruses as Antitumor Weapons: Defining Conditions for Tumor Remission Cancer Res., April 1, 2001; 61(8): 3501 - 3507. [Abstract] [Full Text]
|
|
|
|
|
|
J. T. Douglas, M. Kim, L. A. Sumerel, D. E. Carey, and D. T. Curiel Efficient Oncolysis by a Replicating Adenovirus (Ad) in Vivo Is Critically Dependent on Tumor Expression of Primary Ad Receptors Cancer Res., February 1, 2001; 61(3): 813 - 817. [Abstract] [Full Text]
|
|
|
|
|
|
K. Suzuki, J. Fueyo, V. Krasnykh, P. N. Reynolds, D. T. Curiel, and R. Alemany A Conditionally Replicative Adenovirus with Enhanced Infectivity Shows Improved Oncolytic Potency Clin. Cancer Res., January 1, 2001; 7(1): 120 - 126. [Abstract] [Full Text]
|
|
|
|
|
|
D. T. Curiel The Development of Conditionally Replicative Adenoviruses for Cancer Therapy Clin. Cancer Res., September 1, 2000; 6(9): 3395 - 3399. [Abstract] [Full Text]
|
|
|
|
|
|
K. Doronin, K. Toth, M. Kuppuswamy, P. Ward, A. E. Tollefson, and W. S. M. Wold Tumor-Specific, Replication-Competent Adenovirus Vectors Overexpressing the Adenovirus Death Protein J. Virol., July 1, 2000; 74(13): 6147 - 6155. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
Hx, antihexon monoclonal antibody. C, in vitro cytopathic effect of Adv-E1AdB-F/K20, Adv-E1AdB-F/wt, and Adv-lacZ-F/K20 for U-373 MG cells. MTT assays were performed as described in "Materials and Methods." The ED50 of Adv-E1AdB-F/wt was 32 times higher than that of Adv-E1AdB-F/K20.