This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wiemels, J. L. Articles by Greaves, M. F. Search for Related Content PubMed PubMed Citation Articles by Wiemels, J. L. Articles by Greaves, M. F.

A Lack of a Functional NAD(P)H:Quinone Oxidoreductase Allele Is Selectively Associated with Pediatric Leukemias That Have MLL Fusions¹

Leukaemia Research Fund Centre, Institute of Cancer Research, London SW3 6JB [J. L. W., A. P., M. F. G.]; Immunogenetics Laboratory, St Mary’s Hospital, Manchester M13 0JH [G. M. T.]; Academic Unit of Paediatric Oncology, Royal Manchester Children’s and Christie Hospital National Health Service Trust, Withington, Manchester M20 4BX [O. B. E.]; and Department of Public Health Sciences, University of Edinburgh, Medical School, Edinburgh EH8 9AG [F. E. A.], United Kingdom

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Rearrangements and fusion of the MLL gene with various alternative partner genes occur in 80% of infant leukemias and are acquired during fetal hemopoiesis in utero. Similar MLL gene recombinants also occur in topoisomerase II-inhibiting drug-induced leukemias. These data have led to the suggestion that some infant leukemia may arise via transplacental fetal exposures during pregnancy to substances that form cleavable complexes with topoisomerase II and induce illegitimate recombination of the MLL gene. A structural feature shared by many topoisomerase II-inhibiting drugs and other chemicals is the quinone moiety. We assayed, by PCR-RFLP, for a polymorphism in an enzyme that detoxifies quinones, NAD(P)H:quinone oxidoreductase (NQO1), in a series (n = 36) of infant leukemias with MLL rearrangements versus unselected cord blood controls (n = 100). MLL-rearranged leukemias were more likely to have genotypes with low NQO1 function (heterozygous CT or homozygous TT at nucleotide 609) than controls (odds ratio, 2.5; P = 0.015). In contrast, no significant allele bias was seen in other groups of pediatric leukemias with TEL-AML1 fusions (n = 50) or hyperdiploidy (n = 29). In the subset of infant leukemias that had MLL-AF4 fusion genes (n = 21), the bias increase in low or null function NQO1 genotypes was more pronounced (odds ratio, 8.12; P = 0.00013). These data support the idea of a novel causal mechanism in infant leukemia involving genotoxic exposure in utero and modulation of impact on a selective target gene by an inherited allele encoding a rate-limiting step in a carcinogen detoxification pathway.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Pediatric acute leukemia is a diverse cancer in terms of its underlying biology and clinical response (1 , 2) . Infants with ALL⁴ or AML usually have acquired MLL gene fusions as their major consistent genetic abnormality (3 , 4) . In contrast, the most common leukemia in children, B-cell precursor or cALL in the 2–5-year age peak of disease incidence (2) , have other genetic abnormalities, most frequently TEL-AML1 gene fusion or hyperdiploidy (5, 6, 7) . These subsets have been postulated to have distinct etiologies (8) , although both can be initiated in utero (9 , 10) . The risk of leukemia in children, in common with cancer in general, may be a composite of the complex interplay between inherited predisposition, exogenous exposures, and chance events. Each subtype of leukemia may then be expected to have distinct or preferential causal networks. Constitutive predisposition can operate via highly penetrant mutant genes like p53 in Li-Fraumeni syndrome or, more commonly, via low penetrance genetic polymorphisms that indirectly modulate risk to more modest levels, such as cytochrome P-450s or glutathione transferases (11) . The latter are most often reported in the context of cancers linked to particular genotoxic exposures (12) . Very few such associations have been reported in childhood leukemia (13 , 14) . Preliminary evidence suggests that particular HLA DQ/DP haplotypes may be associated with increased risk of cALL, which accords with the postulated role of infection in this biological subset of leukemia (15) .

MLL gene rearrangements are common in secondary acute leukemias (usually myeloblastic M4/M5) associated with prior exposure to epidophyllotoxin or anthracycline drugs that inhibit topoisomerase II (16 , 17) . Breaks in the MLL gene occur within a 10-kb cluster region at the 3' end of which is a functional topoisomerase II binding site (18) . In secondary leukemias, breaks in the MLL gene occur more often in the 3' side of the BCR within a few kb of the topoisomerase II site (19) . De novo ALL or AML with MLL gene breaks were reported to have more common 5' breaks (19) , but subsequent studies have reported either preferential 3' breaks in infant ALL with MLL-AF4 fusions (20) or little or no bias in breakpoint distribution in infant cases (21) . These discrepancies can be accounted for, at least in part, by differences in the definition of 5' and 3' regions of the BCR. These data, coupled with the prenatal origin of MLL gene fusions (9 , 22) , have suggested a plausible etiological mechanism for infant acute leukemia involving transplacental exposure to substances that form cleavable complexes with topoisomerase II-inhibiting substances (8 , 23) . A number of candidate substances have been identified and provide the focus for ongoing epidemiological case/control studies (4) . Some prior epidemiological associations reported for infant leukemia are also in accord with this suggested mechanism (24 , 25) .

The potential exposures of the pregnant mother and fetus to dietary, medical, or environmental chemicals that interact with topoisomerase II may be orders of magnitude lower in functional dose than those of chemotherapy drugs used in the treatment of cancer, although in some cases the chemicals involved in the former are as biologically active in the role of topoisomerase II inhibitors as the chemotherapeutics (26) . We anticipated that interindividual differences in metabolism of these chemicals might play an important role in response to such lower doses and modulate the risk of pediatric leukemias with MLL gene fusions but not that of other subtypes. Many topoisomerase II-inhibiting compounds are quinone-containing substances (27, 28, 29, 30) . The metabolism of quinones, as exemplified by benzene detoxification, is critically controlled by the enzyme NQO1 (or DT-diaphorase, EC 1.6.99.2; Ref. 31 ). NQO1 converts toxic benzoquinones to hydroquinones in an obligate two-electron reduction. This reaction is in competition with one-electron reduction reactions by cytochromes P-450, producing the semiquinone, which generate free radicals and reactive oxygen species via redox cycling.

Two polymorphic variants of NQO1 have been identified: a CT change at nt 609 yields a proline to serine substitution (32) , and a TC substitution at nt 464 results in a tryptophan replacement of arginine (33 , 34) . The first of these (C609T) effectively inactivates the enzyme due to decreased catalytic activity and stability of NQO1 protein (35 , 36) ; the second (T464C) has not yet been completely characterized. We have analyzed these polymorphisms in three subgroups of infant and childhood leukemias with the hypothesis that: (a) MLL leukemia patients and/or their mothers will show a higher prevalence of low NQO1-inducing genotypes, reflecting a reduced ability to detoxify carcinogens that promote MLL translocations; and (b) other groups of childhood leukemias, including those cALLs with TEL-AML1 translocations and those exhibiting hyperdiploidy, that have not been epidemiologically associated with chemical exposure should not demonstrate a bias in allele frequency.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Patient and Control Samples.
All of the patients (<15 years old) were enrolled in the United Kingdom Childhood Cancer Epidemiology Study (UKCCS). Patient samples taken at the time of diagnosis of acute leukemia were screened and classified for common molecular subgroups of pediatric leukemia by banded karyotyping and by fluorescence in situ hybridization (for hyperdiploidy) and reverse transcription-PCR (for MLL fusions and TEL-AML1 fusions). Remission blood samples were also obtained. Controls consisted of umbilical cord blood samples obtained from healthy new-born infants. A small proportion (<10%) of patients was from minority ethnic groups in the United Kingdom (i.e., Asian, Afro-Caribbean black, and Oriental). No attempt was made to screen out such individuals, and we have no evidence that they are disproportionately represented in any leukemia subgroup.

NQO1 Genotyping.
Genotyping was performed by PCR-RFLP analysis of DNA extracted from patient blood samples and controls. Infant (<24 months) leukemic patient samples used were taken either at diagnosis of leukemia (n = 16) or, when in remission, within 3 months of diagnosis (n = 20). All of the other patient DNA samples for genotyping were from blood taken during remission. Twenty nmoles of the primers NQO1609A, CCTCTCTGTGCTTTCTGTATCC with NQO1609B, GATGGACTTGCCCAAGTGATG (for the nt 609 polymorphism) or NQO1464A, CTGGTCTTACCTCAATGATGTC with NQO1464B, CCTGCATCAGTACAGACCACC (for the nt 464 polymorphism) were mixed with 60 ng of DNA, 50 mM KCl, 10 mM Tris-HCl (pH 8.3), 2.5 pmol of each dNTP, and 1.25 units Taq polymerase in a total volume of 50 µl and subjected to 35 cycles (94°C for 1 min, 60°C for 1 min, and 72°C for 1 min) in an MJ Research thermal cycler (Watertown, MA) followed by an extension at 72°C for 7 min. PCR products were checked on agarose gels. The remainder of the PCR reaction was digested with HinF1 in the case of nt 609 polymorphism or with MspI in the case of the nt 464 polymorphism. Digestion with HinFI yielded two bands for the homozygous wild-type bp 609 (84 and 214 bp), four bands for heterozygotes (65, 84, 149, and 214 bp), and three bands for homozygous variant (65, 84, and 149 bp). Digestion of the second PCR reaction with MspI yielded two bands in the case of homozygous wild type (62 and 144 bp), three bands for heterozygotes (62, 144, and 209 bp), and one band for homozygous variants (209 bp). Digestion products were analyzed by electrophoresis in 0.7% agarose with 2% Synergel (Diversified Biotech) and viewed by ethidium bromide staining/UV trans-illumination (Fig. 1) .

View larger version (83K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. PCR-RFLP analysis of NQO1 polymorphisms in six individuals analyzed on a 0.7% agarose/2% Synergel electrophoresis gel. Lane 1, Marker (Life Technologies, Inc., 1 kb). Lanes 1–3, nt 464 PCR reactions digested with MspI; Lanes 4–6, nt 609 PCR reactions digested with HinFI. Lanes 1 and 4, homozygote normal individuals for the respective polymorphisms; Lanes 3 and 6, homozygote variant individuals for the respective polymorphisms; Lanes 2 and 5, heterozygote individuals for the polymorphisms.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Of the 36 cases of MLL fusion gene-positive infant leukemias available, 30 were classified morphologically and by immunophenotype as ALL and 6 as AML. MLL fusion gene partners were as shown in Table 1 . As anticipated, most of the cases were MLL-AF4-positive. Two hundred fifteen individuals were typed for NQO1 genotypes and are presented in Table 1 . A 17% allele frequency was found for controls for the nt 609 variant allele, which is intermediate to the 13–25% allele frequency found in comparable studies in Caucasians in Europe and North America (34 , 37, 38, 39) . In the largest group to date, a 16% allele frequency was found among 575 individuals (34) . A 5.5% allele frequency was found for controls at the nt 464 variant, which is similar to that found in Canadian Caucasians (5%; Ref. 34 ). Representative PCR gel results are illustrated in Fig. 1 .

When NQO1 genotypes were analyzed for the major molecular subtype of MLL gene rearranged ALL, i.e., those with MLL-AF4 fusions, a more pronounced bias toward low-function genotypes (as nt 609) was evident [OR, 8.12; 95% CI, 2.29–31.48 (Table 2) ]. Other subgroups of these infant leukemias, i.e., AML or ALL with MLL-ENL or MLL-AF9 fusions had too few cases for a separate analysis of NQO1 allele frequency.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
NQO1 is a cytoplasmic, ubiquitously expressed enzyme that catalyzes an obligate two-electron reduction of a wide variety of quinones using NADH or NADPH as the reducing cofactor. NQO1 is generally known for its detoxifying properties, effective with such chemicals as menadione (40) , benzene (41) , and benzo(a)pyrene quinone (42) . NQO1 is also known to be involved in the recycling of membrane antioxidants ubiquinone and vitamin E (43 , 44) . The simplest quinone, benzoquinone, is a metabolite of benzene produced in the bone marrow from hydroquinone via myeloperoxidase (45) and is also derived from arbutin, a glycoside conjugate of hydroquinone, which is common in the food supply (46) . Studies suggest that the balance between myeloperoxidase and NQO1 levels in the bone marrow determines the level of toxic effects of hydroquinone and may ultimately determine the leukemogenicity of benzene (47 , 48) . NQO1 strongly inhibited a class of DNA adducts induced by hydroquinone (49) , which suggests a potential mechanism for its protection of the hemopoietic system in benzene-exposed individuals (41) . NQO1 has a wide substrate specificity and may play a similar role in detoxifying other environmentally derived quinones and quinone-imines.

Two polymorphic variants in NQO1 have been found, a CT substitution at nt 609 and a TC substitution at nt 464. The nt 609 polymorphism has been recently associated with specific leukemogenic changes, including clonal abnormalities in chromosomes 5 and/or 7, in therapy-related leukemias (50) . This polymorphism is effectively completely inactivating, whereas the nt 464 polymorphism has not been characterized in mammalian cells. A higher prevalence of low NQO1-inducing genotypes (C609T), as we describe here for pediatric leukemia with MLL gene fusions, therefore, reflects a reduced ability to detoxify quinone-based carcinogens. Although the allele bias that we describe is statistically significant, especially for the small series of cases (n = 21) with MLL-AF4 gene fusions, it will be important to confirm this association in an independent series of patients. The prevalence of the C609T polymorphism varies among different ethnic groups. The highest reported allele frequency of the variant is approximately 40% in Asian populations (37 , 41) . It may be significant in this context that infant leukemia is more frequent in Oriental than in Western countries (analysis of data from Ref. 51 ).⁵ The lack of association of nt 464 variant alleles with MLL⁺ leukemias may indicate a low functional phenotype of this polymorphism.

Felix et al. (52) recently reported that an excess risk of secondary leukemias (both with and without MLL gene fusion) was associated with a reduced likelihood of inheritance of the CYP3A4-V allele of cytochrome P-450 CYP3A4 gene, which metabolizes epidophyllotoxins (and other chemicals) to quinone metabolites. However, no such association was observed in de novo leukemias with MLL gene fusions, most of which were in infant cases. Taken at face value, these data seem to conflict with our own but need not necessarily do so. Firstly, cytochrome P-450 enzymes may be more critical or dose-limiting in the context of high-dose chemotherapeutic exposures generating genotoxic metabolites. Secondly, CYP3A4 is not expressed in fetal development (53 , 54) and, therefore, cannot contribute to the risk of MLL gene fusions in the context of infant leukemia. NQO1 is expressed in fetal liver.⁶

There was no significant bias of allele frequency in other subsets of pediatric ALL with alternative acquired molecular abnormalities, hyperdiploidy, or TEL-AML1 fusion genes. The latter subtypes are members of the common (c) variant of childhood ALL in which an abnormal response to infection is postulated to be a major etiological factor (8) . We, therefore, demonstrate a unique and hitherto undescribed link between an inherited genetic polymorphism and a specific acquired genetic abnormality in a cancer subtype. We hypothesize that the link is associated with suspected patterns of chemical exposure during pregnancy. The hypothesis is that substances that form cleavable complexes with topoisomerase II are prime candidates for the induction of MLL gene fusions (8 , 23) . This idea was prompted by the observation that MLL gene fusions characteristic of infant leukemia are also common in secondary leukemias associated with prior exposure to therapeutic drugs including epidophyllotoxins or anthracyclines, which operate via topoisomerase II inhibition (16 , 17) .

Candidate substances that might generate infant leukemia with MLL gene fusions and that would be metabolized to quinones in the fetal liver include dietary flavonoids, podophyllin toxins, and benzene. Ongoing case/control studies are assessing via maternal, questionnaire-based data, exposure patterns during pregnancy. Epidemiological studies have implicated a number of different maternal exposures during pregnancy that are associated with infant leukemia, although cases were not analyzed for MLL gene status. These include diets rich in flavonoids (25) , pesticides, marijuana, alcohol (55) , and benzene or gasoline exposures (reviewed in Ref. 24 ). Some of these, if causally relevant, could operate via the quinone metabolic pathway. Benzene metabolites (in gasoline and in tobacco marijuana smoke, for example) as well as flavonoids are oxidized by peroxidases to yield semiquinones and quinones (31 , 56) . In the case of benzene metabolites, the oxidized products interact with topoisomerase II (57) . A NQO1-deficient individual may be less able to cope with the quinone assault. Unoxidized flavonoids are excellent topoisomerase II inhibitors (26) , and, therefore, the role of NQO1 is less clear

It should be remembered that the ultimate mechanism for MLL breakage leading to translocation is unknown and could involve topoisomerase II inhibition or, alternatively, the formation of reactive metabolites or reactive oxygen species. Indeed, many topoisomerase II-inhibiting drugs form reactive oxygen species with great facility as do benzene metabolites (31) and flavonoids (56) . The 3' end of the MLL BCR has been shown to be a DNase-hypersensitive site and liable to breaks by a variety of apoptotic-inducing stimuli, which indicates that other mechanisms not involving topoisomerase II may play a role. The ultimate mechanism of NQO1-modified attack on the MLL gene in infant leukemia, therefore, remains to be uncovered. The objective of additional studies lies in uncovering the genetic-environmental interactions and pathway leading to the development of a highly malignant and clinically intractable leukemia in infants. Prevention is the long-term goal.

	ACKNOWLEDGMENTS

 
We thank Dr. C. Price, S. Colman, M. Iravani, R. Dhat, and A. Hussain for technical support; Dr. C. Harrison for chromosome data; Dr. E. Roman for diagnostic summaries; and the clinicians and hematologists who provided blood and marrow samples from patients. We also thank Professor M. Smith for advice and B. Deverson for help in the preparation of the manuscript.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Laboratory studies were funded by the Kay Kendall Leukaemia Fund and the Leukaemia Research Fund. The United Kingdom Childhood Cancer Study is sponsored and administered by the United Kingdom Co-ordinating Committee on Cancer Research. The Study is conducted by 12 teams of investigators (10 clinical and epidemiological and 2 biological) based in university departments, research institutes, and the Scottish health service. The work is coordinated by a Management Committee and in Scotland by a Steering Group. It is supported by the United Kingdom Children’s Cancer Study Group of pediatric oncologists and by the National Radiological Protection Board. Funding is provided by a consortium of statutory bodies, cancer charities, and industrial sponsors.

² To whom requests for reprints should be addressed, at LRF Centre, Institute of Cancer Research, Chester Beatty Laboratories, 237 Fulham Road, London SW3 6JB, United Kingdom. Phone: 44-171-352-8133; Fax: 44-171-352-3299; E-mail: m.greaves{at}icr.ac.uk

³ See footnote 1 for affiliations.

⁴ The abbreviations used are: ALL, acute lymphoblastic leukemia; AML, acute myeloblastic leukemia; cALL, common ALL; BCR, breakpoint cluster region; NQO1, NAD(P)H:quinone oxidoreductase; nt, nucleotide; OR, odds ratio; CI, confidence interval.

⁵ Freda E. Alexander, unpublished observations.

⁶ Joseph Wiemels and Mel Greaves, unpublished observations.

Received 4/ 9/99. Accepted 6/15/99.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Kersey J. H. Fifty years of studies on the biology and therapy of childhood leukemia. Blood, 90: 4243-4251, 1997.[Free Full Text]
2. Greaves M. A natural history for pediatric acute leukemia. Blood, 82: 1043-1051, 1993.[Free Full Text]
3. Pui C-H., Kane J. R., Crist W. M. Biology and treatment of infant leukemias. Leukemia (Baltimore), 9: 762-769, 1995.[Medline]
4. Greaves M. F. Workshop report. Infant leukemia biology, aetiology, and treatment. Leukemia (Baltimore), 10: 372-377, 1996.[Medline]
5. Raimondi S. C. Current status of cytogenetic research in childhood acute lymphoblastic leukemia. Blood, 81: 2237-2251, 1993.[Free Full Text]
6. Romana S. P., Mauchauffe M., Le Coniat M., Chumakov I., Le Paslier D., Berger R., Bernard O. A. The t(12;21) of acute lymphoblastic leukemia results in a tel-AML1 gene fusion. Blood, 85: 3662-3670, 1995.[Abstract/Free Full Text]
7. Golub T. R., Barker G. F., Bohlander S. K., Hiebert S. W., Ward D. C., Bray Ward P., Morgan E., Raimondi S. C., Rowley J. D., Gilliland D. G. Fusion of the TEL gene on 12p13 to the AML1 gene on 21q22 in acute lymphoblastic leukemia. Proc. Natl. Acad. Sci. USA, 92: 4917-4921, 1995.[Abstract/Free Full Text]
8. Greaves M. F. Aetiology of acute leukaemia. Lancet, 349: 344-349, 1997.[Medline]
9. Gale K. B., Ford A. M., Repp R., Borkhardt A., Keller C., Eden O. B., Greaves M. F. Backtracking leukemia to birth: identification of clonotypic gene fusion sequences in neonatal blood spots. Proc. Natl. Acad. Sci. USA, 94: 13950-13954, 1997.[Abstract/Free Full Text]
10. Ford A. M., Bennett C. A., Price C. M., Bruin M. C., Van Wering E. R., Greaves M. Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia. Proc. Natl. Acad. Sci. USA, 95: 4584-4588, 1998.[Abstract/Free Full Text]
11. Taylor G. M., Birch J. M. The hereditary basis of human leukemia Ed. 6 Henderson E. S. Lister T. A. Greaves M. F. eds. . Leukemia, : 210-245, W B Saunders Philadelphia 1996.
12. Hietanen E., Husgafvel-Pursiainen K., Vainio H. Interaction between dose and susceptibility to environmental cancer: a short review. Environ. Health Perspect., 105: 749-754, 1997.
13. Chen C. L., Liu Q., Pui C-H., Rivera G. K., Sandlund J. T., Ribeiro R., Evans W. E., Relling M. V. Higher frequency of glutathione S-transferase deletions in black children with acute lymphoblastic leukemia. Blood, 89: 1701-1707, 1997.[Abstract/Free Full Text]
14. Krajinovic M., Labuda D., Richer C., Karimi S., Sinnett D. Susceptibility to childhood acute lymphoblastic leukemia: influence of CYP1A1, CYP2D6, GSTM1, and GSTT1 genetic polymorphisms. Blood, 93: 1496-1501, 1999.[Abstract/Free Full Text]
15. Taylor G. M., Robinson M. D., Binchy A., Birch J. M., Stevens R. F., Jones P. M., Carr T., Dearden S., Gokhale D. A. Preliminary evidence of an association between HLA-DPB1*0201 and childhood common acute lymphoblastic leukaemia supports an infectious aetiology. Leukemia (Baltimore), 9: 440-443, 1995.[Medline]
16. Pui C-H., Relling M. V., Rivera G. K., Hancock M. L., Raimondi S. C., Heslop H. E., Santana V. M., Ribeiro R. C., Sandlund J. T., Mahmoud H. H., Evans W. E., Crist W. M., Krance R. A. Epipodophyllotoxin-related acute myeloid leukemia: a study of 35 cases. Leukemia (Baltimore), 9: 1990-1996, 1995.[Medline]
17. Rowley J. D. The critical role of chromosome translocations in human leukemias. Annu. Rev. Genet., 32: 495-519, 1998.[Medline]
18. Gu Y., Alder H., Nakamura T., Schichman S. A., Prasad R., Canaani O., Saito H., Croce C. M., Canaani E. Sequence analysis of the breakpoint cluster region in the ALL-1 gene involved in acute leukemia. Cancer Res., 54: 2326-2330, 1994.[Medline]
19. Broeker P. L., Harden A., Rowley J. D., Zeleznik L. N. The mixed lineage leukemia (MLL) protein involved in 11q23 translocations contains a domain that binds cruciform DNA and scaffold attachment region (SAR) DNA. Curr. Top. Microbiol. Immunol., 211: 259-268, 1996.[Medline]
20. Cimino G., Rapanotti M. C., Biondi A., Elia L., Lo-Coco F., Price C., Rossi V., Rivolta A., Canaani E., Croce C. M., Mandelli F., Greaves M. Infant acute leukemias show the same biased distribution of ALL1 gene breaks as topoisomerase II related secondary acute leukemias. Cancer Res., 57: 2879-2883, 1997.[Abstract/Free Full Text]
21. Felix C. A., Hosler M. R., Slater D. J., Parker R. I., Masterson M., Whitlock J. A., Rebbeck T. R., Nowell P. C., Lange B. J. MLL genomic breakpoint distribution within the breakpoint cluster region in de novo leukemia in children. J. Pediatr. Hematol. Oncol., 20: 299-308, 1998.[Medline]
22. Ford A. M., Ridge S. A., Cabrera M. E., Mahmoud H., Steel C. M., Chan L. C., Greaves M. In utero rearrangements in the trithorax-related oncogene in infant leukaemias. Nature (Lond.), 363: 358-360, 1993.[Medline]
23. Ross J. A., Potter J. D., Robison L. L. Infant leukemia, topoisomerase II inhibitors, and the MLL gene. J. Natl. Cancer Inst., 86: 1678-1680, 1994.[Free Full Text]
24. Ross J. A., Davies S. M., Potter J. D., Robison L. L. Epidemiology of childhood leukemia with a focus on infants. Epidemiol. Rev., 16: 243-272, 1994.[Free Full Text]
25. Ross J. A., Potter J. D., Reaman G. H., Pendergrass T. W., Robison L. L. Maternal exposure to potential inhibitors of DNA topoisomerase II and infant leukemia (United States): a report from the Children’s Cancer Group. Cancer Causes Control, 7: 581-590, 1996.[Medline]
26. Yamashita Y., Kawada S. Z., Nakano H. Induction of mammalian topoisomerase II dependent DNA cleavage by nonintercalative flavonoids, genistein and orobol. Biochem. Pharmacol., 39: 737-744, 1990.[Medline]
27. Powis G. Free radical formation by antitumor quinones. Free Radical Biol. Med., 6: 63-101, 1989.[Medline]
28. Chen H., Eastmond D. A. Topoisomerase inhibition by phenolic metabolites: a potential mechanism for benzene’s clastogenic effects. Carcinogenesis (Lond.), 16: 2301-2307, 1995.[Abstract/Free Full Text]
29. Frydman B., Marton L. J., Sun J. S., Neder K., Witiak D. T., Liu A. A., Wang H. M., Mao Y., Wu H. Y., Sanders M. M. Induction of topoisomerase II-mediated DNA cleavage by ß-lachone and related naphthoquinones. Cancer Res., 57: 620-627, 1997.[Abstract/Free Full Text]
30. Leteurtre F., Kohlhagen G., Pommier Y. Streptonigrin-induced topoisomerase II sites exhibit base preferences in the middle of the enzyme stagger. Biochem. Biophys. Res. Commun., 203: 1259-1267, 1994.[Medline]
31. Ross D. Metabolic basis of benzene toxicity. Eur. J. Haemotol., 57 (Suppl.): 111-118, 1996.[Medline]
32. Traver R. D., Horikoshi T., Danenberg K. D., Stadlbauer T. H. W., Danenberg P. V., Ross D., Gibson N. W. NAD(P)H:Quinone oxidoreductase gene expression in human colon carcinoma cells: characterization of a mutation which modulates DT-diaphorase activity and mitomycin sensitivity. Cancer Res., 52: 797-802, 1992.[Abstract/Free Full Text]
33. Pan S. S., Forrest G. L., Akman S. A., Hu L. T. NAD(P)H:Quinone oxidoreductase expression and mitomycin C resistance developed by human colon cancer HCT 116 cells. Cancer Res., 55: 330-335, 1995.[Abstract/Free Full Text]
34. Gaedigk A., Tyndale R. F., Jurima-Romet M., Sellers E. M., Grant D. M., Leeder J. S. NAD(P)H:Quinone oxidoreductase: polymorphisms and allele frequencies in Caucasian, Chinese, and Canadian Native Indian and Inuit populations. Pharmacogenetics, 8: 305-313, 1998.[Medline]
35. Traver R. D., Siegel D., Beall H. D., Phillips R. M., Gibson N. W., Franklin W. A., Ross D. Characterization of a polymorphism in NAD(P)H:quinone oxidoreductase (DT-diaphorase). Br. J. Cancer, 75: 69-75, 1997.[Medline]
36. Siegel D., McGuinness S. M., Winski S. L., Ross D. Genotype-phenotype relationships in studies of a polymorphism in NAD(P)H:quinone oxidoreductase 1. Pharmacogenetics, 9: 113-121, 1999.[Medline]
37. Kelsey K. T., Ross D., Traver R. D., Christiani D. C., Zuo Z-F., Spitz M., Wang M., Xu X., Lee B-K., Schwartz B. S., Wiencke J. K. Ethnic variation in the prevalence of a common NAD(P)H:quinone oxidoreductase polymorphism and its implications for anticancer chemotherapy. Br. J. Cancer, 76: 852-854, 1997.[Medline]
38. Rosvold E. A., McGlynn K. A., Lustbader E. D., Buetow K. H. Identification of an NAD(P)H:quinone oxidoreductase polymorphism and its association with lung cancer and smoking. Pharmacogenetics, 5: 199-206, 1995.[Medline]
39. Schulz W. A., Krummeck A., Rosinger I., Eickelmann P., Neuhaus C., Ebert T., Schmitz-Drager B. J., Sies H. Increased frequency of a null-allele for NAD(P)H:quinone oxidoreductase in patients with urological malignancies. Pharmacogenetics, 7: 235-239, 1997.[Medline]
40. Thor H., Smith M. T., Hartzell P., Bellomo G., Jewell N. A., Orrenius S. The metabolism of menadione (2-methyl-1,4-naphthoquinone) by isolated hepatocytes. A study on the implication of oxidative stress in intact cells. J. Biol. Chem., 257: 12419-12425, 1982.[Abstract/Free Full Text]
41. Rothman N., Smith M. T., Hayes R. B., Traver R. D., Hoener B., Campleman S., Li G. L., Dosemeci M., Linet M., Zhang L., Xi L., Wacholder S., Lu W., Meyer K. B., Titenko Holland N., Stewart J. T., Yin S., Ross D. Benzene poisoning, a risk factor for hematological malignancy, is associated with the NQO1 609CT mutation and rapid fractional excretion of chlorzoxazone. Cancer Res., 57: 2839-2842, 1997.[Abstract/Free Full Text]
42. Joseph P., Jaiswal A. K. NAD(P)H:Quinone oxidoreductase1 (DT diaphorase) specifically prevents the formation of benzo[a]pyrene quinone-DNA adducts generated by cytochrome P4501A1 and P450 reductase. Proc. Natl. Acad. Sci. USA, 91: 8413-8417, 1994.[Abstract/Free Full Text]
43. Beyer R. E., Segura-Aguilar J., Di Bernardo S., Cavazzoni M., Fato R., Fiorentini D., Galli M. C., Setti M., Landi L., Lenaz G. The role of DT-diaphorase in the maintenance of the reduced antioxidant form of coenzyme Q in membrane systems. Proc. Natl. Acad. Sci. USA, 93: 2528-2532, 1996.[Abstract/Free Full Text]
44. Siegel D., Bolton E. M., Burr J. A., Liebler D. C., Ross D. The reduction of -tocopherolquinone by human NAD(P)H:quinone oxidoreductase (hNQO1): the role of -tocopherolquinone as a cellular antioxidant. Mol. Pharmacol., 52: 300-305, 1997.[Abstract/Free Full Text]
45. Smith M. T., Yager J. W., Steinmetz K. L., Eastmond D. A. Peroxidase-dependent metabolism of benzene’s phenolic metabolites and its potential role in benzene toxicity and carcinogeneity. Environ. Health Perspect., 82: 23-29, 1989.[Medline]
46. Deisinger P. J., Hill T. S., English J. C. Human exposure to naturally occurring hydroquinone. J. Toxicol. Environ. Health, 47: 31-46, 1996.[Medline]
47. Gangousis L. G., Goon D., Zyglewska T., K. K., W., Ross D. Cell-specific metabolism in mouse bone marrow stroma: studies of activation and detoxification of benzene metabolites. Mol. Pharmacol., 42: 1118-1125, 1992.[Abstract]
48. Thomas D. J., Sadler A., Subrahmanyam V. V., Siegel D., Reasor M. J., Wierda D., Ross D. Bone marrow stromal cell bioactivation and detoxification of the benzene metabolite hydroquinone: comparison of macrophages and fibroblastoid cells. Mol. Pharmacol., 37: 255-262, 1990.[Abstract]
49. Wiemels J., Wiencke J. K., Varkonyi A., Smith M. T. Modulation of toxicity and macromolecular binding of benzene metabolites by NAD(P)H:quinone oxidoreductase in transfected HL-60 cells. Chem. Res. Toxicol., 12: 467-475, 1999.[Medline]
50. Larson R. A., Wang Y., Banerjee M., Wiemels J., Hartford C., LeBeau M. M., Smith M. T. Presence of the inactivating polymorphism in the NAD(P)H:quinone oxidoreductase (NQO1) gene in patients with primary and therapy-related myeloid leukemia. Blood, 94: 803-807, 1999.[Abstract/Free Full Text]
51. Parkin D. M., Muir C. S., Whekan S. J., Gao Y. T., Ferlay J., Powell J. Cancer Incidence in Five Continents . IARC Scientific Pub., 120: IARC Lyon, France 1992.
52. Felix C. A., Walker A. H., Lange B. J., Williams T. M., Winick N. J., Cheung N-K. V., Lovett B. D., Nowell P. C., Blair I. A., Rebbeck T. R. Association of CYP3A4 genotype with treatment-related leukemia. Proc. Natl. Acad. Sci. USA, 95: 13176-13181, 1998.[Abstract/Free Full Text]
53. Yang H. Y., Lee Q. P., Rettie A. E., Juchau M. R. Functional cytochrome P4503A isoforms in human embryonic tissues: expression during organogenesis. Mol. Pharmacol., 46: 922-928, 1994.[Abstract]
54. Schuetz J. D., Beach D. L., Guzelian P. S. Selective expression of cytochrome P450 CYP3A mRNAs in embryonic and adult human liver. Pharmacogenetics, 4: 11-20, 1994.[Medline]
55. Shu X-O., Ross J. A., Pendergrass T. W., Reaman G. H., Lampkin B., Robison L. L. Parental alcohol consumption, cigarette smoking, and risk of infant leukemia: a Children’s Cancer Group Study. J. Natl. Cancer Inst., 88: 24-31, 1996.[Abstract/Free Full Text]
56. Metodiewa D., Jaiswal A. K., Cenas N., Dickancaite E., Segura-Aguilar J. Quercetin may act as a cytotoxic prooxidant after its metabolic activation to semiquinone and quinoidal product. Free. Radical Biol. Med., 26: 107-116, 1999.[Medline]
57. Frantz C. E., Chen H., Eastmond D. A. Inhibition of human topoisomerase II in vitro by bioactive benzene metabolites. Environ. Health Perspect., 104: 1319-1323, 1996.
58. Repp R., Borkhardt A., Haupt E., Kreuder J., Brettreich S., Hammermann J., Nishida K., Harbott J., Lampert F. Detection of four different 11q23 chromosomal abnormalities by multiplex-PCR and fluorescence-based automatic DNA-fragment analysis. Leukemia (Baltimore), 9: 210-215, 1995.[Medline]
59. Pui C-H., Frankel L. S., Carroll A. J., Raimondi S. C., Shuster J. J., Head D. R., Crist W. M., Land V. J., Pullen J., Steuber C. P., Behm F. G., Borowitz M. J. Clinical characteristics and treatment outcome of childhood acute lymphoblastic leukemia with the t(4;11)(q21;q23): a collaborative study of 40 cases. Blood, 77: 440-447, 1991.[Abstract/Free Full Text]

This article has been cited by other articles:

				C. Bueno, P. Catalina, G. J. Melen, R. Montes, L. Sanchez, G. Ligero, J. L. Garcia-Perez, and P. Menendez Etoposide induces MLL rearrangements and other chromosomal abnormalities in human embryonic stem cells Carcinogenesis, September 1, 2009; 30(9): 1628 - 1637. [Abstract] [Full Text] [PDF]

				M. Lanciotti and C. Dufour Re: "NQO1 POLYMORPHISMS AND DE NOVO CHILDHOOD LEUKEMIA: A HUGE REVIEW AND META-ANALYSIS" Am. J. Epidemiol., May 15, 2009; 169(10): 1278 - 1279. [Full Text] [PDF]

				A. P. Chokkalingam and P. A. Buffler Genetic susceptibility to childhood leukaemia Radiat Prot Dosimetry, December 1, 2008; 132(2): 119 - 129. [Abstract] [Full Text] [PDF]

				N. Guha, J. S. Chang, A. P. Chokkalingam, J. L. Wiemels, M. T. Smith, and P. A. Buffler NQO1 Polymorphisms and De Novo Childhood Leukemia: A HuGE Review and Meta-Analysis Am. J. Epidemiol., December 1, 2008; 168(11): 1221 - 1232. [Abstract] [Full Text] [PDF]

				K. Iskander, R. J. Barrios, and A. K. Jaiswal Disruption of NAD(P)H:Quinone Oxidoreductase 1 Gene in Mice Leads to Radiation-Induced Myeloproliferative Disease Cancer Res., October 1, 2008; 68(19): 7915 - 7922. [Abstract] [Full Text] [PDF]

				J. A. Ross Environmental and Genetic Susceptibility to MLL-Defined Infant Leukemia J Natl Cancer Inst Monographs, July 1, 2008; 2008(39): 83 - 86. [Abstract] [Full Text] [PDF]

				P. Bolufer, M. Collado, E. Barragan, J. Cervera, M.-J. Calasanz, D. Colomer, J. Roman-Gomez, and M. A. Sanz The potential effect of gender in combination with common genetic polymorphisms of drug-metabolizing enzymes on the risk of developing acute leukemia Haematologica, March 1, 2007; 92(3): 308 - 314. [Abstract] [Full Text] [PDF]

				L. G. Spector, S. M. Davies, L. L. Robison, J. M. Hilden, M. Roesler, and J. A. Ross Birth Characteristics, Maternal Reproductive History, and the Risk of Infant Leukemia: A Report from the Children's Oncology Group Cancer Epidemiol. Biomarkers Prev., January 1, 2007; 16(1): 128 - 134. [Abstract] [Full Text] [PDF]

				A. Begleiter, D. Hewitt, A. W. Maksymiuk, D. A. Ross, and R. P. Bird A NAD(P)H:Quinone Oxidoreductase 1 Polymorphism Is a Risk Factor for Human Colon Cancer Cancer Epidemiol. Biomarkers Prev., December 1, 2006; 15(12): 2422 - 2426. [Abstract] [Full Text] [PDF]

				M. C. Aldrich, L. Zhang, J. L. Wiemels, X. Ma, M. L. Loh, C. Metayer, S. Selvin, J. Feusner, M. T. Smith, and P. A. Buffler Cytogenetics of Hispanic and white children with acute lymphoblastic leukemia in california. Cancer Epidemiol. Biomarkers Prev., March 1, 2006; 15(3): 578 - 581. [Abstract] [Full Text] [PDF]

				T. Umemura, Y. Kuroiwa, Y. Kitamura, Y. Ishii, K. Kanki, Y. Kodama, K. Itoh, M. Yamamoto, A. Nishikawa, and M. Hirose A Crucial Role of Nrf2 in In Vivo Defense against Oxidative Damage by an Environmental Pollutant, Pentachlorophenol Toxicol. Sci., March 1, 2006; 90(1): 111 - 119. [Abstract] [Full Text] [PDF]

				V. M. Arlt, M. Stiborova, C. J. Henderson, M. R. Osborne, C. A. Bieler, E. Frei, V. Martinek, B. Sopko, C. R. Wolf, H. H. Schmeiser, et al. Environmental Pollutant and Potent Mutagen 3-Nitrobenzanthrone Forms DNA Adducts after Reduction by NAD(P)H:Quinone Oxidoreductase and Conjugation by Acetyltransferases and Sulfotransferases in Human Hepatic Cytosols Cancer Res., April 1, 2005; 65(7): 2644 - 2652. [Abstract] [Full Text] [PDF]

				L. G. Spector, Y. Xie, L. L. Robison, N. A. Heerema, J. M. Hilden, B. Lange, C. A. Felix, S. M. Davies, J. Slavin, J. D. Potter, et al. Maternal Diet and Infant Leukemia: The DNA Topoisomerase II Inhibitor Hypothesis: A Report from the Children's Oncology Group Cancer Epidemiol. Biomarkers Prev., March 1, 2005; 14(3): 651 - 655. [Abstract] [Full Text] [PDF]

				J. A. Ross and A. F. Olshan Pediatric Cancer in the United States: The Children's Oncology Group Epidemiology Research Program Cancer Epidemiol. Biomarkers Prev., October 1, 2004; 13(10): 1552 - 1554. [Full Text] [PDF]

				O. Paltiel, S. Harlap, L. Deutsch, A. Knaanie, S. Massalha, E. Tiram, M. Barchana, and Y. Friedlander Birth Weight and Other Risk Factors for Acute Leukemia in the Jerusalem Perinatal Study Cohort Cancer Epidemiol. Biomarkers Prev., June 1, 2004; 13(6): 1057 - 1064. [Abstract] [Full Text] [PDF]

				M. Stiborova, E. Frei, B. Sopko, K. Sopkova, V. Markova, M. Lankova, T. Kumstyrova, M. Wiessler, and H. H. Schmeiser Human cytosolic enzymes involved in the metabolic activation of carcinogenic aristolochic acid: evidence for reductive activation by human NAD(P)H:quinone oxidoreductase Carcinogenesis, October 1, 2003; 24(10): 1695 - 1703. [Abstract] [Full Text] [PDF]

				M. F. Greaves, A. T. Maia, J. L. Wiemels, and A. M. Ford Leukemia in twins: lessons in natural history Blood, October 1, 2003; 102(7): 2321 - 2333. [Abstract] [Full Text] [PDF]

				M. Lehtinen, P. Koskela, H. M. Ogmundsdottir, A. Bloigu, J. Dillner, M. Gudnadottir, T. Hakulinen, A. Kjartansdottir, M. Kvarnung, E. Pukkala, et al. Maternal Herpesvirus Infections and Risk of Acute Lymphoblastic Leukemia in the Offspring Am. J. Epidemiol., August 1, 2003; 158(3): 207 - 213. [Abstract] [Full Text] [PDF]

				J. Zhang, W. A. Schulz, Y. Li, R. Wang, R. Zotz, D. Wen, D. Siegel, D. Ross, H. E. Gabbert, and M. Sarbia Association of NAD(P)H: quinone oxidoreductase 1 (NQO1) C609T polymorphism with esophageal squamous cell carcinoma in a German Caucasian and a northern Chinese population Carcinogenesis, May 1, 2003; 24(5): 905 - 909. [Abstract] [Full Text] [PDF]

				A. Anwar, D. Dehn, D. Siegel, J. K. Kepa, L. J. Tang, J. A. Pietenpol, and D. Ross Interaction of Human NAD(P)H:Quinone Oxidoreductase 1 (NQO1) with the Tumor Suppressor Protein p53 in Cells and Cell-free Systems J. Biol. Chem., March 14, 2003; 278(12): 10368 - 10373. [Abstract] [Full Text] [PDF]

				M. T. Smith, Y. Wang, C. F. Skibola, D. J. Slater, L. L. Nigro, P. C. Nowell, B. J. Lange, and C. A. Felix Low NAD(P)H:quinone oxidoreductase activity is associated with increased risk of leukemia with MLL translocations in infants and children Blood, December 15, 2002; 100(13): 4590 - 4593. [Abstract] [Full Text] [PDF]

				J. L. Wiemels, B. C. Leonard, Y. Wang, M. R. Segal, S. P. Hunger, M. T. Smith, V. Crouse, X. Ma, P. A. Buffler, and S. R. Pine Site-specific translocation and evidence of postnatal origin of the t(1;19) E2A-PBX1 fusion in childhood acute lymphoblastic leukemia PNAS, November 12, 2002; 99(23): 15101 - 15106. [Abstract] [Full Text] [PDF]

				N. Hamajima, T. Saito, K. Matsuo, and K. Tajima Competitive Amplification and Unspecific Amplification in Polymerase Chain Reaction with Confronting Two-Pair Primers J. Mol. Diagn., May 1, 2002; 4(2): 103 - 107. [Abstract] [Full Text] [PDF]

				A. Anwar, D. Siegel, J. K. Kepa, and D. Ross Interaction of the Molecular Chaperone Hsp70 with Human NAD(P)H:Quinone Oxidoreductase 1 J. Biol. Chem., April 12, 2002; 277(16): 14060 - 14067. [Abstract] [Full Text] [PDF]

				L. J. Raffini, D. J. Slater, E. F. Rappaport, L. Lo Nigro, N.-K. V. Cheung, J. A. Biegel, P. C. Nowell, B. J. Lange, and C. A. Felix Panhandle and reverse-panhandle PCR enable cloning of der(11) and der(other) genomic breakpoint junctions of MLL translocations and identify complex translocation of MLL, AF-4, and CDK6 PNAS, April 2, 2002; 99(7): 4568 - 4573. [Abstract] [Full Text] [PDF]

				M. Krajinovic, D. Labuda, G. Mathonnet, M. Labuda, A. Moghrabi, J. Champagne, and D. Sinnett Polymorphisms in Genes Encoding Drugs and Xenobiotic Metabolizing Enzymes, DNA Repair Enzymes, and Response to Treatment of Childhood Acute Lymphoblastic Leukemia Clin. Cancer Res., March 1, 2002; 8(3): 802 - 810. [Abstract] [Full Text] [PDF]

				G. Asher, J. Lotem, R. Kama, L. Sachs, and Y. Shaul NQO1 stabilizes p53 through a distinct pathway PNAS, February 20, 2002; (2002) 52706799. [Abstract] [Full Text] [PDF]

				M. Greaves Science, medicine, and the future: Childhood leukaemia BMJ, February 2, 2002; 324(7332): 283 - 287. [Full Text] [PDF]

				J. G. Blanco, T. Dervieux, M. J. Edick, P. K. Mehta, J. E. Rubnitz, S. Shurtleff, S. C. Raimondi, F. G. Behm, C.-H. Pui, and M. V. Relling Molecular emergence of acute myeloid leukemia during treatment for acute lymphoblastic leukemia PNAS, August 28, 2001; 98(18): 10338 - 10343. [Abstract] [Full Text] [PDF]

				C. Bonnesen, I. M. Eggleston, and J. D. Hayes Dietary Indoles and Isothiocyanates That Are Generated from Cruciferous Vegetables Can Both Stimulate Apoptosis and Confer Protection against DNA Damage in Human Colon Cell Lines Cancer Res., August 1, 2001; 61(16): 6120 - 6130. [Abstract] [Full Text] [PDF]

				F. E. Alexander, S. L. Patheal, A. Biondi, S. Brandalise, M.-E. Cabrera, L. C. Chan, Z. Chen, G. Cimino, J.-C. Cordoba, L.-J. Gu, et al. Transplacental Chemical Exposure and Risk of Infant Leukemia with MLL Gene Fusion Cancer Res., March 1, 2001; 61(6): 2542 - 2546. [Abstract] [Full Text]

				M. T. Smith, Y. Wang, E. Kane, S. Rollinson, J. L. Wiemels, E. Roman, P. Roddam, R. Cartwright, and G. Morgan Low NAD(P)H:quinone oxidoreductase 1 activity is associated with increased risk of acute leukemia in adults Blood, March 1, 2001; 97(5): 1422 - 1426. [Abstract] [Full Text] [PDF]

				D. Siegel, A. Anwar, S. L. Winski, J. K. Kepa, K. L. Zolman, and D. Ross Rapid Polyubiquitination and Proteasomal Degradation of a Mutant Form of NAD(P)H:Quinone Oxidoreductase 1 Mol. Pharmacol., February 1, 2001; 59(2): 263 - 268. [Abstract] [Full Text]

				T. Naoe, K. Takeyama, T. Yokozawa, H. Kiyoi, M. Seto, N. Uike, T. Ino, A. Utsunomiya, A. Maruta, I. Jin-nai, et al. Analysis of Genetic Polymorphism in NQO1, GST-M1, GST-T1, and CYP3A4 in 469 Japanese Patients with Therapy-related Leukemia/Myelodysplastic Syndrome and de novo Acute Myeloid Leukemia Clin. Cancer Res., October 1, 2000; 6(10): 4091 - 4095. [Abstract] [Full Text]

				E. Hellstrom-Lindberg, C. Willman, A. J. Barrett, and Y. Saunthararajah Achievements in Understanding and Treatment of Myelodysplastic Syndromes Hematology, January 1, 2000; 2000(1): 110 - 132. [Abstract] [Full Text] [PDF]

				C. A. Felix, B. J. Lange, and J. M. Chessells Pediatric Acute Lymphoblastic Leukemia: Challenges and Controversies in 2000 Hematology, January 1, 2000; 2000(1): 285 - 302. [Abstract] [Full Text] [PDF]

				G. Asher, J. Lotem, R. Kama, L. Sachs, and Y. Shaul NQO1 stabilizes p53 through a distinct pathway PNAS, March 5, 2002; 99(5): 3099 - 3104. [Abstract] [Full Text] [PDF]

				J. L. Wiemels, R. N. Smith, G. M. Taylor, O. B. Eden, F. E. Alexander, M. F. Greaves, and United Kingdom Childhood Cancer Study Investigator Methylenetetrahydrofolate reductase (MTHFR) polymorphisms and risk of molecularly defined subtypes of childhood acute leukemia PNAS, March 27, 2001; 98(7): 4004 - 4009. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Wiemels, J. L. Articles by Greaves, M. F. Search for Related Content PubMed PubMed Citation Articles by Wiemels, J. L. Articles by Greaves, M. F.