Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 4165-4169, September 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Harris, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Harris, C. C.
[Cancer Research 59, 4165-4169, September 1, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Mutational Analysis of the p63/p73L/p51/p40/CUSP/KET Gene in Human Cancer Cell Lines Using Intronic Primers

Koichi Hagiwara, Mary G. McMenamin, Ko Miura and Curtis C. Harris1

Laboratory of Human Carcinogenesis, National Cancer Institute, NIH, Bethesda, Maryland 20892


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
After the identification of p73, a second homologue of the human p53 tumor suppressor gene has been reported and named p63/p73L/p51/p40/CUSP/KET. We have investigated the hypotheses that: (a) p63 is mutated in diverse types of human cancers; and (b) p63 functions in the same pathway as p53 and p73 in the process of carcinogenesis; therefore, mutations in these three genes would be mutually exclusive. We have analyzed the genomic structure of the p63 gene and have performed mutational analyses on 54 human cell lines using intronic primers flanking each exon. We have confirmed that the human p63 open reading frame encodes the same length of protein as murine p63 that was initially reported to be 39 amino acids longer than human p63. By mutational analysis, we have shown that DLD1 and SKOV3 cells have either heterozygous mutations or polymorphisms in the putative DNA binding domain of p63. In these cell lines, p63 is biallelically expressed. We conclude that mutations in the p63 gene are rare in human cell lines. The fact that DLD1 is abnormal for both p63 and p53 genes suggests that they may not be involved in the same tumor suppressor pathway.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
The existence of a p53 homologue had long been considered unlikely. However, emerging evidence indicates that there is a p53 gene family (1) . After the identification of the p73 gene (2) , the second homologue of p53 was reported from several investigators under the names p73L (3) , p51 (4) , p40 (5) , CUSP,2 KET (6) , and p63 (7) . Although the amino acid sequences and the molecular weights were reported to be different, they have proven to be isotypes derived from a single gene with two promoters, two 3'-end exons, and at least three alternative splicing patterns (summarized in Table 1Citation ). In this report, the name p63 will be used hereafter. p53, p63, and p73 have much sequence homology throughout their length and share domain structures that include a transactivation domain, a DNA binding domain, and an oligomerization domain from the NH2 terminus to the COOH terminus. Because p63 and p73 share more homology than p53, they are considered to be evolutionarily more closely related. A prominent feature of p63 is its lack of the transactivation domain ({Delta}Np63s: shown in Table 1Citation ) in some isotypes transcribed from the second promoter (7) . p63 isotypes having the transcriptional transactivation domain transactivate p53 target sequences such as the p21WAF-1 promoter (4) and the minimal p53 binding sequence, PG-13 (7) . Overexpression of p63 induces apoptosis, although this ability differs among isotypes (4 , 7) . The expression of p63 is tissue specific, and many tissues have dominantly expressed isotypes (3, 4, 5 , 7) . By immunohistochemical analysis, high p63 expression was observed in the basal cells of various epithelial tissues (7) . Mice lacking p63 show developmental defects in organs of ectodermal origin (8 , 9) ; mice lacking p53 have exencephaly and other developmental defects in about 25% of the embryos (10, 11, 12) . This suggests that p63 and p53 activate different target genes. Because p63 has a high homology with p53 and p73, we tested two hypotheses: (a) that p63 is mutated in diverse types of human cancers; and (b) that p63 is functioning in the same pathway as p53 and p73 in the process of carcinogenesis so that mutations would be exclusive among the three genes. Detailed mutational analysis is necessary to investigate these hypotheses. In addition to the six isotypes shown in Table 1Citation , p63 has even more minor isotypes produced by additional alternative splicing patterns (4 , 8 , 13) . This makes mutation detection by RT-PCR-SSCP3 analysis difficult because the differently spliced mRNAs exhibit additional bands on the gel (4) . In this report, we studied the p63 genomic sequence, designed PCR primers in the introns flanking each exon, and then performed the mutation screening using genomic DNA. This enables accurate p63 mutational analysis without being affected by the presence of multiple isotypic mRNAs produced by alternative splicing.


View this table:
[in this window]
[in a new window]

 
Table 1 p63 isotypes

 

    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Isolation of Human p63 Genomic Clones.
To obtain human genomic clones that contain the entire human p63 gene, human genomic libraries made in YAC (CEPH-Gé néthon, distributed by Research Genetics), PAC (Genome Systems), and BAC (Research Genetics) were screened by PCR using primer pairs CF1 (5'-GTCCCAGAGCACACAGACAAATG-3') and CB1 (5'- TTTGTCGCACCATCTTCTGATG-3') or CF51 (5' -AGATTGCCCCTCCTAGTCATTTG-3') and CB68 (5' -CGGTTCATCCCTCCAACACAAC-3'), arbitrarily designed from the p63 coding sequence. The CF1-CB1 pair and the CF51-CB68 pair were later found to amplify exon 1-intron 1-exon 2 and exon 6-intron 6-exon 7 fragments, respectively.

Determination of the Intronic Sequences Flanking Each Exon of the Human p63 Gene.
The intronic sequences that flank each exon of the human p63 gene were determined by the "Long Distance Sequencer" method (14, 15, 16) from YAC clone yhCEPH913D2. In brief, YAC DNA was digested by HincII, RsaI, PvuII, NlaIV, HaeIII, or Cac8I (New England Biolabs) and ligated with a vectorette unit. PCR was then performed using a gene-specific primer and the 224 M13 primer (14) . A total of 69 gene-specific primers were designed from the reported cDNA sequences (3, 4, 5, 6 , 7) to determine all of the exon/intron boundaries. Two to four amplified fragments were selected and directly sequenced on the fluorescent DNA sequencer 370A (Perkin-Elmer) using the -21 M13 primer (Amersham) and the ThermoSequenase dye terminator sequencing kit (Amersham). Our genomic sequences were compared with the available cDNA sequences (3, 4, 5, 6 , 7) , and the exon/intron boundaries were assigned by the GT/AG rule (17) . The nucleotide sequences of the 5' untranslated regions of mRNAs with transactivation domains (TAp63s in Table 1Citation ) or without transactivation domains ({Delta}Np63s in Table 1Citation ) had been reported in GenBank (accession numbers AB016072 and AF091627, respectively). We determined the genomic sequences corresponding to these untranslated regions; then the first translation start codons (ATG) of the open reading frames were assigned. The presence of the upstream in-frame stop codons, which defines the open reading frames of both TAp63s and {Delta}Np63s, was also searched.

Preparation of DNA.
Fifty-four human cell lines were grown in the recommended medium. Cell lines used were as follows: 11 colon cancers (HCT116, DLD1, SW620, HT-29, SW480, COLO320DM, SW48, WiDr, LS174T, RKO, and SW403), 11 non-small cell lung cancers (866 MT, A2182, NCI-H292, Calu6, A427, Calu1, NCI-H358, NCI-H1155, NCI-H157, NCI-H596, and A549), 6 small cell lung cancers (NCI-N417, DMS92, NCI-H446, NCI-H146, NCI-H82, and NCI-H526), 5 breast cancers (MDA-MB-468, T-47D, MCF7, Hs578T, and ZR-75–1), 5 hepatocellular carcinomas (HA22T/VGH, HUH4, HEP3B, HUH7, and SK-HEP-1), 1 hepatoblastoma (HepG2), 1 hepatoblastoma transfected by hepatitis B virus (HB611), 1 SV40 immortalized liver cell line (THLE-5B), 3 pancreatic cancers (MIAPaCa-2, Capan-2, and AsPC-1), 2 oral cancers (FaDu and SSC-4), 2 mesotheliomas (M9K and M24), 1 T-cell lymphoblastic leukemia (CCRF CEM), 1 T-cell lymphoma (H9), 1 ovarian cancer (SKOV3), 1 cervical cancer (CaSki), 1 esophageal cancer (HCE7), and 1 glioblastoma (U118 MG). DNA was extracted using the Nucleon I DNA Extraction kit (Scotlab) and dissolved in 10 mM Tris-HCl (pH 8.0)/1 mM EDTA to a final concentration of 50 ng/µl.

PCR-SSCP Analysis.
Sixteen primer sets were designed from the intronic sequences to amplify all coding exons and the splicing junctions of the p63 gene. The primers and the lengths of the PCR fragments are shown in Table 2Citation . PCR was performed in a 25-µl reaction containing 1x XL buffer II (Perkin-Elmer), 1.1 mM Mg(OAc)2, 200 µM deoxynucleotide triphosphates, 300 nM of each primer, and 2 units of rTth DNA polymerase, XL (Perkin-Elmer) using 40 cycles of 94°C for 40 s, 55°C for 30 s, and 68°C for 2 min. After confirming the amplification by agarose gel electrophoresis, the PCR fragments were labeled by five additional cycles of 94°C for 40 s, 55°C for 30 s, and 68°C for 2 min in a 5-µl labeling solution containing 1x XL buffer II, 1.1 mM Mg(OAc)2, 50 µM deoxynucleotide triphosphates, 300 nM of each primer, 0.2 µCi of [{alpha}-33P]dATP (DuPont), and 0.1 unit of rTth DNA polymerase, XL. For fragments longer than 300 bp, the labeled fragment was then digested by an appropriate restriction enzyme (see Table 2Citation ) to divide it into two shorter fragments of <300 bp. Labeled fragments were denatured by heating at 70°C after adding an equal amount of denaturing solution containing 98% formamide, 0.025% xylene cyanol, and 0.025% bromphenol blue and were then run on a 0.5x MDE gel (FMC Bioproducts) at 20°C. The gel was dried and exposed to Kodak XAR film overnight.


View this table:
[in this window]
[in a new window]

 
Table 2 Intronic primers for p63

 
Direct Sequencing of the PCR Fragments.
The PCR fragments that gave abnormal bandshifts on the MDE gel were subjected to direct sequencing. The DNA from each cell line was amplified by the intronic primers that were tagged by either -21 M13 or -28 M13 reverse sequences (Amersham), purified by the Wizard PCR Prep kit (Promega), and then sequenced using either -21 M13 or -28 M13 reverse DYEnamic ET primers and ThermoSequenase (Amersham) with the fluorescent DNA sequencer 370A (Perkin-Elmer).

RT-PCR using total RNA from DLD1 and SKOV3 cells was done as follows. Total RNA was isolated using the RNA Extraction kit (Stratagene). One µg of total RNA was reverse transcribed using SuperScript II reverse transcriptase (Life Technologies, Inc.) and then amplified by rTth DNA polymerase, XL using -21 M13 or -28 M13 reverse sequence-tagged primer pairs Ex5M13 (TGTAAAACGACGGCCAGTCCATGAGCTGAGCCGTGA-ATTC) and Ex6rev (AGGAAACAGCTATGACCATCAGCACACTCTG-TCTTCCTGTGAT) to check exon 6 and Ex12M13 (TGTAAAACGACGGCCAGTTATCCCACAGATTGCAGCATTGT) and Ex13rev (AGGAAACA-GCTATGACCATATCCATGGAGTAATGCTCAATCTG) to check exon 13. Each primer was designed on different exons to span the intervening intron and thus avoid amplification from contaminating genomic DNA. The nucleotide sequence was determined as described above. The correct exon/exon boundary sequences were confirmed to guarantee the mRNA-derived sequences.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Screening of the human YAC, PAC, and BAC genomic libraries using the p63-specific primer pairs gave five clones shown in Fig. 1ACitation . To find a clone that contained the entire p63 gene, we first screened 270,000 PAC and BAC clones using primer pairs CF1-CB1 and CF51-CB68. Each PAC or BAC clone had an average insert size of 100 kb; thus, 270,000 clones were enough to cover the entire human genome nine times. Even so, we were not able to find a single clone that was positive for both primer pairs, suggesting that p63 is so large that it does not fit into a single PAC or BAC clone. We then screened a human YAC library. Most of these clones have from 500-kb to 2-Mb inserts. We found clones yhCEPH809A5, yhCEPH913D2, and yhCEPH914F12 that contain the entire p63 gene. These three clones are reported to have the STS marker D3S1288 that had been mapped to chromosome 3q27.4 This is consistent with the reported location of the p63 gene at 3q27–29 (3 , 4 , 6 , 7) . The intronic sequences flanking each exon were determined from yhCEPH913D2 by the Long Distance Sequencer method (14) . The sequences were deposited in GenBank under accession numbers AF124528AF124540. PAC clone 71B1 and BAC clone 243L1, obtained using the primer pair CF1-CB1, were also mapped on the p63 genomic structure (Fig. 1A)Citation . Each clone was found to contain only three exons. This suggests that the 5' exons of the p63 gene are widely dispersed in the genome, as is the case for the p53 and p73 genes (18) .



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Analysis of the human p63 gene. A, location of the human genomic clones (YAC, PAC, and BAC). YAC yhCEPH913D2 containing the entire p63 gene was used in this study. The extent of the insert of each clone was determined by mapping individual exons on the clone. The distances between exons have not yet been determined. B, comparison of the NH2 termini of the human and murine p63, human and murine p53, and human p73 proteins, with the human nucleotide sequence shown above. p63 has a longer open reading frame than either p53 or p73 in the NH2 terminus. The translation start codon is located in exon 1. The nucleotide sequence of exon 2 is boxed. Dashes (-) were inserted to maximize the alignment. Left, amino acid numbers for each protein. Amino acids common to human and murine are shown in reverse text, as well as any in p53 or p73 common to conserved amino acids in p63. ***, in-frame upstream stop codon. +++, "ATG" codon initially reported as the translation start codon.

 
For isotypes with the transactivation domain (TAp63s), human p63 was originally reported to be 39 amino acids shorter than the murine p63 in the NH2 terminus (4 , 7) ; however, the recently reported human KET sequence has the same length of the NH2 terminus with murine p63 (6) . By investigating the genomic sequence, we found that the human p63 gene does have the 39-amino acid stretch, which is highly homologous with its murine counterpart. The in-frame stop codon 24 nucleotides upstream from the translation start codon defines this open reading frame. As shown in Fig. 1BCitation , the highly conserved 39-amino acid domain is specific to p63 and not present in either p53 or p73. This suggests that the domain may play an important role in distinguishing specific p63 functions. For the isotypes without transactivation domain ({Delta}Np63s), we also found an in-frame stop codon upstream of the reported start codon (3 , 6 , 7) , which defines the reported open reading frames.

We designed PCR primers in the introns to amplify all of the coding exons individually from the genomic DNA. This enables the mutational analysis to be independent of either the level of expression of each allele or of the presence of the alternative splicing patterns. We searched for p63 mutations in 54 human cell lines that we had previously analyzed for mutations in the p73 and p53 genes (19) . Of these 54 cell lines, only DLD1 and SKOV3 showed single nucleotide changes in one allele each. DLD1 was changed in exon 6, and SKOV3 was changed in exon 13. As shown in Fig. 2Citation , each cell line showed an abnormal band on the SSCP gel in addition to the normal band, indicating that each cell line is heterozygous for the altered exon. Direct sequencing analysis showed that the nucleotide change in exon 6 of DLD1 causes an amino acid change from 279Pro to 279His. The change in exon 13 of SKOV3 causes an amino acid change from 560Ser to 560Ala. Both changes are located in the putative DNA binding domain of the p63 protein. p73 has been reported to be monoallelically expressed in neuroblastoma cells (2) . To determine the pattern of allelic expression in p63, RT-PCR direct sequencing analysis was performed using primers spanning an intron to avoid amplification of contaminating genomic DNA. As shown in Fig. 2CCitation , biallelic expression was found in both DLD1 and SKOV3.



View larger version (59K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. SSCP-sequencing analysis of the p63 gene in DLD1 and SKOV3 cells. A, SSCP analysis in exon 6 and exon 13 of the p63 gene. DLD1(left column, arrow) and SKOV3 (right column, arrow) each show an abnormal band in addition to the common bands, suggesting that both cell lines have an abnormal allele in addition to a normal allele. B, direct genomic sequencing of p63 exon 6 in DLD1 and p63 exon 13 in SKOV3 cells using the PCR product amplified by the intronic primers for each exon. In both cell lines, both normal and abnormal sequences were seen to overlap. The abnormal allele encodes 279His instead of 279Pro in DLD1 and 560Ala instead of 560Ser in SKOV3. C, direct sequencing of the RT-PCR products of p63 exon 6 in DLD1 and p63 exon 13 in SKOV3 cells. PCR primer sets spanning the intervening introns allow only cDNA-derived sequences to be amplified. In both cell lines, both normal and abnormal alleles are biallelically expressed.

 
The nucleotide change in each cell line may be either a rare polymorphism or a somatic mutation. Regardless, these genetic changes are likely to have functional consequences because the amino acid substitution produced by either change would result in a significant change in the three-dimensional structure of the protein. In DLD1, the resulting amino acid substitution of a histidine for a proline, an amino acid that does not have the ability to form hydrogen bonds, would now allow the formation of an {alpha}-helix or a ß-sheet, which was precluded previously. In SKOV3, the loss of a serine would mean the loss of polarity and the loss of a possible phosphorylation site. Amino acid substitutions that result in tertiary structural changes can cause significant functional alterations, even when they are defined as polymorphisms. Taken together, functional analysis of these genetically altered p63 genes and the search for somatic mutations or genetic polymorphisms in primary human cancers are warranted. In p53, several "dominant-negative" mutants with altered DNA binding capacity have been shown to compromise the function of the normal coexisting protein (20) . The nucleotide changes observed in DLD1 and SKOV3 are both located in the putative DNA binding domain of p63 and are both expressed, giving rise to the possibility that they could be dominant-negative mutants that suppress the function of the p63 protein produced from the normal allele.

In the literature, one p63 somatic mutation (187Ala to 187Pro) was found in 66 primary human tumors, and two mutations (184Ser to 184Leu in Ho-1-U-1 cells and 204Gln to 204Leu in SKG-III cells) were observed in 67 human cell lines evaluated by RT-PCR-SSCP analysis. The authors did not define the mutations as homozygous or heterozygous (4) . Another group (13) found no mutations in 45 primary lung cancers but found a heterozygous frameshift mutation in one cell line (EBC1) of the 44 lung cancer cell lines examined. In EBC1, the abnormal allele has an insertion of an adenine after the 233Lys codon. All of these mutations, including ours, are located in the putative DNA binding domain of the p63 protein. We conclude that mutations in p63 are not frequent in the human tumors or in the human cell lines examined. The high percentage of homology among the oligomerization domains of p53, p63, and p73 suggests that they may form heterotetramers. Indeed, it has been reported that p53 and p73 interact in the yeast two-hybrid system (8) . Hypothetically, for the precise regulation of cell proliferation, p53, p63, and p73 may all need to be functionally and physically intact. If this were the case, the mutations would be expected to show a mutually exclusive pattern in cancer cells. In the 54 cell lines that we investigated, 36 of these have mutations in p53, whereas 18 are wild-type. Two (A427 and NCI-H1155) have mutations in p73, whereas 52 are wild-type (19) . A427 has a mutation in p73, but has wild-type p53 and p63 genes. NCI-H1155 and DMS92 have mutations in both p73 and p53 genes but are wild-type for p63. DLD1 has a mutation in p53 and p63 (heterozygous) but is wild-type for p73. SKOV3 has a mutation in p63 (heterozygous) but is wild-type for p73 and p53. Other cell lines have wild-type p73 and p63, with or without p53 mutations. Therefore, mutations in p53 and p63, as well as in p53 and p73, are not mutually exclusive. The relationship between p63 and p73 mutations is difficult to evaluate because of the low mutation rates in both genes.

We detected one single nucleotide polymorphism in intron 10, as shown in Table 3Citation . This polymorphism can be detected by SSCP using primer pair exon 10-F and exon 10-B (Table 2)Citation and is thus useful for detecting a loss of heterozygosity in the p63 locus.


View this table:
[in this window]
[in a new window]

 
Table 3 A polymorphism in intron 10

 
In this study, we analyzed the human p63 gene and found that it has a longer NH2 terminus than was initially reported and that it is highly homologous with murine p63. By SSCP, we studied the mutational status in 54 human cell lines using intronic primers and found possible heterozygous mutations or polymorphisms in two cell lines, DLD1 and SKOV3. RT-PCR analysis revealed that p63 is biallelically expressed in these cell lines. We compared mutations in the p53, p63, and p73 genes in these 54 cell lines to test the hypothesis that these gene products may function in the same tumor suppressor pathway so that the mutations would be mutually exclusive. Our data are not consistent with this hypothesis. We conclude that p63 mutations are uncommon in the human cancers examined and that p53 and p63 are not in the same tumor suppressor pathway. Although p63 or p73 somatic mutations seems to be uncommon in human cancer, transcriptional silencing after DNA methylation would be an alternative mechanism of inactivating these members of the p53 gene family (21 , 22) . Additional studies are required to elucidate the role of the p63 gene in human carcinogenesis.


    ACKNOWLEDGMENTS
 
We thank Dorothea Dudek for editorial assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom requests for reprints should be addressed, at Laboratory of Human Carcinogenesis, National Cancer Institute, Building 37, Room 2C01, 37 Convent Drive MSC 4255, Bethesda, MD 20892-4255. Phone: (301) 496-2048; Fax: (301) 496-0497; Back

2 Genbank accession number AF091627. Back

3 The abbreviations used are: RT-PCR, reverse transcriptase-PCR; SSCP, single strand conformation polymorphism; YAC, yeast artificial chromosome; PAC, P1 artificial chromosome; BAC, bacterial artificial chromosome. Back

4 Internet address: http://kiwi.imgen.bcm.tmc.edu:8088/bio/access_yac.html. Back

Received 5/ 6/99. Accepted 7/19/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Kaelin W. G. J. The emerging p53 family. J. Natl. Cancer Inst., 91: 594-598, 1999.[Abstract/Free Full Text]
  2. Kaghad M., Bonnet H., Yang A., Creancier L., Biscan J-C., Valent A., Minty A., Chalon P., Lelias J-M., Dumont X., Ferrara P., McKeon F., Caput D. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell, 90: 809-819, 1997.[Medline]
  3. Senoo M., Seki N., Ohira M., Sugano S., Watanabe M., Tachibana M., Tanaka T., Shinkai Y., Kato H. A second p53-related protein, p73L, with high homology to p73. Biochem. Biophys. Res. Commun., 248: 603-607, 1998.[Medline]
  4. Osada M., Ohba M., Kawahara C., Ishioka C., Kanamaru R., Katoh I., Ikawa Y., Nimura Y., Nakagawara A., Obinata M., Ikawa S. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med., 4: 839-843, 1998.[Medline]
  5. Trink B., Okami K., Wu L., Sriuranpong J., Jen J., Sidransky D. A new human p53 homologue. Nat. Med., 4: 747-748, 1998.[Medline]
  6. Augustin M., Bamberger C., Paul D., Schmale H. Cloning and chromosomal mapping of the human p53-related KET gene to chromosome 3q27 and its murine homolog Ket to mouse chromosome 16. Mamm. Genome, 9: 899-902, 1998.[Medline]
  7. Yang A., Kaghad M., Wang Y., Gillett E., Fleming M. D., Dötsch V., Andrews N. C., Caput D., McKeon F. p63, a p53 homolog at 3q27-29, encodes multiple products with transactivating, death-inducing, and dominant-negative activities. Mol. Cell, 2: 305-316, 1998.[Medline]
  8. Mills A. A., Zheng B., Wang X-J., Vogel H., Roop D. R., Bradley A. p63 is a p53 homologue required for limb and epidermal morphogenesis. Nature (Lond.), 398: 708-713, 1999.[Medline]
  9. Yang A., Schweitzer R., Sun D., Kaghad M., Walker N., Bronson R. T., Tabin C., Sharpe A., Caput D., Crum C., McKeon F. p63 is essential for regenerative proliferation in limb, craniofacial and epithelial development. Nature (Lond.), 398: 714-718, 1999.[Medline]
  10. Armstrong J. F., Kaufman M. H., Harrison D. J., Clarke A. R. High-frequency developmental abnormalities in p53-deficient mice. Curr. Biol., 5: 931-936, 1995.[Medline]
  11. Ohyama K., Chung C. H., Chen E., Gibson C. W., Misof K., Fratzl P., Shapiro I. M. p53 influences mice skeletal development. J. Craniofacial Genet. Dev. Biol., 17: 161-171, 1997.[Medline]
  12. Choi J., Donehower L. A. p53 in embryonic development: maintaining a fine balance. Cell. Mol. Life Sci., 55: 38-47, 1999.[Medline]
  13. Tani M., Shimizu K., Kawahara C., Kohno T., Ishimoto O., Ikawa S., Yokota J. Mutation and expression of the p51 gene in human lung cancer. Neoplasia, 1: 71-79, 1999.[Medline]
  14. Hagiwara K., Harris C. C. "Long distance sequencer" method: a novel strategy for large DNA sequencing projects. Nucleic Acids Res., 24: 2460-2461, 1996.[Free Full Text]
  15. Takenoshita S., Hagiwara K., Nagashima M., Gemma A., Bennett W. P., Harris C. C. The genomic structure of the gene encoding the human transforming growth factor ß type II receptor (TGF-ß RII). Genomics, 36: 341-344, 1996.[Medline]
  16. Takenoshita S., Mogi A., Nagashima M., Ke Y., Nagamachi Y., Miyazono K., Hagiwara K. Characterization of the human Smad2 gene: its promoter sequence and activity, exon-intron structure, 3' end sequence and expression of the Smad2 mRNA. Genomics, 48: 1-11, 1998.[Medline]
  17. Breathnach R., Benoist C., O’Hara K., Gannon F., Chambon P. Ovalbumin gene: evidence for a leader sequence in mRNA and DNA sequences at the exon-intron boundaries. Proc. Natl. Acad. Sci. USA, 75: 4853-4857, 1978.[Abstract/Free Full Text]
  18. Mai M., Huang H., Reed C., Qian C., Smith J. S., Alderete B., Jenkins R., Smith D. I. Genomic organization and mutation analysis of p73 in oligodendrogliomas with chromosome 1 p-arm deletions. Genomics, 51: 359-363, 1998.[Medline]
  19. Yoshikawa H., Nagashima M., Khan M. A., McMenamin M. G., Hagiwara K., Harris C. C. Mutational analysis of p73 and p53 in human cancer cell lines. Oncogene, 18: 3415-3421, 1999.[Medline]
  20. Chene P. In vitro analysis of the dominant negative effect of p53. J. Mol. Biol., 14: 205-209, 1998.
  21. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  22. Corn P. G., Kuerbitz S. J., van Noesel M. M., Esteller M., Compitello N., Baylin S. B., Herman J. G. Transcriptional silencing of the p73 gene in acute lymphoblastic leukemia and Burkitt’s lymphoma is associated with 5'CpG island methylation. Cancer Res., 59: 3352-3356, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
R. D. Kirschner, K. Sanger, G. A. Muller, and K. Engeland
Transcriptional activation of the tumor suppressor and differentiation gene S100A2 by a novel p63-binding site
Nucleic Acids Res., May 1, 2008; 36(9): 2969 - 2980.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
K.E. King, R.M. Ponnamperuma, M.J. Gerdes, T. Tokino, T. Yamashita, C.C. Baker, and W.C. Weinberg
Unique domain functions of p63 isotypes that differentially regulate distinct aspects of epidermal homeostasis
Carcinogenesis, January 1, 2006; 27(1): 53 - 63.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-i. Kurata, T. Okuyama, M. Osada, T. Watanabe, Y. Tomimori, S. Sato, A. Iwai, T. Tsuji, Y. Ikawa, and I. Katoh
p51/p63 Controls Subunit {alpha}3 of the Major Epidermis Integrin Anchoring the Stem Cells to the Niche
J. Biol. Chem., November 26, 2004; 279(48): 50069 - 50077.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Kim, J. Han, J. Kim, and C. Park
Maspin Expression Is Transactivated by p63 and Is Critical for the Modulation of Lung Cancer Progression
Cancer Res., October 1, 2004; 64(19): 6900 - 6905.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
M. D. Westfall and J. A. Pietenpol
p63: molecular complexity in development and cancer
Carcinogenesis, June 1, 2004; 25(6): 857 - 864.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. P. Hussain, P. Amstad, P. He, A. Robles, S. Lupold, I. Kaneko, M. Ichimiya, S. Sengupta, L. Mechanic, S. Okamura, et al.
p53-Induced Up-Regulation of MnSOD and GPx but not Catalase Increases Oxidative Stress and Apoptosis
Cancer Res., April 1, 2004; 64(7): 2350 - 2356.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
F. Koga, S. Kawakami, Y. Fujii, K. Saito, Y. Ohtsuka, A. Iwai, N. Ando, T. Takizawa, Y. Kageyama, and K. Kihara
Impaired p63 Expression Associates with Poor Prognosis and Uroplakin III Expression in Invasive Urothelial Carcinoma of the Bladder
Clin. Cancer Res., November 15, 2003; 9(15): 5501 - 5507.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. P. Massion, P. M. Taflan, S. M. Jamshedur Rahman, P. Yildiz, Y. Shyr, M. E. Edgerton, M. D. Westfall, J. R. Roberts, J. A. Pietenpol, D. P. Carbone, et al.
Significance of p63 Amplification and Overexpression in Lung Cancer Development and Prognosis
Cancer Res., November 1, 2003; 63(21): 7113 - 7121.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
C. Langner, M. Ratschek, O. Tsybrovskyy, L. Schips, and R. Zigeuner
P63 Immunoreactivity Distinguishes Upper Urinary Tract Transitional-cell Carcinoma and Renal-cell Carcinoma Even in Poorly Differentiated Tumors
J. Histochem. Cytochem., August 1, 2003; 51(8): 1097 - 1099.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Hagiwara, T. Kikuchi, Y. Endo, Huqun, K. Usui, M. Takahashi, N. Shibata, T. Kusakabe, H. Xin, S. Hoshi, et al.
Mouse SWAM1 and SWAM2 Are Antibacterial Proteins Composed of a Single Whey Acidic Protein Motif
J. Immunol., February 15, 2003; 170(4): 1973 - 1979.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
L L Barrow, H van Bokhoven, S Daack-Hirsch, T Andersen, S E C van Beersum, R Gorlin, and J C Murray
Analysis of the p63 gene in classical EEC syndrome, related syndromes, and non-syndromic orofacial clefts
J. Med. Genet., August 1, 2002; 39(8): 559 - 566.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. H. G. Duijf, K. R. J. Vanmolkot, P. Propping, W. Friedl, E. Krieger, F. McKeon, V. Dotsch, H. G. Brunner, and H. van Bokhoven
Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63
Hum. Mol. Genet., April 1, 2002; 11(7): 799 - 804.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Nishi, M. Senoo, K. H. Nishi, B. Murphy, T. Rikiyama, Y. Matsumura, S. Habu, and A. C. Johnson
p53 Homologue p63 Represses Epidermal Growth Factor Receptor Expression
J. Biol. Chem., November 2, 2001; 276(45): 41717 - 41724.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Suliman, O. G. Opitz, A. Avadhani, T. C. Burns, W. El-Deiry, D. T. Wong, and A. K. Rustgi
p63 Expression Is Associated with p53 Loss in Oral-Esophageal Epithelia of p53-deficient Mice
Cancer Res., September 1, 2001; 61(17): 6467 - 6473.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
G. BOUGEARD, J.-M. LIMACHER, C. MARTIN, F. CHARBONNIER, A. KILLIAN, O. DELATTRE, M. LONGY, P. JONVEAUX, J.-P. FRICKER, D. STOPPA-LYONNET, et al.
Detection of 11 germline inactivating TP53 mutations and absence of TP63 and HCHK2 mutations in 17 French families with Li-Fraumeni or Li-Fraumeni-like syndrome
J. Med. Genet., April 1, 2001; 38(4): 253 - 257.
[Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
E. A. Ratovitski, M. Patturajan, K. Hibi, B. Trink, K. Yamaguchi, and D. Sidransky
p53 associates with and targets Delta Np63 into a protein degradation pathway
PNAS, February 13, 2001; 98(4): 1817 - 1822.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. A. McGrath, P. H.G. Duijf, V. Doetsch, A. D. Irvine, R. d. Waal, K. R.J. Vanmolkot, V. Wessagowit, A. Kelly, D. J. Atherton, W. A. D. Griffiths, et al.
Hay-Wells syndrome is caused by heterozygous missense mutations in the SAM domain of p63
Hum. Mol. Genet., February 1, 2001; 10(3): 221 - 229.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B.-J. Park, S.-J. Lee, J. I. Kim, S.-J. Lee, C.-H. Lee, S.-G. Chang, J.-H. Park, and S.-G. Chi
Frequent Alteration of p63 Expression in Human Primary Bladder Carcinomas
Cancer Res., July 1, 2000; 60(13): 3370 - 3374.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Hibi, B. Trink, M. Patturajan, W. H. Westra, O. L. Caballero, D. E. Hill, E. A. Ratovitski, J. Jen, and D. Sidransky
AIS is an oncogene amplified in squamous cell carcinoma
PNAS, May 9, 2000; 97(10): 5462 - 5467.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Kato, A. Shimada, M. Osada, S. Ikawa, M. Obinata, A. Nakagawara, R. Kanamaru, and C. Ishioka
Effects of p51/p63 Missense Mutations on Transcriptional Activities of p53 Downstream Gene Promoters
Cancer Res., December 1, 1999; 59(23): 5908 - 5911.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Harris, C. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hagiwara, K.
Right arrow Articles by Harris, C. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online