Cancer Research Aziza Shad  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 3698-3704, August 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tartour, E.
Right arrow Articles by Sautèes-Fridman, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tartour, E.
Right arrow Articles by Sautèes-Fridman, C.
[Cancer Research 59, 3698-3704, August 1, 1999]
© 1999 American Association for Cancer Research


Immunology

Interleukin 17, a T-cell-derived Cytokine, Promotes Tumorigenicity of Human Cervical Tumors in Nude Mice1

Eric Tartour2, François Fossiez, Isabelle Joyeux, Annie Galinha, Alain Gey, Emmanuel Claret, Xavier Sastre-Garau, Jérôme Couturier, Veronique Mosseri, Virginie Vives, Jacques Banchereau, Wolf H. Fridman, John Wijdenes, Serge Lebecque and Catherine Sautèes-Fridman

Unité d’Immunologie Clinique, INSERM U 225 and Université Pierre et Marie Curie [E. T., I. J., A. Ga., A. Ge., V. V., W. H. F., C. S-F.], Département de Pathologie [X. S-G., J. C.], and Unité de Biostatistique [V. M.], Institut Curie, 75248 Paris, Cedex 05, France; Schering Plough, 69571 Dardilly, France [F. F., J. B., S. L.]; and Diaclone, BP1985, F25020 Besançon, France [E. C., J. W.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Interleukin (IL) 17 is a proinflammatory cytokine secreted mainly by activated human memory CD4 T cells that induces IL-6, IL-8, and nitric oxide. Because IL-6 and IL-8 have been implicated in the pathogenesis of cervical cancer, we investigated the action of IL-17 on human cervical tumor cell lines in vitro and in vivo. We showed that in vitro, IL-17 increases IL-6 and IL-8 secretion by cervical carcinoma cell lines at both protein and mRNA levels. No direct effect of IL-17 on in vitro proliferation of cervical tumor cell lines could be demonstrated. However, two cervical cell lines transfected with a cDNA encoding IL-17 exhibited a significant increase in tumor size as compared to the parent tumor when transplanted in nude mice. This enhanced tumor growth elicited by IL-17 was associated with increased expression of IL-6 and macrophage recruitment at the tumor site. A potential role of IL-17 in modulation of the human cervical tumor phenotype was also supported by its expression on the cervical tumor in patients with CD4 infiltration. IL-17 therefore behaves like a T-cell-specific cytokine with paradoxical tumor-promoting activity. This may partially explain previous reports concerning the deleterious effect of CD4 T cells in cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
IL-17,3 previously termed CTL-associated antigen 8 (CTLA-8), is a Mr 17,000 cytokine expressed mainly by activated human memory CD4 T cells (1, 2, 3) . Its amino acid sequence shares remarkable homology with that of the thirteenth open reading frame of herpesvirus saimiri, a {gamma} herpes virus causing T-cell lymphoma in monkeys and rabbits (4) . In vitro, this virus could immortalize human CD4 and CD8 T cells via an unknown mechanism that confers an IL-2-based autocrine growth after activation by CD2 upon these cells (5 , 6) . The role of IL-17 in the proliferation of T cells is a matter of discussion. In mice, IL-17 plus suboptimal concentrations of phytohemagglutinin resulted in a modest enhancement of T-cell growth (7) . No similar growth factor activity was observed in the human system (2) . IL-17 is considered to be a proinflammatory cytokine because it has been shown to increase the production of IL-6 and IL-8 in macrophages, fibroblasts, keratinocytes, and synovial cells (2 , 7, 8, 9, 10) and of nitric oxide in human osteoarthritis cartilage via activation of mitogen-activated protein kinase and nuclear factor {kappa}B (11 , 12) . The release of IL-10, IL-12, IL-1R antagonist, and stromelysin was also stimulated by rhIL-17 in human activated macrophages (8) .

Interestingly, in vitro, IL-6 behaves as a growth factor for many tumor cell lines derived from myeloma, lymphoma, Kaposi’s sarcoma, melanoma, and ovarian and renal or bladder cell carcinoma (13) . In mice, IL-6-transfected tumors often exhibited increased tumorigenicity (14, 15, 16) . In myeloma patients, anti-IL-6 mAb administration transiently inhibited myeloma cell proliferation (17) . IL-8, a member of the CXC family of chemotactic cytokines, also stimulates the proliferation of tumor cells because IL-8 is an autocrine growth factor for human melanoma (18) . Its expression by tumor cells is directly correlated with their metastatic potential in nude mice (19) . Therefore, if the activity of IL-17 is mediated via these proinflammatory cytokines, a potential role for IL-17 in tumor cell proliferation may be hypothesized.

Cervical cancer is associated with HPV infection, but additional factors must contribute to its pathogenesis because only a minority of HPV infections result in persistent lesions or progress to malignancy (20) . Various arguments suggest that IL-6 may be involved in the pathogenesis and development of cervical cancers. IL-6 stimulates the growth of both normal cervical cells and HPV-immortalized and cervical carcinoma-derived cell lines (21 , 22) . In vitro, cervical carcinoma cells also secrete higher levels of IL-6 and IL-8 than HPV-infected and normal cervical epithelial cells (23) . Finally, an increased expression of IL-6 mRNA was demonstrated in biopsies derived from invasive cervical carcinoma compared to biopsies derived from cervical intraepithelial neoplasia or normal cervix (24) . The role of IL-17 in the up-regulation of IL-6 and IL-8 expression therefore prompted us to investigate the action of this cytokine on the in vitro and in vivo proliferation of human cervical tumors.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tumor Cell Lines.
The HeLa cervical tumor cell line was obtained from the American Type Culture Collection (Manassas, VA), and the IC1 cervical carcinoma cell line was provided by Dr J. Couturier (Institut Curie, Paris, France; Ref. 25 ). The human melanoma cell lines WM793, 1341D, MZ2, and HT144 have been described previously (26) . These cell lines were grown in RPMI 1640 (Biowhittaker, Walkersville, MD) supplemented with 10% FCS, 100 units/ml penicillin-streptomycin, 5% sodium pyruvate, and 0.01% mercaptoethanol (all from Sigma Chemical Co., St. Louis, MO).

Transfection of HeLa and IC1 Cells.
A cDNA encoding hIL-17 was inserted into an expression vector under the control of the SR{alpha} promoter in pBR322 into which a neomycin resistance gene was introduced (NT-Neo; Ref. 27 ). NT-Neo containing or lacking the 640-bp IL-17 cDNA was linearized with ScaI restriction enzyme and stably transfected by electroporation into HeLa and IC1 cells. Electroporation was performed with a Bio-Rad Gene Pulser at a voltage of 260 V with a capacitance of 960 µF. At 72 h after electroporation, transfectants were selected by culture in RPMI 1640 (Life Technologies, Inc.) supplemented with 1 mg/ml G418 (Geneticin; Life Technologies, Inc., Paisley, United Kingdom). G418-resistant clones were expanded in selection medium and tested for IL-17 expression.

Recombinant Proteins and Antibodies.
rhIL-17 was purified from the supernatant of IL-17-transfected NSO cells, as described previously (2)

Neutralizing anti-IL-17 mAb 5 as well as anti-IL-17 mAbs 16 and 25 were produced in ascites and purified by anion-exchange chromatography (2) .

Assays.
hIL-6 and hIL-8 were assayed using ELISA kits purchased from Immunotech (Marseille, France) and Medgenix (Brussels, Belgium), respectively.

An ELISA was used to measure hIL-17 concentrations in culture supernatants. Briefly, 96 break-away, flat-bottomed-well (Nunc) microtiter plates were coated with 50 µl of anti-IL-17 mAb 25 (10 µg/ml) diluted in carbonate buffer [0.1 M Na2CO3/NaHCO3 (pH 9.6)] overnight at 4°C. The plate was then saturated with 200 µl of PBS-1% BSA for 1 h at room temperature. After washes with PBS-0.05% Tween 20 (Merck, Schuchardt, Germany), 50 µl of rhIL-17 or samples diluted in PBS-1% BSA were added and incubated for 3 h at 37°C. After washes, the plates were incubated with 50 µl of peroxidase-labeled anti-IL-17 mAb 16 (5 µg/ml) diluted in PBS-1% BSA for 2 h at 37°C. The reaction was revealed by the addition of the peroxidase substrate (o-phenylenediaminedihydrochloride), and the optical density was read at a wavelength of 492 nm. The lowest concentration of hIL-17 detected was 0.05 ng/ml.

RT-PCR Amplification.
RT-PCR was performed as described previously (28) . The following oligonucleotide primers were used: (a) human ß-actin sense, TCGTCGACAACGGCTCCGGCATGTGC; (b) human ß-actin antisense, TTCTGCAGGGAGGAGCTGGAAGCAGC; (c) hIL-6 sense, ACGAATTCACAAACAAATTCGGTACA; (d) hIL-6 antisense, CATCTAGATTCTTTGCCTTTTTCTGC; (e) hIL-8 sense, TTCTGCAGCTCTGTGTGA-AGG; (f) hIL-8 antisense, GAAGAGGGCTGAGAATTCAT; (g) hIL-17 sense, ACTCCTGGGAAGACCTCATTG; (h) hIL-17 antisense, GGCCACATGGTGGACAATCG; (i) human CD4 sense, GGAGTCCCTTTTAGGC-ACTTGC; (j) human CD4 antisense, GAACTCCACCTGTTCCCCCTC; (k) human CD8 sense, CTCCTCCTGGCCGCGCAGCTG; (l) human CD8 antisense, GCCGGGCTCTCCTCCGCCG; (m) murine IL-6 sense, TGGAGTCACAGAAGGAGTGGCTAAG; (n) murine IL-6 antisense, TCTGACCACAGTGAGGAATGTCCAC; (o) murine hypoxanthine phosphoribosyltransferase sense, GTTGGATACAGGCCAGACTTTGTTG; and (p) murine hypoxanthine phosphoribosyltransferase antisense, GATTCAACTTGCGCTCATCTTAGGC.

In Vitro Growth Assay.
Cells were plated into flat-bottomed 96-well plates at a density of 104 cells/well. The cells were cultured for 3 days, and their proliferation was determined by a MTT assay (29) . Briefly, 20 µl of MTT (Sigma) at a concentration of 5 mg/ml were added to each well and incubated for 4 h in the dark. The formazan grain was then dissolved in DMSO, and the absorbance at 570 nm was read using an ELISA plate reader. A standard curve between the absorbance of the MTT test and the number of cells was determined for each cell line. The conversion of MTT to formazan was directly correlated with the number of viable cells.

Tumor Growth in Nude Mice.
Male 8-week-old athymic nu/nu mice (Iffa Credo, L’Arbresle, France) were used for the experiments described here. Human cervical tumors were injected into mice by subdermal inoculation of 106 cells. A total of 8–10 mice/group were used per experiment. Tumor volume (in mm3) was estimated from the length (a) and width (b) of the tumor by using the following formula: volume = ab2/2. Biopsies were snap-frozen in liquid nitrogen and stored at -70°C for RNA extraction.

Immunocytochemistry.
Cryostat sections (5 µM) of tumor xenografts were fixed in acetone at 4°C for 5 min. After washes in TBS, they were incubated with biotinylated rat mAb against Mac1 (M1/70 hybridoma) or with isotype-matched control biotinylated rat mAb (PharMingen, San Diego, CA). After washes in TBS, slides were incubated with alkaline phosphatase-conjugated streptavidin (DAKO, Trappes, France), and enzymatic activity was revealed with Fast Red reagent (DAKO) associated with 1 mM of levamisole, a known inhibitor of endogenous alkaline phosphatase. Sections were counterstained with Mayer’s Hematoxylin.

Statistical Analysis.
The in vivo comparison of tumor size between the various groups of mice was analyzed by the Mann-Whitney test.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Analysis of IL-6 and IL-8 Production by Tumor Cell Lines Stimulated with rhIL-17.
rhIL-17 significantly increased IL-6 secretion by the two human cervical cell lines, HeLa and IC1 (Fig. 1)Citation . This action was not restricted to tumor cell lines derived from cervical carcinoma because two of four melanoma cell lines were also sensitive to rIL-17. To control this result, we showed that the addition of anti-IL-17 mAb inhibited up-regulation of IL-6 production by IL-17 (Fig. 1)Citation , whereas an isotype control-matched antibody has no effect (data not shown). Tumor cells did not constitutively secrete significant levels of IL-17, and anti-IL-17 antibody alone had no effect on IL-6 secretion (data not shown). Only cell lines that already produced basal levels of IL-6 appeared to respond to IL-17 (Fig. 1)Citation . An increased production of IL-8 was also demonstrated after treatment of the HeLa (Fig. 2A)Citation , IC1, WM793, and HT144 cell lines with rIL-17. In contrast, cell lines resistant to rIL-17-induced IL-6 production (MZ2 and 1341D) did not secrete IL-8 after IL-17 treatment (data not shown). The activity of rIL-17 was observed at a dose range between 0.2 and 2 ng/ml (Fig. 2A)Citation . We did not observe any effect of IL-17 on granulocyte colony-stimulating factor production (data not shown), which has been shown to be regulated by IL-17 in other cell types (2 , 30) .



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Effect of hIL-17 on the secretion of IL-6 by different tumor cell lines. A total of 106 human cervical carcinoma cells (HeLa or IC1) or melanoma cells (WM793, HT144, MZ2, or 1341D) were added per well in a 24-well plate and stimulated with rhIL-17 (100 ng/ml; {blacksquare}), a mixture of hIL-17 (100 ng/ml) preincubated for 30 min at 37°C with 1 µg/ml neutralizing anti-hIL-17 mAb 5 (), or culture medium alone (). After 24 h, culture supernatants were harvested and tested for IL-6 concentrations using a commercially available ELISA. Results represent the mean ± SD of triplicate determinations from one representative experiment.

 


View larger version (26K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, increased production of IL-6 and IL-8 after in vitro treatment of HeLa cells with hIL-17. The human cervical carcinoma cell line HeLa was plated at 106 cells/ml and cultured with various concentrations of purified hIL-17. After 24 h, the levels of IL-6 ({square}) and IL-8 ({diamondsuit}) in the supernatants were measured by ELISA. B, induction of IL-6 and IL-8 mRNA after 6 h of hIL-17 stimulation of HeLa cells. cDNA derived from mRNA extracted from HeLa cells cultured for 6 h with medium alone or hIL-17 (10 and 100 ng/ml) was amplified by PCR using primers specific for ß-actin, IL-6, and IL-8 mRNA. Amplified PCR products were then loaded onto a 2% agarose gel and stained with ethidium bromide for UV visualization.

 
To more thoroughly analyze the mechanisms of action of IL-17, IL-6, and IL-8, mRNA expression was assessed by RT-PCR in rIL-17-treated and untreated cervical carcinoma cells. A clear up-regulation of IL-6 and IL-8 mRNA was observed 6 h after in vitro stimulation of HeLa cells with rIL-17 (Fig. 2B)Citation . IL-17 therefore seemed to regulate IL-6 and IL-8 either at the transcriptional level or by increasing the mRNA half-life.

Characterization of IL-17-transfected Human Cervical Carcinoma Cell Lines.
To further analyze the role of IL-17 on human cervical carcinoma cell lines, we transfected two tumor cell lines (HeLa and IC1) with a cDNA encoding hIL-17. Stable transfectants were obtained that secreted significant amounts of IL-17 in their supernatant (from 4–10 ng/ml for 5 x 105 cells over 24 h; Fig. 3ACitation ). No expression of either IL-17 mRNA or protein could be detected in any of the tumor cell lines analyzed before transfection (Fig. 3ACitation ; data not shown). Interestingly, IL-17-transfected cell lines produced more IL-6 than the parent cervical carcinoma cell lines or cells transfected with the vector alone (Fig. 3A)Citation , which confirms the results obtained with rIL-17. No clear increase in IL-8 secretion was observed in these IL-17 transfectants, which could be explained by the weaker effect of IL-17 on the regulation of IL-8 than IL-6 in these cells (Fig. 2A)Citation .



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A, characterization of IL-17-transfected human cervical tumor cell lines. Wild-type (WT) or human cervical carcinoma cells (HeLa and IC1) transfected with NT plasmid alone (Neo) or cDNA encoding hIL-17 were plated in 24-well flat-bottomed plates at a density of 106 cells/well. The cells were cultured for 24 h, and the IL-6 () or IL-17 ({blacksquare}) levels were determined by ELISA. B, in vitro proliferation of parental and mock-transfected or IL-17-transfected human cervical tumor cell lines. Wild-type (WT) or human cervical carcinoma cells (HeLa and IC1) transfected with NT plasmid alone (Neo) or cDNA encoding hIL-17 were plated in 96-well flat-bottomed plates at a density of 104 cells/well. The cells were cultured for 3 days, and their proliferation was determined by a MTT assay. For these experiments, all cells were cultured in the same medium without G418/neomycin. For each cell line, a standard curve between the absorbance of the MTT test and the number of cells was determined. Values are the mean ± SD (bars) of triplicate cultures and are representative of two experiments.

 
We then investigated the growth rate of the various clones. Fig. 3BCitation shows a typical experiment, in which IL-17-expressing and parent cells (HeLa and IC1) showed identical in vitro growth. Similarly, exogenous recombinant IL-17 did not influence the proliferation of human cervical cell lines (data not shown).

Tumor Growth of Human Cervical Carcinoma Cells and Their IL-17 Transfectants in Nude Mice.
In contrast to the absence of any significant effect of IL-17 on the in vitro growth of cervical carcinoma cell lines, the two cervical carcinoma cell lines (HeLa and IC1) transfected with hIL-17 cDNA and then transplanted in nude mice grew faster than mock-transfected cells (Fig. 4, A and B)Citation . For example, at day 31 after transplantation, a mean tumor volume of 26 mm3 was measured in transplanted parental HeLa cells, whereas the tumor volume of the IL-17-transfected HeLa cell line reached 404 mm3 (P = 0.0003). IL-17 did not affect the tumor incidence rate (Fig. 4C)Citation , and its effect seemed more pronounced after an initial growth period in nude mice. Therefore, IL-17 did not play a role in the initial stage of tumor development but rather enhanced its progression.



View larger version (14K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Tumor growth in nude mice of mock- or IL-17-transfected human cervical carcinoma cell lines. The mock-transfected (Neo) or IL-17-transfected human cervical cell line HeLa (A) or IC1 (B) was injected into mice by subdermal inoculation of 106 cells. A total of 8–10 mice/group were used per experiment, and tumor size was assessed as described in "Materials and Methods." Results are representative of two independent experiments. C, tumor incidence between mock- and IL-17-transfected tumors. *, statistically significant results (P < 0.05).

 
Analysis of the Expression and Activity of the hIL-17 Transgene in Nude Mice.
To determine the in vivo persistence of the IL-17 transgene in tumors transfected with IL-17 cDNA and transplanted in nude mice, biopsies were performed at day 56 after transplantation. hIL-17 cDNA was detected in four of four biopsies derived from mice transplanted with HeLa-IL-17 cells but not in mice previously injected with the control transfectant (HeLa-Neo; Fig. 5ACitation ), indicating that the transgene was not lost during tumor development.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. hIL-17 and murine IL-6 mRNA expression in biopsies derived from mock- or IL-17-transfected HeLa cells transplanted in nude mice. cDNA derived from mRNA extracted from mock-transfected (HeLa-Neo) or IL-17-transfected (HeLa-IL-17) cells was amplified by PCR using primers specific for hIL-17 (A), murine IL-6 (B), and murine HGPRT mRNA (C). Amplified PCR products were loaded onto a 2% agarose gel and stained with ethidium bromide for UV visualization.

 
Because various studies have reported that hIL-17 is biologically active in murine cells (31) , we analyzed the in situ expression of genes normally regulated by IL-17, such as IL-6. Increased expression of murine IL-6 mRNA was demonstrated in biopsies excised from HeLa-IL-17 cells. (Fig. 5B)Citation . Murine IL-6 primers used for this study did not cross-react with hIL-6 (data not shown). The same analysis could not be performed for hIL-6 mRNA because the primers used could also amplify murine IL-6 mRNA. The murine counterpart of hIL-8 has not yet been isolated; therefore, its expression was not investigated.

Immunohistochemical analysis of HeLa-IL-17 tumors with anti-Mac1 antibodies revealed marked infiltration by murine macrophages, whereas mock-transfected HeLa tumors did not seem to recruit cells from the monocyte-macrophage lineage (Fig. 6)Citation . This selective peri and intratumoral macrophage recruitment was also detected in IC1-IL-17 tumors using other antibodies (anti-Mac3) recognizing antigenic determinants on macrophages (data not shown). The intratumoral infiltration of other immune cells such as B cells and neutrophils did not seem to differ in tumor xenografts derived from mock-transfected or IL-17-transfected HeLa cells (data not shown).



View larger version (103K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Macrophage recruitment in biopsies derived from mock- or IL-17-transfected HeLa cells transplanted into nude mice. Cryostat section of biopsies derived from IL-17-transfected (A and B) or mock-transfected HeLa cervical carcinoma (C) transplanted into nude mice were fixed in acetone and incubated with biotinylated rat anti-Mac1 (A and C) or isotype-matched control biotinylated rat mAb. After washes in TBS, slides were incubated with alkaline phosphatase-conjugated streptavidin, and enzymatic activity was revealed with the Fast Red reagent. Sections were counterstained with Mayer’s Hematoxylin.

 
hIL-17 mRNA Expression in Biopsies Derived from Invasive Cervical Carcinomas.
The possible involvement of IL-17 in the progression of human cervical tumors prompted us to determine whether it is expressed in tumor biopsies from cervical carcinoma patients. We showed a significant expression of IL-17 in four of six samples tested (Fig. 7)Citation . It is noteworthy that no IL-17 mRNA expression could be observed in tumors infiltrated only by CD8 T cells (Fig. 7)Citation . Equivalent ß-actin mRNA in the various samples assessed by RT-PCR excluded a bias in the interpretation of these results due to a variation of the total mRNA levels (data not shown). In this short series, the presence of CD4-positive T cells seems to be associated with IL-17 mRNA expression, in line with previous studies indicating the activated memory CD4 origin of this cytokine (2) .



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. IL-17 mRNA expression in biopsies derived from invasive cervical carcinomas. Six cDNAs derived from mRNA extracted from six primary invasive cervical carcinomas were amplified by PCR using oligonucleotide primers specific for hIL-17, CD4, and CD8. Amplified PCR products were loaded onto a 2% agarose gel and stained with ethidium bromide for UV visualization.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study demonstrates that IL-17 increases the growth rate of human cervical tumors transplanted in nude mice. A direct effect of IL-17 on the in vivo proliferation of cervical cancer cells seems unlikely because wild-type and mock- or IL-17-transfected tumors exhibited the same in vitro proliferation kinetics (Fig. 3B)Citation . Therefore, an indirect mechanism involving a host-dependent growth-promoting effect may be hypothesized because the enhanced tumor growth elicited by IL-17 was associated in vivo with increased expression of IL-6 and macrophage recruitment at the tumor site (Figs. 5Citation and 6Citation ). In previous studies, macrophages were considered to be the main source of IL-6 produced in cervical carcinoma (24) . Induction of IL-6 by IL-17 may play a role in the activity of IL-17 because it has been shown previously that IL-6 stimulates the growth of cervical carcinoma-derived cell lines in medium deprived of growth factors (21 , 22) . However, in line with our experiments, various groups have also reported that IL-6 did not exhibit any in vitro effect on tumor cell proliferation, despite a significant change in the in vivo tumorigenicity of IL-6-transfected tumor cells (32 , 33) . Recently, in a model of human melanoma transplanted in nude mice, Lu et al. (34) demonstrated that IL-6 could indeed function as an in vivo paracrine growth-stimulating factor for advanced-stage human melanoma cells.

A tumor-promoting activity of macrophages acting on the formation of tumor stroma has also been described. For example, tumor growth was markedly impaired in the op/op mouse, which possesses a profound macrophage deficiency compared with normal littermates. Treatment of tumor-bearing op/op mice with recombinant colony-stimulating factor 1 corrected this impairment (35) . Moreover, in nude mice, the reduced tumorigenicity of IL-10-transfected Chinese hamster ovary cells compared to parent cells was found to be associated with inhibition of macrophage recruitment at the tumor site (36) . The mechanisms that may explain the selective tumor homing of macrophages in IL-17-producing cervical carcinoma remain to be elucidated. It has been shown that IL-17 induces MCP-1, a known selective macrophage chemoattractant, in epithelial cells (37) . However, we found no difference in the expression of JE and MCP-5 mRNA, the murine counterpart of MCP-1, in biopsies derived from mock- or IL-17-transfected cervical carcinoma cell lines transplanted in nude mice. In addition, IL-17 did not induce human MCP-1 in human cervical cell lines (data not shown).

Although it has been shown that IL-17 stimulated granulopoiesis and elicited a rise in peripheral neutrophil counts after s.c. administration (2 , 38) , we could not demonstrate any significant neutrophil infiltrate in established cervical tumor xenografts.

Of course, only neutralization of macrophages and/or IL-6 activity in vivo would constitute direct evidence of the role of these factors as mediators of IL-17 activity on tumor enhancement. Unfortunately, in three independent experiments, the unexpected inhibitory effects of control immunoglobulins administered to tumor-bearing nude mice prevented us from drawing any definitive conclusions about the role of anti-IL-6 or anti-Mac1 antibodies in this model.

Because IL-17 is secreted mainly by CD4-positive T cells in man [Ref. 2 ; its source in mice has not been thoroughly investigated (3 , 31) ], it may seem paradoxical that immune cells secrete tumor-promoting factors. However, other studies have also reported that T lymphocytes could secrete basic fibroblast growth factor or vascular endothelial growth factor, which stimulate tumor angiogenesis (39 , 40) , or heparin binding epidermal growth factor, which is considered to be a tumor survival factor (40 , 41) .

In mice, although CD4 and CD8 T cells were often both required for induction of immune control on tumor growth (42, 43, 44) , various models have clearly implicated the CD4 T-cell population as cells that may enhance tumor development (45) . A spontaneously arising B-cell lymphoma in SJL/J mice has been shown to depend on host CD4 T cells for its proliferation and growth (46) . Treatment with anti-CD4 mAb before or after inoculation of a lethal dose of lymphoma cells inhibited tumor growth and allowed mice to survive (47 , 48) . Various immunotherapy protocols in mice, including systemic administration of IL-2 or IL-12, were greatly improved after elimination of CD4 T cells (49, 50, 51) . Similarly, depletion of CD4 T cells increased the efficiency of T-cell-mediated immunity after peptide vaccination in a model of established micrometastases from lung carcinoma (52) .

In man, several tumors seem to be sensitive to the enhancing effects of CD4 T cells. Nakamura et al. (53) characterized Kaposi’s sarcoma cell lines that were dependent on growth factors released by CD4 T cells. Umetsu et al. (54) also identified a group of follicular B-cell lymphomas highly infiltrated with CD4 T cells that play an essential role in sustaining rather than inhibiting tumor cell growth in vivo. These examples may explain some reports in which a high number of tumor-infiltrating lymphocytes in certain cancers is considered to be a poor prognostic marker (55) .

Finally the expression of IL-17 in biopsies derived from cervical cancer patients (Fig. 7)Citation , together with the fact that the amount of IL-17 secreted by activated human T cells (2) was in the same range as that produced by the stably transfected cervical carcinoma cell lines, suggests that our findings may have some clinical relevance.

Future studies will be designed to assess the clinical prognostic value of this factor.


    ACKNOWLEDGMENTS
 
We thank John Abrams (DNAX) for providing us with some antibodies against IL-17.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from Comité de Paris de la Ligue Nationale de Lutte contre le Cancer (France) and the Indo-French Center for the Promotion of Advanced Research and by the Institut Curie and the Institut National de la Santé et de la Recherche Médicale. Back

2 To whom requests for reprints should be addressed, at Unité d’Immunologie Clinique, Institut Curie, 26 Rue d’Ulm, 75248 Paris, Cedex 05, France. Phone: 33-1-44-32-42-18. Fax: 33-1-40-51-04-20; E-mail: etartour{at}curie.fr Back

3 The abbreviations used are: IL, interleukin; rhIL, recombinant human IL; HPV, human papillomavirus; hIL, human IL; mAb, monoclonal antibody; RT-PCR, reverse transcription-PCR; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; TBS, Tris-buffered saline; MCP-1, monocyte chemoattractant protein 1. Back

Received 2/18/99. Accepted 6/ 3/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rouvier E., Luciani M. F., Mattei M. G., Denizot F., Golstein P. CTLA-8, cloned from an activated T cell, bearing AU-rich messenger RNA instability sequences, and homologous to a herpesvirus saimiri gene. J. Immunol., 150: 5445-5556, 1993.[Abstract]
  2. Fossiez F., Djossou O., Chomarat P., Flores-Romo L., Ait-Yahia S., Maat C., Pin J. J., Garrone P., Garcia E., Saeland S., Blanchard D., Gaillard C., Das Mahapatra B., Rouvier E., Golstein P., Banchereau J., Lebecque S. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J. Exp. Med., 183: 2593-2603, 1996.[Abstract/Free Full Text]
  3. Spriggs M. K. Interleukin-17 and its receptor. J. Clin. Immunol., 17: 366-369, 1997.[Medline]
  4. Fleckenstein B., Desrosiers R. C. Herpesvirus saimiri and Herpesvirus ateles Roizman I. B. eds. . The Herpesviruses, : 253-332, Plenum Publishing Press New York 1992.
  5. Mittrucker H. W., Muller-Fleckenstein I., Fleckenstein B., Fleischer B. CD2-mediated autocrine growth of Herpesvirus saimiri-transformed human T lymphocytes. J. Exp. Med., 176: 909-913, 1992.[Abstract/Free Full Text]
  6. Biesinger B., Muller-Fleckenstein I., Simmer B., Lang G., Wittmann S., Platzer E., Desrosiers R. C., Fleckenstein B. Stable growth transformation of human T lymphocytes by Herpesvirus saimiri. Proc. Natl. Acad. Sci. USA, 89: 3116-3119, 1992.[Abstract/Free Full Text]
  7. Yao Z., Fanslow W. C., Seldin M. F., Rousseau A. M., Painter S. L., Comeau M. R., Cohen J. I., Spriggs M. K. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity, 3: 811-821, 1995.[Medline]
  8. Jovanovic D. V., Di Battista J. A., Martel-Pelletier J., Jolicoeur F. C., He Y., Mineau F., Pelletier J. P. IL-17 stimulates the production and expression of proinflammatory cytokines, IL1-ß and TNF-{alpha}, by human macrophages. J. Immunol., 160: 3513-3521, 1998.[Abstract/Free Full Text]
  9. Teunissen M. B., Koomen C. W., de Waal Malefyt R., Wierenga E. A., Bos J. D. Interleukin-17 and interferon-{gamma} synergize in the enhancement of proinflammatory cytokine production by human keratinocytes. J. Investig. Dermatol., 111: 645-649, 1998.[Medline]
  10. Chabaud M., Fossiez F., Taupin J. L., Miossec P. Enhancing effect of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. J. Immunol., 161: 409-414, 1998.[Abstract/Free Full Text]
  11. Shalom-Barak T., Quach J., Lotz M. Interleukin-17-induced gene expression in articular chondrocytes is associated with activation of mitogen-activated protein kinases and NF-{kappa}B. J. Biol. Chem., 273: 27467-27473, 1998.[Abstract/Free Full Text]
  12. Attur M. G., Patel R. N., Abramson S. B., Amin A. R. Interleukin-17 up-regulation of nitric oxide production in human osteoarthritis cartilage. Arthritis Rheum., 40: 1050-1053, 1997.[Medline]
  13. Fridman W. H., Tartour E. Cytokines and cell regulation. Molecular Aspects of Medicine, 3-90, Elsevier Science Oxford, United Kingdom 1997.
  14. Vink A., Coulie P., Warnier G., Renauld J. C., Stevens M., Donckers D., Van Snick J. Mouse plasmacytoma growth in vivo: enhancement by interleukin 6 (IL-6) and inhibition by antibodies directed against IL-6 or its receptor. J. Exp. Med., 172: 997-1000, 1990.[Abstract/Free Full Text]
  15. Scala G., Quinto I., Ruocco M. R., Arcucci A., Mallardo M., Caretto P., Forni G., Venuta S. Expression of an exogenous interleukin 6 gene in human Epstein Barr virus B cells confers growth advantage and in vivo tumorigenicity. J. Exp. Med., 172: 61-68, 1990.[Abstract/Free Full Text]
  16. Durandy A., Emilie D., Peuchmaur M., Forveille M., Clement C., Wijdenes J., Fischer A. Role of IL-6 in promoting growth of human EBV-induced B-cell tumors in severe combined immunodeficient mice. J. Immunol., 152: 5361-5367, 1994.[Abstract]
  17. Bataille R., Barlogie B., Lu Z. Y., Rossi J. F., Lavabre-Bertrand T., Beck T., Wijdenes J., Brochier J., Klein B. Biologic effects of anti-interleukin-6 murine monoclonal antibody in advanced multiple myeloma. Blood, 86: 685-691, 1995.[Abstract/Free Full Text]
  18. Schadendorf D., Moller A., Algermissen B., Worm M., Sticherling M., Czarnetzki B. M. IL-8 produced by human malignant melanoma cells in vitro is an essential autocrine growth factor. J. Immunol., 151: 2667-2675, 1993.[Abstract]
  19. Singh R. K., Gutman M., Radinsky R., Bucana C. D., Fidler I. J. Expression of interleukin 8 correlates with the metastatic potential of human melanoma cells in nude mice. Cancer Res., 54: 3242-3247, 1994.[Abstract/Free Full Text]
  20. Schiffmank M. H., Brinton L. A. The epidemiology of cervical carcinogenesis. Cancer (Phila.), 76 (Suppl. 10): 1888-1901, 1995.[Medline]
  21. Iglesias M., Plowman G. D., Woodworth C. D. Interleukin-6 and interleukin-6 soluble receptor regulate proliferation of normal, human papillomavirus-immortalized, and carcinoma-derived cervical cells in vitro. Am. J. Pathol., 146: 944-952, 1995.[Abstract]
  22. Eustace D., Han X., Gooding R., Rowbottom A., Riches P., Heyderman E. Interleukin-6 (IL-6) functions as an autocrine growth factor in cervical carcinomas in vitro. Gynecol. Oncol., 50: 15-19, 1993.[Medline]
  23. Woodworth C. D., Simpson S. Comparative lymphokine secretion by cultured normal human cervical keratinocytes, papillomavirus-immortalized, and carcinoma cell lines. Am. J. Pathol., 142: 1544-1555, 1993.[Abstract]
  24. Tartour E., Gey A., Sastre-Garau X., Pannetier C., Mosseri V., Kourilsky P., Fridman W. H. Analysis of interleukin 6 gene expression in cervical neoplasia using a quantitative polymerase chain reaction assay: evidence for enhanced interleukin 6 gene expression in invasive carcinoma. Cancer Res., 54: 6243-6248, 1994.[Abstract/Free Full Text]
  25. Couturier J., Sastre-Garau X., Schneider-Maunoury S., Labib A., Orth G. Integration of papillomavirus DNA near myc genes in genital carcinomas and its consequences for proto-oncogene expression. J. Virol., 65: 4534-4538, 1991.[Abstract/Free Full Text]
  26. Montero F., Brailly H., Sautèes C., Joyeux I., Dorval T., Mosseri V., Yasukawa K., Wijdenes J., Adler A., Gorin I., Fridman W. H., Tartour E. Characterization of soluble gp130 released by melanoma cell lines: a polyvalent antagonist of cytokines from IL6 family. Clin. Cancer Res., 3: 1443-1451, 1997.[Abstract]
  27. Daeron M., Latour S., Malbec O., Espinosa E., Pina P., Pasmans S., Fridman W. H. The same tyrosine-based inhibition motif, in the intracytoplasmic domain of Fc {gamma} RIIB, regulates negatively BCR-, TCR-, and FcR-dependent cell activation. Immunity, 3: 635-646, 1995.[Medline]
  28. Tartour E., Gey A., Sastre-Garau X., Lombard Surin I., Mosseri V., Fridman W. H. Prognostic value of intratumoral interferon {gamma} messenger RNA expression in invasive cervical carcinoma. J. Natl. Cancer Inst., 4: 287-294, 1998.
  29. Hansen M. B., Nielsen S. E., Berg K. Re-examination and further development of a precise and rapid dye method for measuring cell growth/cell kill. J. Immunol. Methods, 119: 203-210, 1989.[Medline]
  30. Cai X. Y., Gommoll C. P., Jr., Justice L., Narula S. K., Fine J. S. Regulation of granulocyte colony-stimulating factor gene expression by interleukin-17. Immunol. Lett., 62: 51-58, 1998.[Medline]
  31. Kennedy J., Rossi D. L., Zurawski S. M., Vega F., Jr., Kastelein R. A., Wagner J. L., Hannum C. H., Zlotnik A. Mouse IL-17: a cytokine preferentially expressed by {alpha} ß TCR + CD4-CD8-T cells. J. Interferon Cytokine Res., 16: 611-617, 1996.[Medline]
  32. Sun W. H., Kreisle R. A., Phillips A. W., Ershler W. B. In vivo and in vitro characteristics of interleukin 6-transfected B16 melanoma cells. Cancer Res., 52: 5412-5415, 1992.[Abstract/Free Full Text]
  33. Mullen C. A., Coale M. M., Levy A. T., Stetler-Stevenson W. G., Liotta L. A., Brandt S., Blaese R. M. Fibrosarcoma cells transduced with the IL-6 gene exhibited reduced tumorigenicity, increased immunogenicity, and decreased metastatic potential. Cancer Res., 52: 6020-6024, 1992.[Abstract/Free Full Text]
  34. Lu C., Sheehan C., Rak J. W., Chambers C. A., Hozumi N., Kerbel R. S. Endogenous interleukin 6 can function as an in vivo growth-stimulatory factor for advanced-stage human melanoma cells. Clin. Cancer Res., 2: 1417-1425, 1996.[Abstract]
  35. Nowicki A., Szenajch J., Ostrowska G., Wojtowicz A., Wojtowicz K., Kruszewski A. A., Maruszynski M., Aukerman S. L., Wiktor-Jedrzejczak W. Impaired tumor growth in colony-stimulating factor 1 (CSF-1)-deficient, macrophage-deficient op/op mouse: evidence for a role of CSF-1-dependent macrophages in formation of tumor stroma. Int. J. Cancer, 65: 112-119, 1996.[Medline]
  36. Richter G., Kruger-Krasagakes S., Hein G., Huls C., Schmitt E., Diamantstein T., Blankenstein T. Interleukin 10 transfected into Chinese hamster ovary cells prevents tumor growth and macrophage infiltration. Cancer Res., 53: 4134-4137, 1993.[Abstract/Free Full Text]
  37. Van Kooten C., Boonstra J. G., Paape M. E., Fossiez F., Banchereau J., Lebecque S., Bruijn J. A., De Fijter J. W., Van Es L. A., Daha M. R. Interleukin-17 activates human renal epithelial cells in vitro and is expressed during renal allograft rejection. J. Am. Soc. Nephrol., 9: 1526-1534, 1998.[Abstract]
  38. Schwarzenberger P., La Russa V., Miller A., Ye P., Huang W., Zieske A., Nelson S., Bagby G. J., Stoltz D., Mynatt R. L., Spriggs M., Kolls J. K. IL-17 stimulates granulopoiesis in mice: use of an alternate, novel gene therapy-derived method for in vivo evaluation of cytokines. J. Immunol., 161: 6383-6389, 1998.[Abstract/Free Full Text]
  39. Freeman M. R., Schneck F. X., Gagnon M. L., Corless C., Soker S., Niknejad K., Peoples G. E., Klagsbrun M. Peripheral blood T lymphocytes and lymphocytes infiltrating human cancers express vascular endothelial growth factor: a potential role for T cells in angiogenesis. Cancer Res., 55: 4140-4145, 1995.[Abstract/Free Full Text]
  40. Blotnick S., Peoples G. E., Freeman M. R., Eberlein T. J., Klagsbrun M. T. T lymphocytes synthesize and export heparin-binding epidermal growth factor-like growth factor and basic fibroblast growth factor, mitogens for vascular cells and fibroblasts: differential production and release by CD4+ and CD8+ T cells. Proc. Natl. Acad. Sci. USA, 91: 2890-2894, 1994.[Abstract/Free Full Text]
  41. Miyoshi E., Higashiyama S., Nakagawa T., Hayashi N., Taniguchi N. Membrane-anchored heparin-binding epidermal growth factor-like growth factor acts as a tumor survival factor in a hepatoma cell line. J. Biol. Chem., 272: 14349-14355, 1997.[Abstract/Free Full Text]
  42. Kaido T. J., Maury C., Gresser I. Host CD4+ T lymphocytes are required for the synergistic action of interferon-{alpha}/ß and adoptively transferred immune cells in the inhibition of visceral ESb metastases. Cancer Res., 55: 6133-6139, 1995.[Abstract/Free Full Text]
  43. Hock H., Dorsch M., Diamantstein T., Blankenstein T. Interleukin 7 induces CD4+ T cell-dependent tumor rejection. J. Exp. Med., 174: 1291-1298, 1991.[Abstract/Free Full Text]
  44. Flamand V., Biernaux C., Van Mechelen M., Sornasse T., Urbain J., Leo O., Moser M. Immune surveillance: both CD3+ CD4+ and CD3+ CD8+ T cells control in vivo growth of P815 mastocytoma. Int. J. Cancer, 45: 757-762, 1990.[Medline]
  45. North R. J. Down-regulation of the antitumor immune response. Adv. Cancer Res., 45: 1-43, 1985.[Medline]
  46. Katz I. R., Chapman-Alexander J., Jacobson E. B., Lerman S. P., Thorbecke G. J. Growth of SJL/J-derived transplantable reticulum cell sarcoma as related to its ability to induce T-cell proliferation in the host. III. Studies on thymectomized and congenitally athymic SJL mice. Cell. Immunol., 65: 84-92, 1981.[Medline]
  47. Ohnishi K., Bonavida B. Regulation of Ia+ reticulum cell sarcoma (RCS) growth in syngeneic SJL/J mice. I. Inhibition of tumor growth by passive administration of L3T4 monoclonal antibody before or after tumor inoculation. J. Immunol., 138: 4524-4529, 1987.[Abstract]
  48. Ohnishi K., Bonavida B. Regulation of B-cell lymphoma growth in syngeneic SJL/J mice. Establishment of tumor dormancy following administration of anti-CD4 monoclonal antibody into tumor-bearing mice. Leukemia (Baltimore), 7: 1801-1806, 1993.[Medline]
  49. Rakhmilevich A. L., North R. J. Elimination of CD4+ T cells in mice bearing an advanced sarcoma augments the antitumor action of interleukin-2. Cancer Immunol. Immunother., 38: 107-112, 1994.[Medline]
  50. Colombo M. P., Vagliani M., Spreafico F., Parenza M., Chiodoni C., Melani C., Stoppacciaro A. Amount of interleukin 12 available at the tumor site is critical for tumor regression. Cancer Res., 56: 2531-2534, 1996.[Abstract/Free Full Text]
  51. Martinotti A., Stoppacciaro A., Vagliani M., Melani C., Spreafico F., Wysocka M., Parmiani G., Trinchieri G., Colombo M. P. CD4 T cells inhibit in vivo the CD8-mediated immune response against murine colon carcinoma cells transduced with interleukin-12 genes. Eur. J. Immunol., 25: 137-146, 1995.[Medline]
  52. Mandelboim O., Vadai E., Fridkin M., Katz-Hillel A., Feldman M., Berke G., Eisenbach L. Regression of established murine carcinoma metastases following vaccination with tumour-associated antigen peptides. Nat. Med., 1: 1179-1183, 1995.[Medline]
  53. Nakamura S., Salahuddin S. Z., Biberfeld P., Ensoli B., Markham P. D., Wong-Staal F., Gallo R. C. Kaposi’s sarcoma cells: long-term culture with growth factor from retrovirus-infected CD4+ T cells. Science (Washington DC), 242: 426-430, 1988.[Abstract/Free Full Text]
  54. Umetsu D. T., Esserman L., Donlon T. A., DeKruyff R. H., Levy R. Induction of proliferation of human follicular (B type) lymphoma cells by cognate interaction with CD4+ T cell clones. J. Immunol., 144: 2550-2557, 1990.[Abstract]
  55. Rosen P. R., Groshen S., Saigo P. E., Kinne D. W., Hellman S. A long-term follow-up study of survival in stage I (T1N0M0) and stage II (T1N1M0) breast carcinoma. J. Clin. Oncol., 7: 355-366, 1989.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
G. Murugaiyan and B. Saha
Protumor vs Antitumor Functions of IL-17
J. Immunol., October 1, 2009; 183(7): 4169 - 4175.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. J. Schetter, G. H. Nguyen, E. D. Bowman, E. A. Mathe, S. T. Yuen, J. E. Hawkes, C. M. Croce, S. Y. Leung, and C. C. Harris
Association of Inflammation-Related and microRNA Gene Expression with Cancer-Specific Mortality of Colon Adenocarcinoma
Clin. Cancer Res., September 15, 2009; 15(18): 5878 - 5887.
[Abstract] [Full Text] [PDF]


Home page
Evid Based Complement Alternat MedHome page
A. Vojdani and J. Lambert
The Role of Th17 in Neuroimmune Disorders: Target for CAM Therapy. Part I
Evid. Based Complement. Altern. Med., July 21, 2009; (2009) nep062v1.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Muranski, A. Boni, P. A. Antony, L. Cassard, K. R. Irvine, A. Kaiser, C. M. Paulos, D. C. Palmer, C. E. Touloukian, K. Ptak, et al.
Tumor-specific Th17-polarized cells eradicate large established melanoma
Blood, July 15, 2008; 112(2): 362 - 373.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S Le Gouvello, S Bastuji-Garin, N Aloulou, H Mansour, M-T Chaumette, F Berrehar, A Seikour, A Charachon, M Karoui, K Leroy, et al.
High prevalence of Foxp3 and IL17 in MMR-proficient colorectal carcinomas
Gut, June 1, 2008; 57(6): 772 - 779.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Badoual, G. Bouchaud, N. E. H. Agueznay, E. Mortier, S. Hans, A. Gey, F. Fernani, S. Peyrard, P. L. -Puig, P. Bruneval, et al.
The Soluble {alpha} Chain of Interleukin-15 Receptor: A Proinflammatory Molecule Associated with Tumor Progression in Head and Neck Cancer
Cancer Res., May 15, 2008; 68(10): 3907 - 3914.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Yusuf, T. H. Nasti, S. K. Katiyar, M. K. Jacobs, M. D. Seibert, A. C. Ginsburg, L. Timares, H. Xu, and C. A. Elmets
Antagonistic Roles of CD4+ and CD8+ T-Cells in 7,12-Dimethylbenz(a)anthracene Cutaneous Carcinogenesis
Cancer Res., May 15, 2008; 68(10): 3924 - 3930.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S.-J. Liu, J.-P. Tsai, C.-R. Shen, Y.-P. Sher, C.-L. Hsieh, Y.-C. Yeh, A.-H. Chou, S.-R. Chang, K.-N. Hsiao, F.-W. Yu, et al.
Induction of a distinct CD8 Tnc17 subset by transforming growth factor-{beta} and interleukin-6
J. Leukoc. Biol., August 1, 2007; 82(2): 354 - 360.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Lajoie-Kadoch, P. Joubert, S. Letuve, A. J. Halayko, J. G. Martin, A. Soussi-Gounni, and Q. Hamid
TNF-{alpha} and IFN-{gamma} inversely modulate expression of the IL-17E receptor in airway smooth muscle cells
Am J Physiol Lung Cell Mol Physiol, June 1, 2006; 290(6): L1238 - L1246.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. You, X.-B. Shi, G. DuRaine, D. Haudenschild, C. G. Tepper, S. Hao Lo, R. Gandour-Edwards, R. W. de Vere White, and A. H. Reddi
Interleukin-17 Receptor-Like Gene Is a Novel Antiapoptotic Gene Highly Expressed in Androgen-Independent Prostate Cancer
Cancer Res., January 1, 2006; 66(1): 175 - 183.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Numasaki, M. Watanabe, T. Suzuki, H. Takahashi, A. Nakamura, F. McAllister, T. Hishinuma, J. Goto, M. T. Lotze, J. K. Kolls, et al.
IL-17 Enhances the Net Angiogenic Activity and In Vivo Growth of Human Non-Small Cell Lung Cancer in SCID Mice through Promoting CXCR-2-Dependent Angiogenesis
J. Immunol., November 1, 2005; 175(9): 6177 - 6189.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Umemura, T. Kawabe, K. Shudo, H. Kidoya, M. Fukui, M. Asano, Y. Iwakura, G. Matsuzaki, R. Imamura, and T. Suda
Involvement of IL-17 in Fas ligand-induced inflammation
Int. Immunol., August 1, 2004; 16(8): 1099 - 1108.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. J. Ruddy, F. Shen, J. B. Smith, A. Sharma, and S. L. Gaffen
Interleukin-17 regulates expression of the CXC chemokine LIX/CXCL5 in osteoblasts: implications for inflammation and neutrophil recruitment
J. Leukoc. Biol., July 1, 2004; 76(1): 135 - 144.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Numasaki, J.-i. Fukushi, M. Ono, S. K. Narula, P. J. Zavodny, T. Kudo, P. D. Robbins, H. Tahara, and M. T. Lotze
Interleukin-17 promotes angiogenesis and tumor growth
Blood, April 1, 2003; 101(7): 2620 - 2627.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
P. W. Hellings, A. Kasran, Z. Liu, P. Vandekerckhove, A. Wuyts, L. Overbergh, C. Mathieu, and J. L. Ceuppens
Interleukin-17 Orchestrates the Granulocyte Influx into Airways after Allergen Inhalation in a Mouse Model of Allergic Asthma
Am. J. Respir. Cell Mol. Biol., January 1, 2003; 28(1): 42 - 50.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Starnes, H. E. Broxmeyer, M. J. Robertson, and R. Hromas
Cutting Edge: IL-17D, a Novel Member of the IL-17 Family, Stimulates Cytokine Production and Inhibits Hemopoiesis
J. Immunol., July 15, 2002; 169(2): 642 - 646.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
F. Benchetrit, A. Ciree, V. Vives, G. Warnier, A. Gey, C. Sautes-Fridman, F. Fossiez, N. Haicheur, W. H. Fridman, and E. Tartour
Interleukin-17 inhibits tumor cell growth by means of a T-cell-dependent mechanism
Blood, March 15, 2002; 99(6): 2114 - 2121.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Aggarwal and A. L. Gurney
IL-17: prototype member of an emerging cytokine family
J. Leukoc. Biol., January 1, 2002; 71(1): 1 - 8.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
H. z. Hausen
Papillomaviruses Causing Cancer: Evasion From Host-Cell Control in Early Events in Carcinogenesis
J Natl Cancer Inst, May 3, 2000; 92(9): 690 - 698.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Lee, W.-H. Ho, M. Maruoka, R. T. Corpuz, D. T. Baldwin, J. S. Foster, A. D. Goddard, D. G. Yansura, R. L. Vandlen, W. I. Wood, et al.
IL-17E, a Novel Proinflammatory Ligand for the IL-17 Receptor Homolog IL-17Rh1
J. Biol. Chem., January 5, 2001; 276(2): 1660 - 1664.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Shi, S. J. Ullrich, J. Zhang, K. Connolly, K. J. Grzegorzewski, M. C. Barber, W. Wang, K. Wathen, V. Hodge, C. L. Fisher, et al.
A Novel Cytokine Receptor-Ligand Pair. IDENTIFICATION, MOLECULAR CHARACTERIZATION, AND IN VIVO IMMUNOMODULATORY ACTIVITY
J. Biol. Chem., June 16, 2000; 275(25): 19167 - 19176.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tartour, E.
Right arrow Articles by Sautèes-Fridman, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tartour, E.
Right arrow Articles by Sautèes-Fridman, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online