This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Campiglio, M. Articles by Croce, C. M. Search for Related Content PubMed PubMed Citation Articles by Campiglio, M. Articles by Croce, C. M.

FHIT Loss of Function in Human Primary Breast Cancer Correlates with Advanced Stage of the Disease¹

Kimmel Cancer Institute, Thomas Jefferson University [M. C., Y. P., C. M. C.], Philadelphia, Pennsylvania 19107, and Oncologia Sperimentale E, Istituto Nazionale per lo Studio e la Cura dei Tumori [M. C., S. M., E. T., S. P.], 20133 Milan, Italy

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 
The FHIT gene, encompassing the FRA3B fragile site at chromosome 3p14.2, is a tumor suppressor gene involved in different tumor types. We have assessed 29 human primary breast carcinomas for both the presence of abnormal FHIT transcripts and the Fhit protein levels as compared with the normal breast epithelium of the same patients. In addition, we have also examined a second retrospective series of 156 consecutive breast carcinomas for the expression of the Fhit protein. In nine (31%) cases of the first series, FHIT transcripts were either aberrant or absent as determined by reverse transcription-PCR, and Fhit protein levels in tumors were low or absent as determined immunohistochemically. In 11 other cases (38%), only normal FHIT transcripts were detected by PCR, paralleled by the reduction or absence of Fhit protein. In the remaining nine cases (31%), the presence of the normal FHIT transcript corresponded to protein levels that were similar in tumor and normal breast epithelia. Thus, alterations in FHIT transcripts were detected in 31% of the patients, but reduction or absence of Fhit protein occurred in 69% of the breast carcinoma samples examined. These data suggest that alteration in Fhit expression in breast carcinomas is a frequent event. Analysis of correlation between Fhit expression and pathological, clinical, and biological parameters in these 29 tumors and in a second retrospective series of 156 consecutive primary breast carcinomas indicated that a decrease or an absence of Fhit protein expression is associated with high proliferation and large tumor size.

	Introduction

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 
Breast cancer is still the most frequent malignancy among women of western countries (1) . The genetic abnormalities that occur in breast cancer involve multiple genetic alterations, which are responsible for the progression from normal breast epithelia to invasive cancer cells.

Chromosomal region 3p14.2 is a frequent target for genetic and cytogenetic alterations in a wide range of solid tumors (for review see Ref. 2 ), leading to the search for a tumor suppressor gene in this region. The tumor suppressor gene FHIT, located at chromosome 3p14.2, is more than 1 Mb in size and encodes a 1.1-kb cDNA with 10 small exons; exon 5 is the first protein coding exon and is flanked in intron 4 and intron 5 by the most common fragile site in the human genome, FRA3B (3) . The FHIT gene belongs to the histidine triad (4) superfamily and encodes a cytoplasmic M_r 16,800 protein with diadenosine triphosphate (Ap3A) hydrolase activity. The conserved histidines are required for full enzymatic activity (4) . The gene is inactivated by deletions in cancer-derived cell lines and primary tumors of the lung (5) , head and neck (6) , breast (7) , stomach and colon (3) , and other organs.

Analysis of FHIT gene in a series of human primary breast cancer revealed allelic loss in 25% (7) and abnormal transcripts in approximately 30% of the cases (7 , 8) . FHIT homozygous deletions in samples with 3p14.2 aberrations were also found in the benign breast lesions of two women with familial predisposition to breast cancer (9) . Another study of normal breast epithelium, breast preneoplastic lesions, and invasive tumors reported the loss of heterozygosity of the FHIT locus in two patients with intraductal hyperplasia (10) . Studies correlating FHIT gene alterations with its protein level are required to determine the grade of inactivation of the gene in breast cancer disease. To address this question, we analyzed 29 cases of primary breast tumors for normal and abnormal FHIT transcripts and for the level of expression of Fhit protein in the normal breast epithelia and breast epithelia tumor of the same patient. Down-modulation or absence of Fhit protein was also evaluated in a series of 156 consecutive patients with primary breast carcinomas. In both groups, Fhit protein levels were reduced or absent in almost 70% of the breast cancer samples, whereas aberrant FHIT transcripts were detected in only 31% of the samples. Moreover, down-regulation of Fhit protein expression is associated with highly proliferative and large tumors.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 
Patients.
The study included two series of primary breast carcinoma obtained from patients surgically treated at Istituto Nazionale Tumori (Milan, Italy). The first (Series N. 1) included 23 DCs³ and 6 LCs selected for the availability of fresh tumor specimens. The second (series N. 2) included 156 consecutive cases of ductal, lobular, or mixed infiltrating breast cancer, retrospectively examined. Primary tumor diameter and axillary nodal status were obtained from histopathological reports. Histological grading was performed according to Pereira et al. (11) , based on tubule formation, nuclear morphology, and number of mitoses. Hormone receptors expression was determined by the DCC adsorption technique (12) .

RNA Extraction and RT-PCR.
Tumor specimens were frozen immediately after surgical resection. Total RNA was extracted from the frozen tumors using RNA-zol (Tel-Test, Friendswood, TX) according to the manufacturer’s instructions.

cDNA was synthesized from 1 µg of total RNA. RT was performed in a 20-µl volume of 1x first-strand buffer (Life Technologies, Inc.), 10 mM DTT, 500 µM each dNTP, 0.3 mg/ml random primer (Life Technologies, Inc.), and 300 units of SuperScript II reverse transcriptase (Life Technologies, Inc.). Samples were incubated at 70°C for 5 min and then at 42°C for 1 h before 1 µl of RNase A was added for 30 min.

One µl of cDNA was used for the first PCR amplification with primers EX2F and 06 (CTTTGAAGCTCAGGAAAG and CTGTGTCACTGAAAGTAGACC, respectively) from FHIT exons 2–9 in a volume of 25 µl containing 20 pmol of each primer, 200 µM each dNTP, 1x reaction buffer (Boehringer-Mannheim), and 1.25 units Taq polymerase (Boehringer-Mannheim). PCR cycling conditions were: (a) initial denaturation at 95°C for 3 min followed by 28 cycles of 30 s at 94°C; (b) 30 s at 57°C and 2 min at 72°C; and (c) final extension at 72°C for 5 min, using a Perkin-Elmer-Cetus PCR Thermocycler. Amplified products were diluted 20-fold and 1 µl was used for a second PCR amplification with primers UR5 and 752R (CTGTAAAGGTCCGTAGTG and CTGCCATTTCCTCCTCTGAT, respectively) from FHIT exons 3–9. The nested PCR amplification was carried out for 22 cycles under the same conditions as the first PCR, and products were resolved on a 1.3% agarose gel.

DNA Sequencing.
DNA bands corresponding to the normal and abnormal size FHIT transcripts were excised from the gel, purified using the Quick Gel extraction kit (QIAGEN), and sequenced on the Applied Biosystems model 373A and 377 DNA sequencers.

Immunohistochemistry.
Immunoperoxidase assay was carried out on paraffin-embedded sections of primary breast carcinomas. Briefly, 1–2 µm consecutive sections of formalin-fixed, paraffin-embedded tissue were cut and mounted in poly-L-lysine (Sigma, St. Louis, MO) coated-slides, deparaffined in xylene, and rehydrated in grade alcohol. Endogenous peroxidase activity was blocked by treatment with 0.3% hydrogen peroxide in methanol for 30 min. Fhit antigen enhancement was performed by staining the sections at 120°C in 10 mmol/liter sodium citrate buffer (pH 6.0) for 2 min. After treatment with normal goat at 1:50 for 30 min at room temperature, slides were incubated overnight with different antibodies. Antibodies reactivity was detected using biotinylated goat antirabbit IgG (Dako, Glostrup, Denmark) followed by incubation with streptavidin-conjugated horseradish peroxidase (Dako), and peroxidase activity was detected by amino-ethyl carbazole (AEC). Staining without antibody was performed as a negative control.

The following panel of monoclonal antibodies was applied: (a) rabbit polyclonal antibody anti-GST Fhit serum (1:4000); (b) anti-c-erbB-2 MAbcB11 (1:60; Ylem, Avezzano, AQ, Italy); (c) anti-p53 MAb DO7 (1:500; Novocastra, Newcastle-upon Tyne, United Kingdom); (d) anti-bcl2 Mab 100 (1:20; a kind gift from Dr. David Mason, John Radcliffe Hospital, Headington, Oxford, United Kingdom); and (e) anti-progesterone receptor MAb1A6 (1:20; DBA, Segrate, MI, Italy) evaluated as described previously(13) . Fhit immunostaining was assessed based on cytoplasmic labeling.

Statistical Analysis.
² analysis was used to evaluate differences in frequencies of the various parameters.

	Results

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 
Aberrant FHIT Transcripts in Human Primary Breast Cancer.
Nested RT-PCR analysis of 29 primary breast tumors (23 DCs and 6 LCs) and normal breast epithelium (as a control) using primers within FHIT exons 3 and 9 revealed aberrant transcripts in 7 cases and absence of FHIT products in 2 cases (Table 1 ; Fig. 1 ). Sequence analysis of the aberrant transcripts showed exon deletions involving exon 5 (containing the initiating methionine) in 6 cases—specifically, deletions of exons 4–7 (sample 15), exons 5–8 (samples 8 and 14), exons 4–8 (sample 26), exons 4–6 (sample 27), and exons 5–7 (sample 24). All of the 6 cases also showed the normal-sized fragment of 577 bp, with the correct FHIT sequence. Sample 6 showed a larger abnormal FHIT transcript in the absence of the normal FHIT product; sequence analysis revealed a 65-bp insertion between exon 4 and 5 that leaves the coding region intact. Besides the normal and deleted FHIT transcripts, a larger band was detected in samples 2, 22, and 24 and indicated an 100-bp insertion between noncoding exons 3 and 4 of sample 24, whereas the products were not resolved in sample 2 or 22. In samples 9 and 11, FHIT transcripts were not detected.

View larger version (30K): [in this window] [in a new window]   Fig. 1. Expression of FHIT transcripts PCR in human primary breast cancer. One µl of cDNA was amplified by nested PCR with primers within exons 3 and 9 in 29 primary breast tumors (Lanes 1–29) and 1 normal breast epithelium (Lane 30).

View larger version (177K): [in this window] [in a new window]   Fig. 2. Expression of Fhit protein in human breast normal and cancer epithelium analyzed by immunohistochemistry on paraffin-embedded breast carcinoma using rabbit GST-Fhit antibody. a, strong immunostaining of normal epithelial tissue; b and c, strong immunostaining of tumor and normal epithelium; d and e, weak immunostaining of tumor cells and strong immunostaining in normal epithelium; f, negative immunostaining of tumor cells and strong immunostaining of normal epithelium.

The third group included 11 cases negative for Fhit protein expression in the tumor, whereas the normal epithelium in the same sample was highly positive (Fig. 2f) . Six of these tumors displayed normal FHIT transcripts. It is possible that the normal RT-PCR band derives from the normal cells contaminating the tumor tissue. Two cases showed a mixture of normal and aberrant transcripts (deletions exon 5–7 and 4–6). In one other sample (sample 6) only an abnormal transcript with an insertion that leaves the coding region intact was revealed; suggesting that this insertion was sufficient to abolish protein expression. In the remaining 2 samples (9 and 11), the absence of Fhit transcripts correspond to the lack of Fhit protein (Table 1) . Thus, Fhit protein level were reduced or absent 69% (20 of 29) of the breast carcinoma samples tested.

Correlation between FHIT Alterations and Bio-pathological Parameters.
Reduction and loss of Fhit protein expression was observed with similar frequency also on a retrospective series of 156 consecutive primary breast carcinomas (Table 3) .

	Discussion

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 
In the present study, detection of abnormal FHIT transcripts was reported in one-third of the human breast carcinomas examined in keeping with our previous data (7) . These alterations led to a decrease or absence of Fhit protein in the tumor cells. In addition, down-regulation or absence of Fhit protein was detected in another one-third of the samples displaying normal Fhit transcript. This leads to the conclusion of altered Fhit expression in a larger fraction of tumors (70%) than the one expected on the basis of gene alterations, which suggests that FHIT is one of the most frequent targets of alteration in breast cancer. Indeed, well-studied markers of breast carcinomas aggressiveness, such as HER2 and p53 were affected in less than 30% of our cases, as reported previously (13, 14, 15) . The higher frequency of FHIT alteration in human breast cancer suggests the potential usefulness of this marker for prognostic purpose and as a therapeutic target in breast tumors.

In previous studies, loss of function of FHIT was attributed to intragenic deletions leading to the production of transcripts incapable of synthesizing the protein (16) . In fact, the absence of the initiating methionine located in exon 5 (deleted in some of the samples examined in our study) as well as transfection experiments with constructs sequentially deleted in each FHIT coding exon,⁴ showed that some deletions did not allow Fhit protein expression. Similarly, sample 6 in our study, which displayed only the abnormal transcript with a 65-bp insertion between exon 4 and 5, did not express detectable amounts of protein, suggesting that even an insertion outside the coding region can abolish Fhit protein synthesis. However, our finding of absent Fhit protein in 11 cases and reduced level of the protein in 4 cases suggests that Fhit protein expression can be abrogated by additional mechanisms. Similarly, Hadaczek et al. (17) have reported no FHIT gene abnormalities and a very low number of cases with altered RT-PCR products in clear cell renal carcinoma where the great majority of clear cells showed reduced or absent Fhit protein. One possible reason for the lack of correlation between the data by RT-PCR and by immunohistochemistry observed in these 11 cases may rest in the exquisite sensitivity of RT-PCR in detecting very low-abundance transcripts whose products may not be detectable at the protein level; we cannot exclude the possibility that the normal transcript derives from normal ductal cells present in the tumor specimens (less than 1%) that are strongly positive by immunohistochemistry in all of the 11 specimens.

Finally, the decrease or absence of Fhit protein observed in these 29 cases and in a series of 156 consecutive breast carcinomas is clearly associated with a more aggressive disease, inasmuch as it is significantly associated with highly proliferative and large tumors, showing a tendency to be poorly differentiated.

In conclusion, our studies showed for the first time that Fhit inactivation is a very frequent event in breast carcinomas and identifies a more aggressive phenotype.

	ACKNOWLEDGMENTS

 
We thank Piera Aiello, Ghirelli Cristina, and Luisa Moiraghi for expert technical assistance.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work was supported by NIH Grant CA39860 and by AIRC (Associazone Italiana per la Ricera sul Cancro).

² To whom requests for reprints should be addressed, at Kimmel Cancer Institute, Thomas Jefferson University, Room 1050 BLSB, 233S 10th Street, Philadelphia, PA 19107. Phone: (215) 503-4645; Fax: (215) 923-3528.

³ The abbreviations used are: DC, ductal carcinoma; LC, lobular carcinoma; RT, reverse transcription.

⁴ Unpublished data.

Received 2/19/99. Accepted 7/ 1/99.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods Results Discussion REFERENCES

 

1. Wingo P. A., Tong T., Bolden S. Cancer statistic. CA Cancer J. Clin., 45: 8-30, 1995.[Abstract/Free Full Text]
2. Kok K., Naylor S. L., Buys C. H. Deletions of the short arm of chromosome 3 in solid tumors and search for suppressor genes. Adv. Cancer Res., 71: 27-92, 1997.[Medline]
3. Ohta M., Inoue H., Cotticelli M. G., Kastury K., Baffa R., Palazzo J., Siprashvili Z., Mori M., Mccue P., Druck T., Croce C. M., Huebner K. The FHIT gene, spanning the chromosome 3p14.2 fragile site acid renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell, 84: 587-597, 1996.[Medline]
4. Barnes L. D., Garrison P. N., Siprashvili Z., Guranowski A., Robinson A. K., Ingram S. W., Croce C. M., Ohta M., Huebner K. Fhit, a putative tumor suppressor in humans, is a dinucleoside 5', 5'''-P1, P3-triphosphate hydrolase. Biochemistry, 35: 11529-11535, 1996.[Medline]
5. Sozzi G., Veronese M. L., Negrini M., Baffa R., Cotticelli M. G., Inoue H., Tornielli S., Pilotti S., De Gregorio L., Pastorino U., Pierotti M. A., Ohta M., Huebner K., Croce C. M. The FHIT gene at 3p14.2 is abnormal in lung cancer. Cell, 85: 17-26, 1996.[Medline]
6. Virgilio L., Schuster M., Gollin S. M., Veronese M. L., Ohta M., Huebner K., Croce C. M. Fhit gene alterations in head and neck squamos cell carcinomas. Proc. Natl. Acad. Sci. USA, 93: 9770-9775, 1996.[Abstract/Free Full Text]
7. Negrini M., Monaco C., Vorechovsky I., Ohta M., Druck T., Baffa R., Huebner K., Croce C. M. The FHIT gene at 3p14.2 is abnormal in breast carcinomas. Cancer Res., 56: 3173-3179, 1996.[Abstract/Free Full Text]
8. Hayashi S., Tanimoto M., Hajiro-Nakanishi K., Tsuchiya E., Kurosumi M., Higashi Y., Imai K., Suga K., Nakachi K. Abnormal FHIT transcripts in human breast carcinomas: a clinicopathological and epidemiological analysis of 61 Japanese cases. Cancer Res., 57: 1981-1985, 1997.[Abstract/Free Full Text]
9. Panagopoulos I., Pandis N., Thelin S., Petersson C., Mertens F., Borg Å., Kristoffersson U., Mitelman F., Åman P. The FHIT and PTPRG genes are deleted in benign proliferative breast disease associated with familial breast cancer and cytogenetic rearrangements of chromosome band 3p14. Cancer Res., 56: 4871-4875, 1996.[Abstract/Free Full Text]
10. Ahmadian M., Wistuba I. I., Fong K. M., Behrens C., Kodagoda D. R., Saboorian M. H., Shay J., Tomlinson G. E., Blum J., Minna J. D., Gazdar A. F. Analysis of the FHIT gene and FRA3B region in sporadic breast cancer, preneoplastic lesions, and familial breast cancer probands. Cancer Res., 57: 3664-3668, 1997.[Abstract/Free Full Text]
11. Pereira H., Pinder S. E., Sibbering D. M., Galea M. H., Elston C. W., Blamey R. W., Robertson J. F. R., Ellis I. O. Pathological prognostic factors in breast cancer. IV: should you be a typer or a grader? A comparative study of two histological prognostic features in operable breast carcinoma. Histopathology, 27: 219-226, 1995.[Medline]
12. Pellegrini R., Mariotti A., Tagliabue E., Bressan R., Bunone G., Coradini D., Della Valle G., Formelli F., Cleri L., Pierotti M. A., Colnaghi M. I., Ménard S. Modulation of markers associated with tumor aggressiveness in human breast cancer cell lines by N-(4-hydroxyphenyl)retinamide. Cell Growth Differ., 6: 863-869, 1995.[Abstract]
13. Ménard S., Casalini P., Pilotti S., Cascinelli N., Rilke F., Colnaghi M. I. No additive impact on patient survival of the double alteration of p53 and c-erbB-2 in breast carcinomas. J. Natl. Cancer Inst., 88: 1002-1003, 1996.[Free Full Text]
14. Slamon D. J., Clark G. M., Wong S. G., Levin W. J., Ullrich A., McGuire W. L. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science (Washington DC), 235: 177-182, 1987.[Abstract/Free Full Text]
15. Greenblatt M. S., Bennett W. P., Hollstein M., Harris C. C. Mutations in the p53 tumor suppressor gene: clues to cancer etiology and molecular pathogenesis. Cancer Res., 54: 4855-4878, 1994.[Free Full Text]
16. Huebner, K., Garrison, P. N., Barnes, L. D., and Croce, C. M. The role of the FHIT/FRA3B locus in cancer. Annu. Rev. Genet., in press, 1999.
17. Hadaczek P., Siprashvili Z., Markiewski M., Domagala W., Druck T., McCue P. A., Pekarsky Y., Ohta M., Huebner K., Lubinski J. Absence or reduction of Fhit expression in most clear cell renal carcinomas. Cancer Res., 58: 2946-2951, 1998.[Abstract/Free Full Text]

This article has been cited by other articles:

				F. Bianchi, A. Magnifico, C. Olgiati, N. Zanesi, Y. Pekarsky, E. Tagliabue, C. M. Croce, S. Menard, and M. Campiglio FHIT-proteasome degradation caused by mitogenic stimulation of the EGF receptor family in cancer cells PNAS, December 12, 2006; 103(50): 18981 - 18986. [Abstract] [Full Text] [PDF]

				P. Bavi, Z. Jehan, V. Atizado, H. Al-Dossari, F. Al-Dayel, A. Tulbah, S. S. Amr, S. S. Sheikh, A. Ezzat, H. El-Solh, et al. Prevalence of fragile histidine triad expression in tumors from saudi arabia: a tissue microarray analysis. Cancer Epidemiol. Biomarkers Prev., September 1, 2006; 15(9): 1708 - 1718. [Abstract] [Full Text] [PDF]

				B. Arun, G. Kilic, C. Yen, B. Foster, D. A. Yardley, R. Gaynor, and R. Ashfaq Loss of FHIT Expression in Breast Cancer Is Correlated with Poor Prognostic Markers Cancer Epidemiol. Biomarkers Prev., July 1, 2005; 14(7): 1681 - 1685. [Abstract] [Full Text] [PDF]

				S C L Santos, L R Cavalli, I J Cavalli, R S Lima, B R Haddad, and E M S F Ribeiro Loss of heterozygosity of the BRCA1 and FHIT genes in patients with sporadic breast cancer from Southern Brazil J. Clin. Pathol., April 1, 2004; 57(4): 374 - 377. [Abstract] [Full Text] [PDF]

				Y. Pekarsky, P. N. Garrison, A. Palamarchuk, N. Zanesi, R. I. Aqeilan, K. Huebner, L. D. Barnes, and C. M. Croce Fhit is a physiological target of the protein kinase Src PNAS, March 16, 2004; 101(11): 3775 - 3779. [Abstract] [Full Text] [PDF]

				Q. Yang, M. Nakamura, Y. Nakamura, G. Yoshimura, T. Suzuma, T. Umemura, Y. Shimizu, I. Mori, T. Sakurai, and K. Kakudo Two-Hit Inactivation of FHIT by Loss of Heterozygosity and Hypermethylation in Breast Cancer Clin. Cancer Res., September 1, 2002; 8(9): 2890 - 2893. [Abstract] [Full Text] [PDF]

				B. C. Turner, M. Ottey, D. B. Zimonjic, M. Potoczek, W. W. Hauck, E. Pequignot, C. L. Keck-Waggoner, C. Sevignani, C. M. Aldaz, P. A. McCue, et al. The Fragile Histidine Triad/Common Chromosome Fragile Site 3B Locus and Repair-deficient Cancers Cancer Res., July 15, 2002; 62(14): 4054 - 4060. [Abstract] [Full Text] [PDF]

				L. Roz, M. Gramegna, H. Ishii, C. M. Croce, and G. Sozzi Restoration of fragile histidine triad (FHIT) expression induces apoptosis and suppresses tumorigenicity in lung and cervical cancer cell lines PNAS, March 19, 2002; 99(6): 3615 - 3620. [Abstract] [Full Text] [PDF]

				Z. Li, D. H. Moore, Z. H. Meng, B.-M. Ljung, J. W. Gray, and S. H. Dairkee Increased Risk of Local Recurrence Is Associated with Allelic Loss in Normal Lobules of Breast Cancer Patients Cancer Res., February 1, 2002; 62(4): 1000 - 1003. [Abstract] [Full Text] [PDF]

				S. M. Kraggerud, P. Aman, R. Holm, A. E. Stenwig, S. D. Fossa, J. M. Nesland, and R. A. Lothe Alterations of the Fragile Histidine Triad Gene, FHIT, and Its Encoded Products Contribute to Testicular Germ Cell Tumorigenesis Cancer Res., January 1, 2002; 62(2): 512 - 517. [Abstract] [Full Text] [PDF]

				K. Uematsu, A. Yoshimura, A. Gemma, H. Mochimaru, Y. Hosoya, S. Kunugi, K. Matsuda, M. Seike, F. Kurimoto, K. Takenaka, et al. Aberrations in the Fragile Histidine Triad (FHIT) Gene in Idiopathic Pulmonary Fibrosis Cancer Res., December 1, 2001; 61(23): 8527 - 8533. [Abstract] [Full Text] [PDF]

				Q. Yang, G. Yoshimura, T. Suzuma, T. Tamaki, T. Umemura, M. Nakamura, Y. Nakamura, X. Wang, I. Mori, T. Sakurai, et al. Clinicopathological Significance of Fragile Histidine Triad Transcription Protein Expression in Breast Carcinoma Clin. Cancer Res., December 1, 2001; 7(12): 3869 - 3873. [Abstract] [Full Text] [PDF]

				A. Maitra, I. I. Wistuba, C. Washington, A. K. Virmani, R. Ashfaq, S. Milchgrub, A. F. Gazdar, and J. D. Minna High-Resolution Chromosome 3p Allelotyping of Breast Carcinomas and Precursor Lesions Demonstrates Frequent Loss of Heterozygosity and a Discontinuous Pattern of Allele Loss Am. J. Pathol., July 1, 2001; 159(1): 119 - 130. [Abstract] [Full Text] [PDF]

				S. Zöchbauer-Müller, K. M. Fong, A. Maitra, S. Lam, J. Geradts, R. Ashfaq, A. K. Virmani, S. Milchgrub, A. F. Gazdar, and J. D. Minna 5' CpG Island Methylation of the FHIT Gene Is Correlated with Loss of Gene Expression in Lung and Breast Cancer Cancer Res., May 1, 2001; 61(9): 3581 - 3585. [Abstract] [Full Text]

				J. I. Lee, J.-C. Soria, K. Hassan, D. Liu, X. Tang, A. El-Naggar, W. K. Hong, and L. Mao Loss of Fhit Expression Is a Predictor of Poor Outcome in Tongue Cancer Cancer Res., February 1, 2001; 61(3): 837 - 841. [Abstract] [Full Text]

				G. Borzacchiello, V. Ambrosio, P. Galati, F. Poggiali, A. Venuti, and F. Roperto The Pagetoid Variant of Urothelial Carcinoma In Situ of Urinary Bladder in a Cow Vet. Pathol., January 1, 2001; 38(1): 113 - 116. [Abstract] [Full Text] [PDF]

				T. Segawa, T. Sasagawa, K. Saijoh, and M. Inoue Clinicopathological Significance of Fragile Histidine Triad Transcription Protein Expression in Endometrial Carcinomas Clin. Cancer Res., June 1, 2000; 6(6): 2341 - 2348. [Abstract] [Full Text]

				M. Mori, K. Mimori, T. Shiraishi, H. Alder, H. Inoue, Y. Tanaka, K. Sugimachi, K. Huebner, and C. M. Croce Altered Expression of Fhit in Carcinoma and Precarcinomatous Lesions of the Esophagus Cancer Res., March 1, 2000; 60(5): 1177 - 1182. [Abstract] [Full Text]

				R. Baffa, L. G. Gomella, A. Vecchione, P. Bassi, K. Mimori, J. Sedor, C. M. Calviello, M. Gardiman, C. Minimo, S. E. Strup, et al. Loss of FHIT Expression in Transitional Cell Carcinoma of the Urinary Bladder Am. J. Pathol., February 1, 2000; 156(2): 419 - 424. [Abstract] [Full Text] [PDF]

				X. P. Hao, J. E. Willis, T. G. Pretlow, J. S. Rao, G. T. MacLennan, I. C. Talbot, and T. P. Pretlow Loss of Fragile Histidine Triad Expression in Colorectal Carcinomas and Premalignant Lesions Cancer Res., January 1, 2000; 60(1): 18 - 21. [Abstract] [Full Text]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Campiglio, M. Articles by Croce, C. M. Search for Related Content PubMed PubMed Citation Articles by Campiglio, M. Articles by Croce, C. M.