Cancer Research AACR Membership Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online
[Cancer Research 59, 4219-4221, September 1, 1999]
© 1999 American Association for Cancer Research
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bakkenist, C. J.
Right arrow Articles by McGee, J. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bakkenist, C. J.
Right arrow Articles by McGee, J. O.
[Cancer Research 59, 4219-4221, September 1, 1999]
© 1999 American Association for Cancer Research

Advances in Brief

Heat Shock Cognate 70 Mutations in Sporadic Breast Carcinoma1

Christopher J. Bakkenist2,,3, John Koreth2, Cory S. M. Williams, Nicholas C. A. Hunt and James O. McGee

University of Oxford, Nuffield Department of Pathology and Bacteriology, John Radcliffe Hospital, Oxford OX3 9DU, United Kingdom


   ABSTRACT
Top
 ABSTRACT
Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Heat Shock Cognate 70 (HSC70) is a constitutively expressed molecular chaperone, functions of which regulate the structure, subcellular localization, and turnover of cell proteins. It is also a component of the centrosome facilitating rearrangements during mitotic/meiotic spindle formation and cytoplasmic microtubule organization. We localized HSC70 to 11q23.3, a region deleted in 40% of sporadic breast and other cancers. Sequencing demonstrated mutation in the NH2-terminal ATPase domain of HSC70 in 2 of 15 sporadic breast carcinomas examined. In both cases, mutation was coincident with allelic imbalance, suggesting that HSC70 is a target of somatic mutation and deletion in a fraction of breast carcinomas.


   Introduction
Top
 ABSTRACT
 Introduction
Materials and Methods
 Results
 Discussion
 REFERENCES
 
HSC704 is a constitutive member of the highly conserved heat shock protein 70 family, which generally comprises ~1% of total cellular protein with possibly higher levels in transformed cells (1) . HSC70 has several known functions: it is the uncoating ATPase for the disassembly of clathrin-coated vesicles (involved in intracellular receptor mediated transport; Ref. 2 ); it is a molecular chaperone facilitating correct folding of nascent polypeptides (3) ; it enables protein translocation through the endoplasmic reticulum (Ref. 4 ; steroid hormone activation), nuclear membrane (5) , and into the 26S proteasome (Ref. 6 ; ubiquitin-mediated degradation); and it is an essential component of the centrosome, facilitating rearrangements during mitotic/meiotic spindle formation and cytoplasmic microtubule organization (7) . HSC70 has previously been located to chromosome 11q23.3–q25 (8) . AI has been demonstrated at 11q22–q23.1, 11q23.3, and 11q25-qter in sporadic breast carcinomas at rates of 60% (9 , 10) , 40% (11 , 12) , and 50% (10) , respectively. Although somatic mutations in ATM (13) and PPP2R1B (14) at 11q22–q23.1 have been identified in T-prolymphocytic leukemia (15) or malignant lung and colorectal carcinoma cell lines, respectively, genes mutated at 11q23.3 and 11q25-qter in malignancy have remained anonymous. We fine mapped human HSC70 and investigated its structure in sporadic breast carcinomas.


   Materials and Methods
Top
 ABSTRACT
 Introduction
 Materials and Methods
Results
 Discussion
 REFERENCES
 
Library Hybridization.
A contiguous chromosome 11q22-qter YAC library mapped to 11q by STS content5 was plated in an ordered array. Filters were hybridized sequentially to [{gamma} -32P]ATP end-labeled oligonucleotides (intron 2, ctgaagagctatgaaattgaaa; and intron2/exon3, tttacagatgccaaacgtctgatt) at 42°C overnight in 6X SSC, 5X Denhardt’s solution, 0.1% SDS, and 100 µg of denatured salmon sperm DNA, washed at 50°C in 2x SSC, 1% SDS twice for 20 min, and visualized on XOMAT-AR film (Kodak) overnight at -70°C.

PCR and Sequencing.
Fifteen fresh cases of paired sporadic breast carcinoma and adjacent normal breast tissues were available. HSC70 exons were amplified from 50 ng of genomic DNA using 10 pmol of each primer and 200 µ M deoxynucleotide triphosphates, 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl (pH 8.0), 0.1% Triton X-100, and 0.05 unit SuperTaq (HT Biotechnology, Cambridge, United Kingdom). Primers with intron sequences were used because of the presence of at least two processed HSC70 pseudogenes in the human genome: intron 1 to intron 3 (5'-3') tggttaagtgttctgttaag to gaatgcaccccatactggcc; intron 3 to intron 5, atagttaccaatctgtggtct to tgggcctgcctgcctttaggg; intron 5 to intron 8, aacaggagctatgtactgggt to catcattgtgaccctacactg; and intron 8 to 3' untranslated, aaagaacttgcagtaattcct to cattgcattttccacttaca. PCR products were resolved on 1.5% agarose gels, and DNA fragments were excised and purified (QIA Quick kit; Qiagen). The cycle was sequenced using Amplicycle (Perkin-Elmer). Sequencing reactions were resolved on 6% denaturing urea-polyacrylamide gels and visualized on XOMAT-AR film. Mutations were confirmed by sequencing DNA fragments in both directions in duplicate from two independent PCR reactions.

Microsatellite Analysis.
DNA samples were analyzed for polymorphic microsatellite repeats at two loci on chromosome 11q23.3 around HSC70 (D11S1336 and D11S1284). One of each set of primers was end-labeled with [{gamma}-32P]ATP. PCR products were resolved on 6% denaturing urea-polyacrylamide gels and autoradiographed at -75°C using intensifying screens and XOMAT-AR film preflashed to an absorbance of 0.15 (540 nm) for response linearity. Informative autoradiographs were assessed for AI by software densitometric analysis (Quantiscan; Biosoft Ferguson, MO) using the allelic ratio method, with a cutoff ratio of 2.


   Results
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
Discussion
 REFERENCES
 
HSC70 was localized to three 11q23.3 YACs (y667F08, y881F03, and y874D02) between D11S1336 and D11S1284 (11.7 cR; ~500 kb; Fig. 1ACitation ). Confirmation of this map position was obtained by PCR and Southern blotting (data not shown). No genomic abnormalities in HSC70 were detected in 15 samples of breast carcinoma and paired normal DNA by Southern blotting (data not shown). We therefore used PCR to amplify and sequence HSC70 exons. In total, two sequence changes were detected in the 15 breast carcinomas. Both were single bp transitions (TA=CG at 1608 and TA=CG at 1680) in exon 3, and all resulted in missense mutations in the HSC70 protein at codons 83 (GTC=Val to GCC=Ala) and 107 (TAC=Tyr to CAC=His; Figs. 1BCitation and 2ACitation ).



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 1. A, ideogram of chromosome 11q. Microsatellites in the 11q22-qter region are shown (not to scale). Microsatellite loci along the YACs to which HSC70 was localized are shown in greater detail. The position of HSC70 is indicated. B, HSC70 gene structure. Solid horizontal boxes, coding exons. The sequence of the gene from nucleotide 1532 in intron 2 to nucleotide 1708 in the second coding exon is shown. The point mutations in cases 1 and 4 are marked above the sequence, and the nucleotides in the polymorphism are indicated as XX.

 


View larger version (54K):
[in this window]
[in a new window]
[Download PPT slide]
  		Fig. 2. A, sequence analysis of six breast carcinoma samples. The reactions run through the second coding exon initiated from a sequence within intron 3 and are loaded ACGT. The point mutations are indicated. B, microsatellite analysis of four paired normal (N) and breast carcinoma (T) DNA samples. The four cases shown are polymorphic for D11S1336. AIs in cases 1 and 4 are indicated.

 
Microsatellite PCR at the HSC70 locus demonstrated AI in 5 of the 13 breast carcinomas with either one or both markers. Both of the cases in which mutation had been detected showed AI at D11S1336 (Fig. 2B)Citation . Two patients were not polymorphic for either microsatellite.

A 2-bp polymorphism was identified in intron 2 adjacent to the splice acceptor consensus sequence. Of the 15 paired normal and breast carcinoma cases, 3 were heterozygous and 3 were homozygous for a 2-bp deletion of GT at 1542, 1543. Of the two cases in which HSC70 point mutations were identified, both were homozygous for the deletion.

Three homozygous deviations from the deposited sequence were detected. These are CC rather than GG at 1447, 1448 in intron 2, C rather than T at 3448 in intron 6, and CC rather than AA at 3795, 3796 in intron 7. The deviation in intron 6 is within the sequence of a U14 small nucleolar RNA required for the processing of eukaryotic ribosomal RNA precursors. The change to C gives the human and mouse U14 small nucleolar RNAs identity at this nucleotide (16) .

hsc70 sequences have been derived from malignant cell line sourced cDNA clones of mouse (F9 teratocarcinoma; Ref. 17 ) and rat (PC12 pheochromocytoma; Ref. 18 ). These hsc70 sequences are reported to deviate from hsc70 sequences subsequently derived from nonmalignant tissue of the mouse (19) and rat (20) by a single amino acid. We reasoned that hsc70 could be mutated in the malignant in the cell lines. Analysis of published hsc70 nucleic acid sequences failed to identify codon changes resulting in amino acid deviations between the two genes in each species. Rather, a translation error at codon 97 in exon 3 was suspected in the F9 sequence (GAT=Asn rather than GAT=Asp). We have subsequently sequenced hsc70 from the F9 cell line (genomic DNA and cDNA) and parental 129SvJ6 mouse (genomic DNA) and have confirmed the reported hsc70 sequence (19) . No amino acid deviations have been identified between the two rat sequences.


   Discussion
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
REFERENCES
 
We have localized HSC70 between D11S1336 and D11S1284 at 11q23.3, a deleted region previously delineated from that at 11q22–23.1 in sporadic breast carcinoma (11 , 12) . HSC70 is <5 Mb distal to D11S528, with which AI has been reported in 40% of breast carcinomas (12) . Our demonstration of AI in 5 of 13 breast carcinomas at D11S1336 and/or D11S1284 corroborates this figure. Sequencing identified mutation in HSC70 in 2 of 15 breast carcinomas, and these mutations were coincident with AI at D11S1336. We therefore propose that HSC70 mutation and deletion are associated with a fraction of sporadic breast carcinomas. Allele loss at 11q23.3 has been identified in a wide variety of solid tumors other than breast (cervical, ovarian, gastric, lung, bladder, prostate, nasopharyngeal, squamous and colorectal cancers, malignant melanoma, and intracerebral neoplasms) at frequencies ranging from 40 to 75% (reviewed in Ref. 21 ). HSC70 mutation may, therefore, be more generally associated with malignancy.

Of the 15 patients, 3 were homozygous for a 2-bp germ-line deletion adjacent to the splice acceptor sequence in intron 2. This included both the breast carcinomas with mutated HSC70 which, although the number of patients is very small, suggests that there may be an association between the polymorphism and somatic mutation of HSC70. The polymorphism is noteworthy because of the remarkably repetitive nature of the eight coding exons and seven intervening introns in HSC70 (Fig. 1B)Citation , the only heat shock protein 70 family member containing introns. Five of the exons in the human gene encode peptides between 61 and 69 amino acids (including 2 and 3), whereas the remaining three encode peptides of 51, 78, and 185 amino acids (22) . Similarly, three of the intervening introns are 322–331 bp (including the first and second), whereas the others are 83, 211, 228, and 249 bp. The conservation of this repetitive gene structure suggests that it is functionally important and that the germ-line deletion, adjacent to the splice acceptor consensus sequence, may itself be corrupting. Alternatively, the polymorphism may be linked to some other sequence that confers some susceptibility to somatic mutation in HSC70. It is, therefore, interesting that the microsatellite distal to the gene was not polymorphic in the three patients homozygous for the 2-bp deletion, whereas that proximal was polymorphic in both of the patients with mutated HSC70.

The two mutations detected in HSC70 were missense mutations in the Mr 44,000 NH2-terminal ATPase domain of HSC70 which, regulated by two cofactors, controls substrate binding by the COOH-terminal of the protein (23) . The mutations identified may affect the binding and hydrolysis of ATP and/or the binding of the two cofactors, p48 (the human Hip homologue) and BAG-1. Hip interacts with the ATPase domain of HSC70, following an initial activation by HSP40 stabilizing the ADP-bound form of HSC70, and may prolong its interaction with substrate proteins (24) . Hip has also been found to assemble with the progesterone receptor and as part of an HSC70/HSP90 chaperone complex (Ref. 24 and references therein). Because steroid hormone receptors require sequential interaction with HSC70 and HSP90 to attain their high affinity conformation for hormone binding, Hip-mediated regulation of HSC70 may be required for the assembly of HSP90/steroid hormone receptor complexes. BAG-1, in contrast to Hip, promotes the dissociation of ADP from HSC70, thereby stimulating its ATPase activity (25) . Overexpression of BAG-1 prolongs the survival of fibroblast cells challenged by apoptotic stimuli (25) . BAG-1 also binds Bcl-2, increasing the antiapoptotic activity of Bcl-2, interacts with hepatocyte and platelet-derived growth factors, enhancing their antiapoptotic activity, and binds and activates the Raf-1 protein kinase (Ref. 25 and references therein). Thus, mediated through its interactions with BAG-1 and Hip, HSC70 is involved in multiple signaling pathways. Murine hsc70 has also been shown to be developmentally regulated in the mammary gland (19) , and centrosome hypertrophy has been identified in a fraction of human breast tumors (HSC70 is a known component of the centrosome; Ref. 26 ). Taken together, these findings and the homeostatic and chaperone functions of HSC70 regulating the structure, subcellular localization, and turnover of cell proteins make HSC70 an attractive candidate for a gene associated with breast carcinoma. Here we have identified HSC70 point mutations with coincident AI in 2 of 15 sporadic breast carcinomas. We therefore propose HSC70 to be a target of somatic mutation and deletion in a fraction of human breast carcinomas.


   ACKNOWLEDGMENTS
 
We thank Michael R. James for the 11q YAC contig.


   FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 C. J. B. was supported by a Cancer Research Campaign Grant (SP1888/1403). J. K. and C. S. C. W. were supported by the Rhodes Trust. Back

2 These authors contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at Hematology/Oncology, St. Jude Children’s Research Hospital, 332 North Lauderdale Street, Memphis, TN 38105-2794. E-mail: Christopher.Bakkenist{at}stjude.org Back

4 The abbreviations used are: HSC70, heat shock cognate 70; YAC, yeast artificial chromosome; AI, allelic imbalance. Back

5 M. R. James, unpublished data. Back

Received 3/26/99. Accepted 7/15/99.


   REFERENCES
Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Pinhasi K. O., Michalovitz D., Ben Z. A., Oren M. Specific interaction between the p53 cellular tumour antigen and major heat shock proteins. Nature (Lond.), 320: 182-184, 1986.[Medline]
  2. Chappell T. G., Welch W. J., Schlossman D. M., Palter K. B., Schlesinger M. J., Rothman J. E. Uncoating ATPase is a member of the 70 kilodalton family of stress proteins. Cell, 45: 3-13, 1986.[Medline]
  3. Anderson R. L., Fong K. J., Gabriele T., Lavagnini P., Hahn G. M., Evans J. W., Waldren C. A., Stamato T. D., Giaccia A. J. Loss of the intrinsic heat resistance of human cells and changes in Mr 70,000 heat shock protein expression in human x hamster hybrids. Cancer Res., 51: 2636-2641, 1991.[Abstract/Free Full Text]
  4. Brodsky J. L., Schekman R. The biology of heat shock proteins and molecular chaperones Morimoto R. I. Tissieres A. Georgopoulos C. eds. . , : 85-110, Cold Spring Harbor Laboratory Plainview, NY 1994.
  5. Imamoto N., Matsuoka Y., Kurihara T., Kohno K., Miyagi M., Sakiyama F., Okada Y., Tsunasawa S., Yoneda . Antibodies against 70-kD heat shock cognate protein inhibit mediated nuclear import of karyophilic proteins. J. Cell Biol., 119: 1047-1061, 1992.[Abstract/Free Full Text]
  6. Bercovich B., Stancovski I., Mayer A., Blumenfeld N., Laszlo A., Schwartz A. L., Ciechanover A. Ubiquitin-dependent degradation of certain protein substrates in vitro requires the molecular chaperone Hsc70. J. Biol. Chem., 272: 9002-9010, 1997.[Abstract/Free Full Text]
  7. Brown C. R., Doxsey S. J., Hong B. L., Martin R. L., Welch W. J. Molecular chaperones and the centrosome. A role for HSP 73 in centrosomal repair following heat shock treatment. J. Biol. Chem., 271: 824-832, 1996.[Abstract/Free Full Text]
  8. Tavaria M., Gabriele T., Anderson R. L., Mirault M. E., Baker E., Sutherland G., Kola I. Localization of the gene encoding the human heat shock cognate protein, HSP73, to chromosome 11. Genomics, 29: 266-268, 1995.[Medline]
  9. Hampton G. M., Mannermaa A., Winquist R., Alavaikko M., Blanco G., Taskinen P. J., Kiviniemi H., Newsham I., Cavenee W. K., Evans G. A. Loss of heterozygosity in sporadic human breast carcinoma: a common region between 11q22 and 11q23.3. Cancer Res., 54: 4586-4589, 1994.[Abstract/Free Full Text]
  10. Koreth J., Bakkenist C. J., McGee J. O. Allelic deletions at chromosome 11q22–q23.1 and 11q25-qter are frequent in sporadic breast but not colorectal cancer. Oncogene, 14: 431-437, 1997.[Medline]
  11. Carter S. L., Negrini M., Baffa R., Gillum D. R., Rosenberg A. L., Schwartz G. F., Croce C. M. Loss of heterozygosity at 11q22–q23 in breast cancer. Cancer Res., 54: 6270-6274, 1994.[Abstract/Free Full Text]
  12. Negrini M., Rasio D., Hampton G. M., Sabbioni S., Rattan S., Carter S. L., Rosenberg A. L., Schwartz G. F., Shiloh Y., Cavenee W. K., Croce C. M. Definition and refinement of chromosome 11 regions of loss of heterozygosity in breast cancer: identification of a new region at 11q23.3. Cancer Res., 55: 3003-3007, 1995.[Abstract/Free Full Text]
  13. Savitsky K., Bar Shira A., Gilad S., Rotman G., Ziv Y., Vanagaite L., Tagle D. A., Smith S., Uziel T., Sfez S., Ashkenazi M., Pecker I., Frydman M., Harnik R., Patanjali S. R., Simmons A., Clines G. A., Sartiel A., Gatti R. A., Chessa L., Sanal O., Lavin M. F., Jaspers N. G. I., Taylor A. M. R., Arlett C. F., Miki T., Weissman S. M., Lovett M., Collins F. S., Shiloh Y. A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science (Washington DC), 268: 1749-1753, 1995.[Abstract/Free Full Text]
  14. Wang S. S., Esplin E. D., Li J. L., Huang L., Gazdar A., Minna J., Evans G. A. Alterations of the PPP2R1B gene in human lung and colon cancer. Science (Washington DC), 282: 284-286, 1998.[Abstract/Free Full Text]
  15. Stilgenbauer S., Schaffner C., Litters A., Liebish P., Gilad S., Bar-Shira A., James M. R., Lichter P., Dohner H. Biallelic mutations in the ATM gene in T-prolymphocytic leukemia. Nat. Med., 10: 1155-1159, 1997.
  16. Barbhaiya H., Leverette R. D., Liu J., Maxwell E. S. Processing of U14 small nucleolar RNA from three different introns of the mouse 70-kDa cognate heat shock protein premessenger RNA. Eur. J. Biochem., 226: 765-771, 1995.[Medline]
  17. Giebel L. B., Dworniczak B. P., Bautz E. K. Developmental regulation of a constitutively expressed mouse mRNA encoding a 72-kDa heat shock- like protein. Dev. Biol., 125: 200-207, 1988.[Medline]
  18. O’Malley K., Mauron A., Barchas J. D., Kedes L. Constitutively expressed rat mRNA encoding a 70-kilodalton heat-shock-like protein. Mol. Cell. Biol., 5: 3476-3483, 1985.[Abstract/Free Full Text]
  19. Soulier S., Vilotte J. L., L’Huillier P. J., Mercier J. C. Developmental regulation of murine integrin ß1 subunit- and Hsc73-encoding genes in mammary gland: sequence of a new mouse Hsc73 cDNA. Gene (Amst.), 172: 285-289, 1996.[Medline]
  20. Sorger P. K., Pelham H. R. Cloning and expression of a gene encoding hsc73, the major hsp70-like protein in unstressed rat cells. EMBO J., 6: 993-998, 1987.[Medline]
  21. Koreth J., Bakkenist C. J., McGee J. O. D. Chromosomes 11q and cancer: a review. J. Pathol., 187: 28-38, 1999.[Medline]
  22. Dworniczak B., Mirault M. E. Structure and expression of a gene coding for a 71kDa heat shock "cognate" gene. Nucleic Acids Res., 15: 5181-5197, 1987.[Abstract/Free Full Text]
  23. Chappell T. G., Konforti B. B, Schmid S. L., Rothman J. E. The ATPase corer of clathrin uncoating protein. J. Biol. Chem., 262: 746-751, 1987.[Abstract/Free Full Text]
  24. Höhfeld J., Minami Y., Hartl F-U. Hip, a novel cochaperone involved in the eukaryotic Hsc70/Hsp40 reaction cycle. Cell, 83: 589-598, 1995.[Medline]
  25. Höhfeld J., Jentsch S. GrpE-like regulation of the Hsc70 chaperone by anti-apoptotic protein BAG-1. EMBO J., 16: 6209-6216, 1997.[Medline]
  26. Lingle W. L., Lutz W. H., Ingle J. N., Maihle N. J., Salisbury J. L. Centrosome hypertrophy in human breast tumors: implications for genomic stability and cell polarity. Proc. Natl. Acad. Sci. USA, 95: 2950-2955, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Cancer Res.Home page
M. Iwasaki, S. Homma, A. Hishiya, S. J. Dolezal, J. C. Reed, and S. Takayama
BAG3 Regulates Motility and Adhesion of Epithelial Cancer Cells
Cancer Res., November 1, 2007; 67(21): 10252 - 10259.
[Abstract] [Full Text] [PDF]

Home page
 Microbiol. Mol. Biol. Rev.Home page
C. S. Sullivan and J. M. Pipas
T Antigens of Simian Virus 40: Molecular Chaperones for Viral Replication and Tumorigenesis
Microbiol. Mol. Biol. Rev., June 1, 2002; 66(2): 179 - 202.
[Abstract] [Full Text] [PDF]

Home page
 J. Med. Genet.Home page
M M de Jong, I M Nolte, G J te Meerman, W T A van der Graaf, J C Oosterwijk, J H Kleibeuker, M Schaapveld, and E G E de Vries
Genes other than BRCA1 and BRCA2 involved in breast cancer susceptibility
J. Med. Genet., April 1, 2002; 39(4): 225 - 242.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bakkenist, C. J.
Right arrow Articles by McGee, J. O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bakkenist, C. J.
Right arrow Articles by McGee, J. O.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online