| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Laboratory of Human Carcinogenesis, National Cancer Institute, NIH, Bethesda, Maryland 20892
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Np63s: shown in Table 1
|
| Materials and Methods |
|---|
|
|
|---|
Determination of the Intronic Sequences Flanking Each Exon of the Human p63 Gene.
The intronic sequences that flank each exon of the human p63 gene were determined by the "Long Distance Sequencer" method (14, 15, 16)
from YAC clone yhCEPH913D2. In brief, YAC DNA was digested by HincII, RsaI, PvuII, NlaIV, HaeIII, or Cac8I (New England Biolabs) and ligated with a vectorette unit. PCR was then performed using a gene-specific primer and the 224 M13 primer (14)
. A total of 69 gene-specific primers were designed from the reported cDNA sequences (3, 4, 5, 6
, 7)
to determine all of the exon/intron boundaries. Two to four amplified fragments were selected and directly sequenced on the fluorescent DNA sequencer 370A (Perkin-Elmer) using the -21 M13 primer (Amersham) and the ThermoSequenase dye terminator sequencing kit (Amersham). Our genomic sequences were compared with the available cDNA sequences (3, 4, 5, 6
, 7)
, and the exon/intron boundaries were assigned by the GT/AG rule (17)
. The nucleotide sequences of the 5' untranslated regions of mRNAs with transactivation domains (TAp63s in Table 1
) or without transactivation domains (
Np63s in Table 1
) had been reported in GenBank (accession numbers AB016072 and AF091627, respectively). We determined the genomic sequences corresponding to these untranslated regions; then the first translation start codons (ATG) of the open reading frames were assigned. The presence of the upstream in-frame stop codons, which defines the open reading frames of both TAp63s and
Np63s, was also searched.
Preparation of DNA.
Fifty-four human cell lines were grown in the recommended medium. Cell lines used were as follows: 11 colon cancers (HCT116, DLD1, SW620, HT-29, SW480, COLO320DM, SW48, WiDr, LS174T, RKO, and SW403), 11 non-small cell lung cancers (866 MT, A2182, NCI-H292, Calu6, A427, Calu1, NCI-H358, NCI-H1155, NCI-H157, NCI-H596, and A549), 6 small cell lung cancers (NCI-N417, DMS92, NCI-H446, NCI-H146, NCI-H82, and NCI-H526), 5 breast cancers (MDA-MB-468, T-47D, MCF7, Hs578T, and ZR-751), 5 hepatocellular carcinomas (HA22T/VGH, HUH4, HEP3B, HUH7, and SK-HEP-1), 1 hepatoblastoma (HepG2), 1 hepatoblastoma transfected by hepatitis B virus (HB611), 1 SV40 immortalized liver cell line (THLE-5B), 3 pancreatic cancers (MIAPaCa-2, Capan-2, and AsPC-1), 2 oral cancers (FaDu and SSC-4), 2 mesotheliomas (M9K and M24), 1 T-cell lymphoblastic leukemia (CCRF CEM), 1 T-cell lymphoma (H9), 1 ovarian cancer (SKOV3), 1 cervical cancer (CaSki), 1 esophageal cancer (HCE7), and 1 glioblastoma (U118 MG). DNA was extracted using the Nucleon I DNA Extraction kit (Scotlab) and dissolved in 10 mM Tris-HCl (pH 8.0)/1 mM EDTA to a final concentration of 50 ng/µl.
PCR-SSCP Analysis.
Sixteen primer sets were designed from the intronic sequences to amplify all coding exons and the splicing junctions of the p63 gene. The primers and the lengths of the PCR fragments are shown in Table 2
. PCR was performed in a 25-µl reaction containing 1x XL buffer II (Perkin-Elmer), 1.1 mM Mg(OAc)2, 200 µM deoxynucleotide triphosphates, 300 nM of each primer, and 2 units of rTth DNA polymerase, XL (Perkin-Elmer) using 40 cycles of 94°C for 40 s, 55°C for 30 s, and 68°C for 2 min. After confirming the amplification by agarose gel electrophoresis, the PCR fragments were labeled by five additional cycles of 94°C for 40 s, 55°C for 30 s, and 68°C for 2 min in a 5-µl labeling solution containing 1x XL buffer II, 1.1 mM Mg(OAc)2, 50 µM deoxynucleotide triphosphates, 300 nM of each primer, 0.2 µCi of [
-33P]dATP (DuPont), and 0.1 unit of rTth DNA polymerase, XL. For fragments longer than 300 bp, the labeled fragment was then digested by an appropriate restriction enzyme (see Table 2
) to divide it into two shorter fragments of <300 bp. Labeled fragments were denatured by heating at 70°C after adding an equal amount of denaturing solution containing 98% formamide, 0.025% xylene cyanol, and 0.025% bromphenol blue and were then run on a 0.5x MDE gel (FMC Bioproducts) at 20°C. The gel was dried and exposed to Kodak XAR film overnight.
|
RT-PCR using total RNA from DLD1 and SKOV3 cells was done as follows. Total RNA was isolated using the RNA Extraction kit (Stratagene). One µg of total RNA was reverse transcribed using SuperScript II reverse transcriptase (Life Technologies, Inc.) and then amplified by rTth DNA polymerase, XL using -21 M13 or -28 M13 reverse sequence-tagged primer pairs Ex5M13 (TGTAAAACGACGGCCAGTCCATGAGCTGAGCCGTGA-ATTC) and Ex6rev (AGGAAACAGCTATGACCATCAGCACACTCTG-TCTTCCTGTGAT) to check exon 6 and Ex12M13 (TGTAAAACGACGGCCAGTTATCCCACAGATTGCAGCATTGT) and Ex13rev (AGGAAACA-GCTATGACCATATCCATGGAGTAATGCTCAATCTG) to check exon 13. Each primer was designed on different exons to span the intervening intron and thus avoid amplification from contaminating genomic DNA. The nucleotide sequence was determined as described above. The correct exon/exon boundary sequences were confirmed to guarantee the mRNA-derived sequences.
| Results and Discussion |
|---|
|
|
|---|
|
Np63s), we also found an in-frame stop codon upstream of the reported start codon (3
, 6
, 7)
, which defines the reported open reading frames.
We designed PCR primers in the introns to amplify all of the coding exons individually from the genomic DNA. This enables the mutational analysis to be independent of either the level of expression of each allele or of the presence of the alternative splicing patterns. We searched for p63 mutations in 54 human cell lines that we had previously analyzed for mutations in the p73 and p53 genes (19)
. Of these 54 cell lines, only DLD1 and SKOV3 showed single nucleotide changes in one allele each. DLD1 was changed in exon 6, and SKOV3 was changed in exon 13. As shown in Fig. 2
, each cell line showed an abnormal band on the SSCP gel in addition to the normal band, indicating that each cell line is heterozygous for the altered exon. Direct sequencing analysis showed that the nucleotide change in exon 6 of DLD1 causes an amino acid change from 279Pro to 279His. The change in exon 13 of SKOV3 causes an amino acid change from 560Ser to 560Ala. Both changes are located in the putative DNA binding domain of the p63 protein. p73 has been reported to be monoallelically expressed in neuroblastoma cells (2)
. To determine the pattern of allelic expression in p63, RT-PCR direct sequencing analysis was performed using primers spanning an intron to avoid amplification of contaminating genomic DNA. As shown in Fig. 2C
, biallelic expression was found in both DLD1 and SKOV3.
|
-helix or a ß-sheet, which was precluded previously. In SKOV3, the loss of a serine would mean the loss of polarity and the loss of a possible phosphorylation site. Amino acid substitutions that result in tertiary structural changes can cause significant functional alterations, even when they are defined as polymorphisms. Taken together, functional analysis of these genetically altered p63 genes and the search for somatic mutations or genetic polymorphisms in primary human cancers are warranted. In p53, several "dominant-negative" mutants with altered DNA binding capacity have been shown to compromise the function of the normal coexisting protein (20)
. The nucleotide changes observed in DLD1 and SKOV3 are both located in the putative DNA binding domain of p63 and are both expressed, giving rise to the possibility that they could be dominant-negative mutants that suppress the function of the p63 protein produced from the normal allele. In the literature, one p63 somatic mutation (187Ala to 187Pro) was found in 66 primary human tumors, and two mutations (184Ser to 184Leu in Ho-1-U-1 cells and 204Gln to 204Leu in SKG-III cells) were observed in 67 human cell lines evaluated by RT-PCR-SSCP analysis. The authors did not define the mutations as homozygous or heterozygous (4) . Another group (13) found no mutations in 45 primary lung cancers but found a heterozygous frameshift mutation in one cell line (EBC1) of the 44 lung cancer cell lines examined. In EBC1, the abnormal allele has an insertion of an adenine after the 233Lys codon. All of these mutations, including ours, are located in the putative DNA binding domain of the p63 protein. We conclude that mutations in p63 are not frequent in the human tumors or in the human cell lines examined. The high percentage of homology among the oligomerization domains of p53, p63, and p73 suggests that they may form heterotetramers. Indeed, it has been reported that p53 and p73 interact in the yeast two-hybrid system (8) . Hypothetically, for the precise regulation of cell proliferation, p53, p63, and p73 may all need to be functionally and physically intact. If this were the case, the mutations would be expected to show a mutually exclusive pattern in cancer cells. In the 54 cell lines that we investigated, 36 of these have mutations in p53, whereas 18 are wild-type. Two (A427 and NCI-H1155) have mutations in p73, whereas 52 are wild-type (19) . A427 has a mutation in p73, but has wild-type p53 and p63 genes. NCI-H1155 and DMS92 have mutations in both p73 and p53 genes but are wild-type for p63. DLD1 has a mutation in p53 and p63 (heterozygous) but is wild-type for p73. SKOV3 has a mutation in p63 (heterozygous) but is wild-type for p73 and p53. Other cell lines have wild-type p73 and p63, with or without p53 mutations. Therefore, mutations in p53 and p63, as well as in p53 and p73, are not mutually exclusive. The relationship between p63 and p73 mutations is difficult to evaluate because of the low mutation rates in both genes.
We detected one single nucleotide polymorphism in intron 10, as shown in Table 3
. This polymorphism can be detected by SSCP using primer pair exon 10-F and exon 10-B (Table 2)
and is thus useful for detecting a loss of heterozygosity in the p63 locus.
|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Laboratory of Human Carcinogenesis, National Cancer Institute, Building 37, Room 2C01, 37 Convent Drive MSC 4255, Bethesda, MD 20892-4255. Phone: (301) 496-2048; Fax: (301) 496-0497; ![]()
2 Genbank accession number AF091627. ![]()
3 The abbreviations used are: RT-PCR, reverse transcriptase-PCR; SSCP, single strand conformation polymorphism; YAC, yeast artificial chromosome; PAC, P1 artificial chromosome; BAC, bacterial artificial chromosome. ![]()
4 Internet address: http://kiwi.imgen.bcm.tmc.edu:8088/bio/access_yac.html. ![]()
Received 5/ 6/99. Accepted 7/19/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. D. Kirschner, K. Sanger, G. A. Muller, and K. Engeland Transcriptional activation of the tumor suppressor and differentiation gene S100A2 by a novel p63-binding site Nucleic Acids Res., May 1, 2008; 36(9): 2969 - 2980. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.E. King, R.M. Ponnamperuma, M.J. Gerdes, T. Tokino, T. Yamashita, C.C. Baker, and W.C. Weinberg Unique domain functions of p63 isotypes that differentially regulate distinct aspects of epidermal homeostasis Carcinogenesis, January 1, 2006; 27(1): 53 - 63. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-i. Kurata, T. Okuyama, M. Osada, T. Watanabe, Y. Tomimori, S. Sato, A. Iwai, T. Tsuji, Y. Ikawa, and I. Katoh p51/p63 Controls Subunit {alpha}3 of the Major Epidermis Integrin Anchoring the Stem Cells to the Niche J. Biol. Chem., November 26, 2004; 279(48): 50069 - 50077. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kim, J. Han, J. Kim, and C. Park Maspin Expression Is Transactivated by p63 and Is Critical for the Modulation of Lung Cancer Progression Cancer Res., October 1, 2004; 64(19): 6900 - 6905. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Westfall and J. A. Pietenpol p63: molecular complexity in development and cancer Carcinogenesis, June 1, 2004; 25(6): 857 - 864. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Hussain, P. Amstad, P. He, A. Robles, S. Lupold, I. Kaneko, M. Ichimiya, S. Sengupta, L. Mechanic, S. Okamura, et al. p53-Induced Up-Regulation of MnSOD and GPx but not Catalase Increases Oxidative Stress and Apoptosis Cancer Res., April 1, 2004; 64(7): 2350 - 2356. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Koga, S. Kawakami, Y. Fujii, K. Saito, Y. Ohtsuka, A. Iwai, N. Ando, T. Takizawa, Y. Kageyama, and K. Kihara Impaired p63 Expression Associates with Poor Prognosis and Uroplakin III Expression in Invasive Urothelial Carcinoma of the Bladder Clin. Cancer Res., November 15, 2003; 9(15): 5501 - 5507. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. Massion, P. M. Taflan, S. M. Jamshedur Rahman, P. Yildiz, Y. Shyr, M. E. Edgerton, M. D. Westfall, J. R. Roberts, J. A. Pietenpol, D. P. Carbone, et al. Significance of p63 Amplification and Overexpression in Lung Cancer Development and Prognosis Cancer Res., November 1, 2003; 63(21): 7113 - 7121. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Langner, M. Ratschek, O. Tsybrovskyy, L. Schips, and R. Zigeuner P63 Immunoreactivity Distinguishes Upper Urinary Tract Transitional-cell Carcinoma and Renal-cell Carcinoma Even in Poorly Differentiated Tumors J. Histochem. Cytochem., August 1, 2003; 51(8): 1097 - 1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Hagiwara, T. Kikuchi, Y. Endo, Huqun, K. Usui, M. Takahashi, N. Shibata, T. Kusakabe, H. Xin, S. Hoshi, et al. Mouse SWAM1 and SWAM2 Are Antibacterial Proteins Composed of a Single Whey Acidic Protein Motif J. Immunol., February 15, 2003; 170(4): 1973 - 1979. [Abstract] [Full Text] [PDF] |
||||
![]() |
L L Barrow, H van Bokhoven, S Daack-Hirsch, T Andersen, S E C van Beersum, R Gorlin, and J C Murray Analysis of the p63 gene in classical EEC syndrome, related syndromes, and non-syndromic orofacial clefts J. Med. Genet., August 1, 2002; 39(8): 559 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. H. G. Duijf, K. R. J. Vanmolkot, P. Propping, W. Friedl, E. Krieger, F. McKeon, V. Dotsch, H. G. Brunner, and H. van Bokhoven Gain-of-function mutation in ADULT syndrome reveals the presence of a second transactivation domain in p63 Hum. Mol. Genet., April 1, 2002; 11(7): 799 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nishi, M. Senoo, K. H. Nishi, B. Murphy, T. Rikiyama, Y. Matsumura, S. Habu, and A. C. Johnson p53 Homologue p63 Represses Epidermal Growth Factor Receptor Expression J. Biol. Chem., November 2, 2001; 276(45): 41717 - 41724. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Suliman, O. G. Opitz, A. Avadhani, T. C. Burns, W. El-Deiry, D. T. Wong, and A. K. Rustgi p63 Expression Is Associated with p53 Loss in Oral-Esophageal Epithelia of p53-deficient Mice Cancer Res., September 1, 2001; 61(17): 6467 - 6473. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. BOUGEARD, J.-M. LIMACHER, C. MARTIN, F. CHARBONNIER, A. KILLIAN, O. DELATTRE, M. LONGY, P. JONVEAUX, J.-P. FRICKER, D. STOPPA-LYONNET, et al. Detection of 11 germline inactivating TP53 mutations and absence of TP63 and HCHK2 mutations in 17 French families with Li-Fraumeni or Li-Fraumeni-like syndrome J. Med. Genet., April 1, 2001; 38(4): 253 - 257. [Full Text] |
||||
![]() |
E. A. Ratovitski, M. Patturajan, K. Hibi, B. Trink, K. Yamaguchi, and D. Sidransky p53 associates with and targets Delta Np63 into a protein degradation pathway PNAS, February 13, 2001; 98(4): 1817 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. McGrath, P. H.G. Duijf, V. Doetsch, A. D. Irvine, R. d. Waal, K. R.J. Vanmolkot, V. Wessagowit, A. Kelly, D. J. Atherton, W. A. D. Griffiths, et al. Hay-Wells syndrome is caused by heterozygous missense mutations in the SAM domain of p63 Hum. Mol. Genet., February 1, 2001; 10(3): 221 - 229. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-J. Park, S.-J. Lee, J. I. Kim, S.-J. Lee, C.-H. Lee, S.-G. Chang, J.-H. Park, and S.-G. Chi Frequent Alteration of p63 Expression in Human Primary Bladder Carcinomas Cancer Res., July 1, 2000; 60(13): 3370 - 3374. [Abstract] [Full Text] |
||||
![]() |
K. Hibi, B. Trink, M. Patturajan, W. H. Westra, O. L. Caballero, D. E. Hill, E. A. Ratovitski, J. Jen, and D. Sidransky AIS is an oncogene amplified in squamous cell carcinoma PNAS, May 9, 2000; 97(10): 5462 - 5467. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kato, A. Shimada, M. Osada, S. Ikawa, M. Obinata, A. Nakagawara, R. Kanamaru, and C. Ishioka Effects of p51/p63 Missense Mutations on Transcriptional Activities of p53 Downstream Gene Promoters Cancer Res., December 1, 1999; 59(23): 5908 - 5911. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |