Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 4266-4270, September 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sowa, Y.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sowa, Y.
Right arrow Articles by Sakai, T.
[Cancer Research 59, 4266-4270, September 1, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Sp3, but not Sp1, Mediates the Transcriptional Activation of the p21/WAF1/Cip1 Gene Promoter by Histone Deacetylase Inhibitor1

Yoshihiro Sowa2, Tetsuro Orita, Sachie Minamikawa-Hiranabe, Takakazu Mizuno, Hitoshi Nomura and Toshiyuki Sakai

Department of Preventive Medicine, Kyoto Prefectural University of Medicine, Kyoto 602-8566 [Y. S., T. S.]; and Chugai Research Institute for Molecular Medicine, Inc., Ibaraki 300-4101 [T. O., S. M-H., T. M., H. N.], Japan


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We previously reported that both sodium butyrate and trichostatin A (TSA), both of which are known as inhibitors of histone deacetylase, arrest human tumor cells at G1 and G2-M and activate the cyclin-dependent kinase inhibitor, the p21/WAF1/Cip1 gene promoter, through the Sp1 sites. In this study, we identified Sp1 and Sp3 as major factors binding to the Sp1 sites of the p21/WAF1/Cip1 promoter in MG63 cells through electrophoretic mobility shift assays and showed that TSA treatment did not change their binding activities. However, GAL4-Sp3 but not GAL4-Sp1 fusion protein supported the TSA-mediated gene induction from a luciferase reporter plasmid driven by five GAL4 DNA-binding sites. Moreover, the ectopic expression of dominant negative Sp3 repressed the enhancement by TSA of the p21/WAF1/Cip1 promoter and Sp1 site-driven promoter. Taken together, these results suggest that histone deacetylase inhibitor up-regulates p21/WAF1/Cip1 transcription by Sp3 but not by Sp1.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cancer results from a sequence of genetic changes that subvert the normal mechanisms of control over cell cycle, differentiation, and morphology. Many natural products have been isolated on the basis of their ability to arrest the deregulated cell cycle, induce differentiation, or revert the abnormal morphology back to normal morphology in various cancer cell lines and transformed cell lines. TSA3 (1) and trapoxin (2) have been also isolated as the potential products having detransforming activity. Furthermore, these compounds also induce differentiation and cell cycle arrest. It has been unclear how these compounds are able to show such antitumor activities. Recently, HDACs have been considered as likely molecular targets of these agents. Actually, both TSA and trapoxin inhibit the activity of HDAC at similar respective concentrations, for which antitumor activities are observed (3 , 4) . Accumulating evidence suggests that the acetylation and deacetylation of histones and/or nonhistone protein play significant roles in the regulation of transcription in eukaryotic cells (5 , 6) . With recent cloning of many histone acetyltransferases and the recognition that many transcription factors, coactivators, and basal transcription initiation complex proteins contain acetyltransferase activity, it has become apparent that histone acetyltransferases play an important role in transcription initiation and activation (7 , 8) . Also, with recent cloning of some HDACs and the recognition that some transcriptional repressors and corepressors form complexes with HDACs (9 , 10) , it has gradually become apparent that HDACs play an important role in transcriptional repression. Because HDAC inhibitors show antitumor activity, HDACs may repress the transcription of antitumor genes, the products of which induce arrest of cell proliferation or differentiation (11) .

Previously, we demonstrated that sodium butyrate, which is a well-known differentiation-inducing reagent that also acts as a HDAC inhibitor at millimolar concentration, inhibits cell proliferation, and induces the expression of p21/WAF1/Cip1, cyclin-cyclin-dependent kinase inhibitor (negative cell cycle regulator), in a p53-independent manner (12) . Furthermore, we also reported that both sodium butyrate and TSA activate the p21/WAF1/Cip1 gene promoter through the Sp1 sites (13) . Interestingly, the region containing the Sp1 sites of the p21/WAF1/Cip1 promoter was also shown to be the minimal region for up-regulation of the p21/WAF1/Cip1 promoter mediated by TGF-ß (14) , phorbol ester (15) , okadaic acid (15) , and geranylgeranyltransferase I inhibitor GGTI-298 (16) . It is not known whether specific transcription factors that are capable of binding to the Sp1 sites mediate the HDAC inhibitor-transactivating signal.

Here, we show that Sp1 and Sp3 predominantly bind to the Sp1 sites of p21/WAF1/Cip1 promoter in MG63 cells and that TSA treatment does not change their binding activities. However, GAL4-Sp3 but not GAL4-Sp1 fusion protein can support TSA induction from a minimal promoter driven by five GAL4 DNA-binding sites. Moreover, we show that the ectopic expression of dominant negative Sp3 represses the enhancement by TSA of the p21/WAF1/Cip1 promoter. Thus, our results suggest that HDAC inhibitor up-regulates the p21/WAF1/Cip1 transcription by Sp3 but not Sp1.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Culture and Preparation of Nuclear Extracts.
MG63 cell line was maintained in DMEM (Life Technologies, Inc., Rockville, MD) supplemented with 10% FCS (Life Technologies, Inc.) and incubated at 37°C in a humidified atmosphere of 5% CO2 in air. Nuclear extracts were prepared from both TSA-treated and untreated MG63 cells, according to the method of Dignam et al. (17) . After 24 h of treatment with 500 ng/ml TSA (Wako, Osaka, Japan), cells in a 100-mm-diameter plate were washed twice with ice-cold PBS containing 0.5 mM p-ABSF (Wako), scraped, and incubated on ice for 10 min in 10 mM HEPES-KOH buffer (pH 7.9) containing 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 5 mM sodium fluoride, 5 mM sodium orthovanadate, and 0.5 mM p-ABSF. Cells were disrupted with a Dounce homogenizer. After centrifugation, nuclei were resuspended in 20 mM HEPES-KOH buffer (pH 7.9) containing 400 mM NaCl, 1.5 mM MgCl2, 25% glycerol, 0.1 mM EDTA, 1 mM DTT, 5 mM sodium fluoride, 5 mM sodium orthovanadate, and 0.5 mM p-ABSF and incubated at 4°C for 60 min. The mixture was centrifuged at 35,000 rpm for 30 min at 4°C, and the supernatant was recovered as nuclear extracts. Nuclear extracts were dialyzed against 20 mM HEPES-KOH buffer (pH 7.9) containing 400 mM KCl, 20% glycerol, 0.1 mM EDTA, 1 mM DTT, 5 mM sodium fluoride, 5 mM sodium orthovanadate, and 0.5 mM p-ABSF. The dialyzed nuclear extract was used for protein concentration determination and was stored at -80°C.

EMSA.
Annealed oligonucleotides containing the sequences between positions -87 and -72 from the transcription start site of the p21/WAF1/Cip1 promoter (AGCTCGGGTCCCGCCTCCTT and TCGAAAGGAGGCGGGACCCG) were labeled with [{alpha}-33P] dCTP using the Klenow fragment of Escherichia coli DNA polymerase and were used as a probe. The reaction mixture for the EMSA contained 8 mM Tris-HCl (pH 7.9), 24 mM HEPES-KCl (pH 7.9), 120 mM KCl, 24% glycerol, 2 mM EDTA, 2 mM DTT, 1 µg of poly(dI · dC) (Amersham Pharmacia Biotech, Inc., Piscataway, NJ), and 8 µg of nuclear extract. After preincubation for 5 min, 33P-labeled probe DNA was added to the mixture, and the binding reaction was allowed to proceed at room temperature for 20 min. The reaction mixture was further incubated for 20 min in the presence or absence of anti-Sp1 or anti-Sp3 antibody (Santa Cruz Biotechnology, Santa Cruz, CA). The product was resolved by electrophoresis on a 6% native polyacrylamide gel and analyzed by Fuji Image Analyzer Bas 2000 (Fujix, Tokyo, Japan).

Plasmid Constructs.
Each of the plasmid constructs pM-Sp1, pM-Sp3, pM-DNSp1, and pM-DNSp3 expresses the GAL4 binding domain fused to active forms of Sp1 (amino acids 83–778) and Sp3 (amino acids 1–654) and the transactivation domain-deleted Sp1 (amino acids 592–778) and Sp3 (amino acids 399–654), respectively. pM, expressing only the GAL4 binding domain, used as a negative control. Furthermore, pM-Sp3 (1–398), pM-Sp3 (81–160), pM-Sp3 (81–398), pM-Sp3 (161–398), pM-Sp3 (241–398), pM-Sp3 (1–80), pM-Sp3 (1–160), pM-Sp3 (1–240), and pM-Sp3 (1–320) express GAL4 binding domains fused to the Sp3 regions corresponding to amino acids 1–398, 81–160, 81–398, 161–398, 241–398, 1–80, 1–160, 1–240, and 1–320, respectively. The regions derived from Sp1 or Sp3 of all above plasmids were created by PCR amplification. The PCR products were subsequently cloned into a pM vector. The region and the junctions of all fusion proteins were sequenced to ensure the integrity of the sequences of the region and the fusion protein’s reading frame. pG5-luc is a luciferase reporter, which carries five GAL4 DNA-binding sites upstream of E1B minimal promoter and the TATA box. pCMV-DNSp3 expresses a construct in which the transactivation domain is deleted (amino acids 399–654), which still has the DNA binding activity to the Sp1 site. pCMV3.1 is an empty vector that was used as a negative control. The full-length p21/WAF1/Cip1 promoter luciferase construct pWWP, the minimal TSA-responsible p21/WAF1/Cip promoter luciferase construct pWPdel-BstX I, the three consensus Sp1 binding site-driven promoter Sp1-luc, and the three mutant Sp1 binding site-driven promoter mtSp1-luc were described previously (12 , 13) .

Transfection Assay.
MG63 cells were transfected by the lipofection technique. MG63 cells were seeded at a density of 0.8 x 105 cells per well in a 12-well plate. The next day, cells were transfected with 0.5 µg per well of reporter plasmid DNA and 2.5 µg per well of effector plasmid DNA in SuperFect (Qiagen, Hilden, Germany) for 2 h. Twenty-four h after the transfection, the medium was changed for medium with or without 500 ng/ml TSA, and 48 h later, cell lysates were collected for the luciferase assay.

The luciferase activities of the cell lysates were measured according to the manufacturer’s recommendations (Promega, Madison, WI). Luciferase activities were normalized for the amount of the protein in cell lysates. All luciferase assays were carried out in triplicate. The level of induction was calculated by dividing the mean luciferase activity of samples treated with TSA by the mean activity of untreated control samples. Each experiment was repeated at least three times.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The Sp1 Sites, Which Are Required for the Transactivation of p21/WAF1/Cip1 Promoter by TSA, Interact with Sp1 and Sp3.
We have previously shown that TSA activates the p21/WAF1/Cip1 gene promoter through the Sp1 sites in a p53-independent manner and that the Sp1 sites were required for the up-regulation mediated by TSA (13) . To determine the mechanism through which the p21/WAF1/Cip1 induction occurs, we performed EMSA using as a probe the sequence between positions -87 and -72 from the transcription start site of the p21/WAF1/Cip1 promoter. The EMSA, performed with nuclear extracts from both TSA-treated MG63 cells and untreated MG63 cells and 33P-end-labeled Sp1 probe (-87 to -72), revealed three specific bands (Fig. 1Citation , Lanes 1 and 5). Supershift experiments in the presence of specific antibodies for Sp1 showed that the slowest-migrating complex was shifted (Fig. 1Citation , Lanes 2 and 6). Both the fast complex and slow-migrating complex, which ran slightly faster than the slowest-migrating complex of Sp1, were shifted in the presence of specific antibodies for Sp3 (Fig. 1Citation , Lanes 3 and 7). In the presence of antibodies for Sp1 and Sp3, used in combination, all three bands disappeared (Fig. 1Citation , Lanes 4 and 8). These results are consistent with our previous report (12) and other reports (14 , 16) . They indicate that both Sp1 and Sp3 interact with Sp1 sites, which are required for the transactivation of the p21/WAF1/Cip1 promoter in MG63 cells. However, TSA treatment did not change DNA-binding activities of either Sp1 or Sp3 (Fig. 1Citation , Lanes 1 versus 5, 2 versus 6, 3 versus 7, and 4 versus 8). These results suggest that a mechanism other than alteration of the DNA-binding activities of Sp1/Sp3 transcription factors is responsible for TSA-mediated transcriptional activation. This result is also consistent with our previous report using sodium butyrate (12) and another report using TGF-ß (14) but is inconsistent with yet another report using geranylgeranyltransferase I inhibitor (16) .



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. The Sp1 sites that are required for the transactivation of the p21/WAF1/Cip1 promoter by TSA interact with Sp1 and Sp3. EMSA was carried out with nuclear extracts prepared from TSA-treated (Lanes 5–8) or untreated (Lanes 1–4) MG63 cells. Labeled oligonucleotide containing the sequence of the Sp1 sites required for the transactivation of the p21/WAF1/Cip1 promoter by TSA from position -87 to -72 from the transcriptional start site was used as a probe. Anti-Sp1 antibody (Lanes 2, 4, 6, and 8) or anti-Sp3 antibody (Lanes 3, 4, 7, and 8) was used as indicated. Left, positions of Sp1 and Sp3.

 
Sp3 but not Sp1 Can Mediate Responsiveness to TSA.
As we have demonstrated previously, TSA activates the p21/WAF1/Cip1 promoter through the Sp1 sites and also activates three consensus Sp1 binding site-driven promoter (13) . To determine whether Sp1 and/or Sp3 acts as a mediator of the TSA-transactivating signal, we used a system in which either Sp1 or Sp3 was fused to the DNA-binding domain of the bacterial transcriptional factor GAL4. Consequently, the ability of these fusion proteins to activate transcription from the consensus GAL4 DNA-binding site in both the presence and absence of TSA could be measured. In this way, an enhancement of the transactivating capability of either Sp1 or Sp3 in response to TSA should result in an augmented transcription from the GAL4 DNA-binding site when an appropriate Sp1 or Sp3 GAL4 fusion protein is expressed. These GAL4 fusion expression plasmids were cotransfected into MG63 cells with a luciferase reporter plasmid, the expression of which is driven by five consensus GAL4 DNA-binding sites. Both GAL4-Sp1 and GAL4-Sp3 fusion proteins responded to TSA treatment, but the magnitude of the response of GAL4-Sp1 was not significantly different from that of the plasmid expressing only the GAL4 DNA-binding domain (Fig. 2Citation , GAL4 and GAL4-Sp1). In contrast, GAL4-Sp3 fusion protein responded to TSA strongly (Fig. 2Citation , GAL4-Sp3). Furthermore, we also used the dominant negative forms of Sp1 and Sp3 fusion proteins, which lack transactivation domains, respectively. GAL4 dominant negative Sp3 fusion protein could not be activated by TSA treatment (Fig. 2Citation , GAL4-DNSp3). These results suggest that the transactivation domain of Sp3 mediate the transcriptional activation through the Sp1 sites by TSA.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Sp3 but not Sp1 can mediate responsiveness to TSA. MG63 cells were cotransfected with 2.5 mg of GAL4-Sp1 or GAL4-Sp3 constructs and 0.5 mg of pG5-luc. At 24 h posttransfection, cells were incubated with or without TSA (500 ng/ml) for 24 h, as described in "Materials and Methods." The luciferase activities of the samples were measured and normalized for the amount of the protein in cell lysates. All luciferase assays were carried out in triplicate. Columns, fold induction, calculated by dividing the mean luciferase activity of samples treated with TSA by the mean activity of untreated control samples. Data are representative of five independent experiments.

 
Analysis of the Necessity of the Sp3 Domain for the Mediation of Transcriptional Activation by TSA.
To determine the TSA response region of Sp3, we also constructed various deletion mutants of transactivation domain of Sp3, which were fused to the GAL4 DNA-binding domain. Similar to the above experiments, we measured the ability of these GAL4 mutant Sp3 fusion proteins to activate transcription from consensus GAL4 DNA-binding site in both the presence and absence of TSA. As shown in Fig. 3Citation , the results using gradual deletions from both NH2 and COOH termini of the transactivation domain of Sp3 suggest that the region between amino acids 81 and 160 of Sp3 is important for the mediation of the transcriptional activation by TSA. However, this domain alone, which corresponds to GAL4-Sp3 (81–160), could not mediate the transcriptional activation by TSA. Neither GAL4-Sp3 (241–398) nor GAL4-Sp3 (1–80) could be activated by TSA treatment, as in the case of GAL4-Sp1. Neither of these constructs has a complete glutamine-rich domain of Sp3. Therefore, either of two of glutamine-rich domains of transactivation domain of Sp3 might be essential to the mediation of the transcriptional activation by TSA.



View larger version (22K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Analysis of the necessity of the Sp3 domain for the mediation of transcriptional activation by TSA. The mutant GAL4-Sp3 protein constructs are represented schematically, and the values for the level of induction of the mutant GAL4-Sp3 constructs are indicated on the right. MG63 cells were cotransfected with 2.5 mg of GAL4-Sp3 constructs and 0.5 mg of pG5-luc. At 24 h posttransfection, cells were incubated with or without TSA (500 ng/ml) for 24 h, as described in "Materials and Methods." The luciferase activities of the samples were measured and normalized for the amount of the protein in cell lysates. All the luciferase assays were carried out in triplicate. The level of induction was calculated by dividing the mean luciferase activity of samples treated with TSA by the mean activity of untreated control samples. Data are representative of three independent experiments.

 
Dominant Negative Sp3 Represses the Enhancement by TSA of Both the p21/WAF1/Cip1 Promoter and the Sp1 Site-driven Promoter.
Moreover, to confirm whether Sp3 itself mediates the transcriptional activation through the Sp1 sites by TSA, we used a dominant negative Sp3 expression plasmid to cotransfect with the p21/WAF1/Cip1 promoter or Sp1 site-driven promoter in the presence of TSA. The ectopic expression of dominant negative Sp3 repressed the promoter activity of the p21/WAF1/Cip1 promoters (Fig. 4, A and B)Citation and consensus Sp1 site-driven promoter (Fig. 4C)Citation , which would otherwise be activated by TSA treatment. In contrast, mutant Sp1 site-driven promoter was not affected by the expression of dominant negative Sp3 (Fig. 4D)Citation . Interestingly, the ectopic expression of dominant negative Sp3 did not repress the promoter activity of the p21/WAF1/Cip1 promoter and Sp1 site-driven promoter in the absence of TSA (data not shown). These results suggest that, in the absence of TSA, Sp3 acts as an inactive transcription factor, but in the presence of TSA, Sp3 changes into a strong transcription factor.



View larger version (24K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Dominant negative Sp3 represses the enhancement by TSA of the p21/WAF1/Cip1 promoter and the Sp1 site-driven promoter. MG63 cells were cotransfected with 0, 1.25, 2.5, or 5.0 mg of pCMV-DNSp3 (the total amount of expression plasmids was adjusted to 5.0 mg by pCMV3.1 control plasmid) and 0.5 mg of pWWP (A), pWPdel-BstX I (B), Sp1-luc (C), and mtSp1-luc (D). At 24 h posttransfection, cells were incubated with or without TSA (500 ng/ml) for 24 h, as described in "Materials and Methods." The luciferase activities of the samples were measured and normalized for the amount of the protein in cell lysates. All the luciferase assays were carried out in triplicate. Columns, fold induction, calculated by dividing the mean luciferase activity of samples treated with TSA by the mean activity of untreated control samples. Data are representative of three independent experiments.

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Our previous studies have shown that both sodium butyrate and TSA, which can inhibit the activity of HDAC at both millimolar and micromolar concentrations, activate the p21/WAF1/Cip1 promoter through the Sp1 sites (12 , 13) . Here, we show that the Sp1 sites are capable of binding at least two transcription factors in vitro, Sp1 and the related protein, Sp3 (18) , which recognizes the same sequence of Sp1. In this report, we determined whether either of these factors could act as a mediator for the TSA. Using chimeric GAL4 DNA-binding domain-Sp1 or Sp3 fusion protein, we have shown that TSA can activate the transcription from Sp3. This activation is specific to the transactivation-domain of Sp3 because neither Sp1 nor the DNA-binding domain of Sp3 could activate transcription in a TSA-dependent manner. Furthermore, the deletion mutants of the Sp3 transactivation domain indicate that at least one glutamine-rich domain of Sp3 is necessary for response to TSA treatment. Moreover, because the ectopic expression of dominant negative Sp3 could repress the enhancement by TSA of the p21/WAF1/Cip1 promoter and Sp1 site-driven promoter, it was also confirmed that Sp3 is involved in the Sp1 site-mediated transactivation by TSA.

Interestingly, the region containing the Sp1 sites of the p21/WAF1/Cip1 promoter was also shown to be the minimal region for mediating up-regulation of p21/WAF1/Cip1 promoter by TGF-ß, phorbol ester, okadaic acid, progesterone, and geranylgeranyltransferase I inhibitor (14, 15, 16 , 19) . In contrast to this report, several recent reports showed that Sp1 but not Sp3 is the mediator of the TGF-ß signal through the Sp1 sites (20) ; geranylgeranyltransferase I inhibitor GGTI-298 up-regulates Sp1 transcriptional activity (16) , and progesterone regulates transcription of the p21/WAF1/Cip1 gene through Sp1 and CBP/p300 (19) . Probably, these agents might enhance the transcriptional activity of Sp1. However, it is considered that the function of TSA as a HDAC inhibitor might be to Sp3 to alter the its transcriptional activity from weak activator or repressor to strong activator. Histone acetylation appears to be critically involved in the activation of an increasingly recognized number of genes (7) . Conversely, histone deacetylation has been linked to some genes’ repression. Several years ago, two transcriptional corepressors, called N-CoR and SMRT, were identified to bind the nuclear receptors and repress the transcription mediated by the receptors (21, 22, 23) . These complexes then recruit a factor with HDAC activity and suppress gene activation (9 , 24 , 25) . Actually, the recruitment of HDAC is critical to the transforming potential of the fusion proteins of acute promyelocytic leukemia, which are the fusions of the PML (promyelocytic leukemia) protein or the PLZF (promyelocytic leukemia zinc-finger) protein with retinoic acid receptor-{alpha} (26, 27, 28) . Similar mechanisms, for which the complex containing HDAC acts as a transcriptional repressor, have been discovered in the myc/mad/max pathway (29 , 30) , the E2F/Rb pathway (31, 32, 33) , and the methylation pathway (34 , 35) . We have tried to determine the interactions between Sp3 and HDAC1/HDAC2, but so far, we have not detected them in the mammalian two-hybrid system. Currently, we are investigating the relationship between Sp3 and HDAC inhibitor.

Recently, we proposed a novel approach for chemotherapy or chemoprevention against cancer, which we termed "gene-regulating chemotherapy or chemoprevention" (36) . Our strategy is to activate the potent function of growth-inhibitory genes, which are activating targets of p53. p21/WAF1/Cip1 gene is one of the better candidates because the p21/WAF1/Cip1 gene appears to be rarely mutated in human common cancers (37 , 38) , whereas the p53 gene is frequently mutated (39 , 40) . Therefore, the elucidation of p53-independent activating mechanism by the HDAC of the p21/WAF1/Cip1 gene might contribute to the therapy or the prevention of cancer when p53 gene is mutated. Thus, HDAC inhibitors are regarded as possible drugs in the treatment of certain cancers. In fact, FR901228, which is a novel HDAC inhibitor (41) , shows remarkable activity in vivo against experimental tumors and is now under clinical investigation (Phase I) at the National Cancer Institute (Bethesda, MD). Furthermore, clinical treatment with sodium phenylbutyrate, which is also a HDAC inhibitor and a drug previously tested for the treatment of thalassemia and certain hyperammonemic states, in combination with all-trans-retinoic acid to a patient with highly resistant acute promyelocytic leukemia induced complete clinical and molecular remission (42) . These findings implicate HDAC inhibitors as possible molecular targets for the cancer therapy.


    ACKNOWLEDGMENTS
 
We thank Dr. T. Yoshino for technical advice and helpful discussions; S. Okada for technical advice; and Drs. M. Jones, P. Kowalski-Saunders, and R. Wadhwa for helpful discussions and criticism during the preparation of this manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by the Smoking Research Foundation for Biomedical Research. Back

2 To whom requests for reprints should be addressed, at Department of Preventive Medicine, Kyoto Prefectural University of Medicine, Kamigyo-ku, Kyoto 602-8566, Japan. Back

3 The abbreviations used are: TSA, trichostatin A; HDAC, histone deacetylase; TGF, transforming growth factor; P-ABSF, 4-(2-aminoethy) benzenesulfonyl fluoride • HCl; EMSA, electrophoretic mobility-shift assay. Back

Received 6/24/99. Accepted 7/20/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Sugita K., Koizumi K., Yoshida H. Morphological reversion of Cis-transformed NIH3T3 cells by trichostatin A. Cancer Res., 52: 168-172, 1992.[Abstract/Free Full Text]
  2. Itazaki H., Nagashima K., Sugita K., Yoshida H., Kawamura Y., Matsumoto K., Ishii K., Uotani N., Nakai H., Terui A., Yoshimatsu S., Ikenishi Y., Nakagawa Y. Isolation and structural elucidation of new cyclotetrapeptides, trapoxins A and B, having detransformation activities as antitumor agents. J. Antibiot. (Tokyo), 43: 1524-1532, 1990.[Medline]
  3. Yoshida M., Kijima M., Akita M., Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J. Biol. Chem., 265: 17174-17179, 1990.[Abstract/Free Full Text]
  4. Kijima M., Yoshida M., Sugita K., Horinouchi S., Beppu T. Trapoxin, an antitumor cyclic tetrapeptide, is an irreversible inhibitor of mammalian histone deacetylase. J. Biol. Chem., 268: 22429-22435, 1993.[Abstract/Free Full Text]
  5. Struhl K. Histone acetylation and transcriptional regulatory mechanisms. Genes Dev., 12: 599-606, 1998.[Free Full Text]
  6. Kuo M. H., Allis C. D. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays, 20: 615-626, 1998.[Medline]
  7. Wolffe A. P., Pruss D. Targeting chromatin disruption: transcription regulators that acetylate histones. Cell, 84: 817-819, 1996.[Medline]
  8. Wade P. A., Pruss D., Wolffe A. P. Histone acetylation: chromatin in action. Trends Biochem. Sci., 22: 128-132, 1997.[Medline]
  9. Pazin M. J., Kadonaga J. T. What’s up and down with histone deacetylation and transcription?. Cell, 89: 325-328, 1997.[Medline]
  10. Wolffe A. P. Transcriptional control. Sinful repression. Nature (Lond.), 387: 16-17, 1997.[Medline]
  11. DePinho R. A. Transcriptional repression. The cancer-chromatin connection. Nature (Lond.), 391: 533-536, 1998.[Medline]
  12. Nakano K., Mizuno T., Sowa Y., Orita T., Yoshino T., Okuyama Y., Fujita T., Ohtani-Fujita N., Matsukawa Y., Tokino T., Yamagishi H., Oka T., Nomura H., Sakai T. Butyrate activates the WAF1/Cip1 gene promoter through Sp1 sites in a p53-negative human colon cancer cell line. J. Biol. Chem., 272: 22199-22206, 1997.[Abstract/Free Full Text]
  13. Sowa Y., Orita T., Minamikawa S., Nakano K., Mizuno T., Nomura H., Sakai T. Histone deacetylase inhibitor activates the WAF1/Cip1 gene promoter through the Sp1 sites. Biochem. Biophys. Res. Commun., 241: 142-150, 1997.[Medline]
  14. Datto M. B., Yu Y., Wang X. F. Functional analysis of the transforming growth factor ß-responsive elements in the WAF1/Cip1/p21 promoter. J. Biol. Chem., 270: 28623-28628, 1995.[Abstract/Free Full Text]
  15. Biggs J. R., Kudlow J. E., Kraft A. S. The role of the transcription factor Sp1 in regulating the expression of the WAF1/CIP1 gene in U937 leukemic cells. J. Biol. Chem., 271: 901-906, 1996.[Abstract/Free Full Text]
  16. Adnane J., Bizouarn F. A., Qian Y., Hamilton A. D., Sebti S. M. p21(WAF1/CIP1) is upregulated by the geranylgeranyltransferase I inhibitor GGTI-298 through a transforming growth factor ß- and Sp1-responsive element: involvement of the small GTPase rhoA. Mol. Cell. Biol., 18: 6962-6970, 1998.[Abstract/Free Full Text]
  17. Dignam J. D., Lebovitz R. M., Roeder R. G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11: 1475-1489, 1983.[Abstract/Free Full Text]
  18. Lania L., Majello B., De Luca P. Transcriptional regulation by the Sp family proteins. Int. J. Biochem. Cell Biol., 29: 1313-1323, 1997.[Medline]
  19. Owen G. I., Richer J. K., Tung L., Takimoto G., Horwitz K. B. Progesterone regulates transcription of the p21(WAF1) cyclin-dependent kinase inhibitor gene through Sp1 and CBP/p300. J. Biol. Chem., 273: 10696-10701, 1998.[Abstract/Free Full Text]
  20. Li J. M., Datto M. B., Shen X., Hu P. P., Yu Y., Wang X. F. Sp1, but not Sp3, functions to mediate promoter activation by TGF-ß through canonical Sp1 binding sites. Nucleic Acids Res., 26: 2449-2456, 1998.[Abstract/Free Full Text]
  21. Horlein A. J., Naar A. M., Heinzel T., Torchia J., Gloss B., Kurokawa R., Ryan A., Kamei Y., Soderstrom M., Glass C. K., Rosenfeld M. G. Ligand-independent repression by the thyroid hormone receptor mediated by a nuclear receptor co-repressor. Nature (Lond.), 377: 397-404, 1995.[Medline]
  22. Kurokawa R., Soderstrom M., Horlein A., Halachmi S., Brown M., Rosenfeld M. G., Glass C. K. Polarity-specific activities of retinoic acid receptors determined by a co-repressor. Nature (Lond.), 377: 451-454, 1995.[Medline]
  23. Chen J. D., Evans R. M. A transcriptional co-repressor that interacts with nuclear hormone receptors. Nature (Lond.), 377: 454-457, 1995.[Medline]
  24. Heinzel T., Lavinsky R. M., Mullen T. M., Soderstrom M., Laherty C. D., Torchia J., Yang W. M., Brard G., Ngo S. D., Davie J. R., Seto E., Eisenman R. N., Rose D. W., Glass C. K., Rosenfeld M. G. A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature (Lond.), 387: 43-48, 1997.[Medline]
  25. Alland L., Muhle R., Hou H., Jr., Potes J., Chin L., Schreiber-Agus N., DePinho R. A. Role for N-CoR and histone deacetylase in Sin3-mediated transcriptional repression. Nature (Lond.), 387: 49-55, 1997.[Medline]
  26. He L. Z., Guidez F., Tribioli C., Peruzzi D., Ruthardt M., Zelent A., Pandolfi P. P. Distinct interactions of PML-RAR{alpha} and PLZF-RAR{alpha} with co-repressors determine differential responses to RA in APL. Nat. Genet., 18: 126-135, 1998.[Medline]
  27. Lin R. J., Nagy L., Inoue S., Shao W., Miller W. H., Jr., Evans R. M. Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature (Lond.), 391: 811-814, 1998.[Medline]
  28. Grignani F., De Matteis S., Nervi C., Tomassoni L., Gelmetti V., Cioce M., Fanelli M., Ruthardt M., Ferrara F. F., Zamir I., Seiser C., Grignani F., Lazar M. A., Minucci S., Pelicci P. G. Fusion proteins of the retinoic acid receptor-{alpha} recruit histone deacetylase in promyelocytic leukaemia. Nature (Lond.), 391: 815-818, 1998.[Medline]
  29. Hassig C., Fleischer T. C., Billin A. N., Schreiber S. L., Ayer D. E. Histone deacetylase activity is required for full transcriptional repression by mSin3A. Cell, 89: 341-347, 1997.[Medline]
  30. Laherty C. D., Yang W. M., Sun J. M., Davie J. R., Seto E., Eisenman R. N. Histone deacetylases associated with the mSin3 corepressor mediate mad transcriptional repression. Cell, 89: 349-356, 1997.[Medline]
  31. Brehm A., Miska E. A., McCance D. J., Reid J. L., Bannister A. J., Kouzarides T. Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature (Lond.), 391: 597-601, 1998.[Medline]
  32. Magnaghi-Jaulin L., Groisman R., Naguibneva I., Robin P., Lorain S., Le Villain J. P., Troalen F., Trouche D., Harel-Bellan A. Retinoblastoma protein represses transcription by recruiting a histone deacetylase. Nature (Lond.), 391: 601-605, 1998.[Medline]
  33. Luo R. X., Postigo A. A., Dean D. C. Rb interacts with histone deacetylase to repress transcription. Cell, 92: 463-473, 1998.[Medline]
  34. Nan X., Ng H. H., Johnson C. A., Laherty C. D., Turner B. M., Eisenman R. N., Bird A. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature (Lond.), 393: 386-389, 1998.[Medline]
  35. Jones P. L., Veenstra G. J., Wade P. A., Vermaak D., Kass S. U., Landsberger N., Strouboulis J., Wolffe A. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat. Genet., 19: 187-191, 1998.[Medline]
  36. Sakai T. Molecular cancer epidemiology: the present status and future possibilities. Jpn. J. Hygiene, 50: 1036-1046, 1996.
  37. Chedid M., Michieli P., Lengel C., Huppi K., Givol D. A single nucleotide substitution at codon 31 (Ser/Arg) defines a polymorphism in a highly conserved region of the p53-inducible gene WAF1/CIP1. Oncogene, 9: 3021-3024, 1994.[Medline]
  38. Li Y. J., Laurent-Puig P., Salmon R. J., Thomas G., Hamelin R. Polymorphisms and probable lack of mutation in the WAF1-CIP1 gene in colorectal cancer. Oncogene, 10: 599-601, 1995.[Medline]
  39. Hollstein M., Sidransky D., Vogelstein B., Harris C. C. p53 mutations in human cancers. Science (Washington DC), 253: 49-53, 1991.[Abstract/Free Full Text]
  40. Vogelstein B., Kinzler K. W. p53 function and dysfunction. Cell, 70: 523-526, 1992.[Medline]
  41. Nakajima H., Kim Y. B., Terano H., Yoshida M., Horinouchi S. FR901228, a potent antitumor antibiotic, is a novel histone deacetylase inhibitor. Exp. Cell Res., 241: 126-133, 1998.[Medline]
  42. Warrell R. P., Jr., He L. Z., Richon V., Calleja E., Pandolfi P. P. Therapeutic targeting of transcription in acute promyelocytic leukemia by use of an inhibitor of histone deacetylase. J. Natl. Cancer Inst., 90: 1621-1625, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JPEN J Parenter Enteral NutrHome page
H. F. Mangian and K. A. Tappenden
Butyrate Increases GLUT2 mRNA Abundance by Initiating Transcription in Caco2-BBe Cells
JPEN J Parenter Enteral Nutr, November 1, 2009; 33(6): 607 - 617.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. Fukushima, Y. Aizaki, and K. Sakuma
Short-Chain Fatty Acids Induce Intestinal Transient Receptor Potential Vanilloid Type 6 Expression in Rats and Caco-2 Cells
J. Nutr., January 1, 2009; 139(1): 20 - 25.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. J. Wilson, D.-S. Byun, S. Nasser, L. B. Murray, K. Ayyanar, D. Arango, M. Figueroa, A. Melnick, G. D. Kao, L. H. Augenlicht, et al.
HDAC4 Promotes Growth of Colon Cancer Cells via Repression of p21
Mol. Biol. Cell, October 1, 2008; 19(10): 4062 - 4075.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
H. Nian, B. Delage, J. T. Pinto, and R. H. Dashwood
Allyl mercaptan, a garlic-derived organosulfur compound, inhibits histone deacetylase and enhances Sp3 binding on the P21WAF1 promoter
Carcinogenesis, September 1, 2008; 29(9): 1816 - 1824.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, M. Liao, and M. L. Dufau
Unlocking Repression of the Human Luteinizing Hormone Receptor Gene by Trichostatin A-induced Cell-specific Phosphatase Release
J. Biol. Chem., August 29, 2008; 283(35): 24039 - 24046.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. Liao, Y. Zhang, and M. L. Dufau
Protein Kinase C{alpha}-Induced Derepression of the Human Luteinizing Hormone Receptor Gene Transcription through ERK-Mediated Release of HDAC1/Sin3A Repressor Complex from Sp1 Sites
Mol. Endocrinol., June 1, 2008; 22(6): 1449 - 1463.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-C. Lin, J.-H. Lin, C.-W. Chou, Y.-F. Chang, S.-H. Yeh, and C.-C. Chen
Statins Increase p21 through Inhibition of Histone Deacetylase Activity and Release of Promoter-Associated HDAC1/2
Cancer Res., April 1, 2008; 68(7): 2375 - 2383.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Andresen, H. Jensen, M. T. Pedersen, K. A. Hansen, and S. Skov
Molecular Regulation of MHC Class I Chain-Related Protein A Expression after HDAC-Inhibitor Treatment of Jurkat T Cells
J. Immunol., December 15, 2007; 179(12): 8235 - 8242.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. G. Lee, C. Wynder, D. A. Bochar, M.-A. Hakimi, N. Cooch, and R. Shiekhattar
Functional Interplay between Histone Demethylase and Deacetylase Enzymes.
Mol. Cell. Biol., September 1, 2006; 26(17): 6395 - 6402.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Honda, M. J. Pazin, H. Ji, R. P. Wernyj, and P. J. Morin
Crucial Roles of Sp1 and Epigenetic Modifications in the Regulation of the CLDN4 Promoter in Ovarian Cancer Cells
J. Biol. Chem., July 28, 2006; 281(30): 21433 - 21444.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
T. Higashi, S. Kyo, M. Inoue, H. Tanii, and K. Saijoh
Novel Functional Single Nucleotide Polymorphisms in the Latent Transforming Growth Factor-{beta} Binding Protein-1L Promoter: Effect on Latent Transforming Growth Factor-{beta} Binding Protein-1L Expression Level and Possible Prognostic Significance in Ovarian Cancer
J. Mol. Diagn., July 1, 2006; 8(3): 342 - 350.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. J. Wilson, D.-S. Byun, N. Popova, L. B. Murray, K. L'Italien, Y. Sowa, D. Arango, A. Velcich, L. H. Augenlicht, and J. M. Mariadason
Histone Deacetylase 3 (HDAC3) and Other Class I HDACs Regulate Colon Cell Maturation and p21 Expression and Are Deregulated in Human Colon Cancer
J. Biol. Chem., May 12, 2006; 281(19): 13548 - 13558.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Natesampillai, M. E. Fernandez-Zapico, R. Urrutia, and J. D. Veldhuis
A Novel Functional Interaction between the Sp1-like Protein KLF13 and SREBP-Sp1 Activation Complex Underlies Regulation of Low Density Lipoprotein Receptor Promoter Function
J. Biol. Chem., February 10, 2006; 281(6): 3040 - 3047.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
B. F. Clem and B. J. Clark
Association of the mSin3A-Histone Deacetylase 1/2 Corepressor Complex with the Mouse Steroidogenic Acute Regulatory Protein Gene
Mol. Endocrinol., January 1, 2006; 20(1): 100 - 113.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Hoshino, H. Matsubara, N. Hanari, M. Mori, T. Nishimori, Y. Yoneyama, Y. Akutsu, H. Sakata, K. Matsushita, N. Seki, et al.
Histone Deacetylase Inhibitor FK228 Activates Tumor Suppressor Prdx1 with Apoptosis Induction in Esophageal Cancer Cells
Clin. Cancer Res., November 1, 2005; 11(21): 7945 - 7952.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. R. Acharya, A. Sparreboom, J. Venitz, and W. D. Figg
Rational Development of Histone Deacetylase Inhibitors as Anticancer Agents: A Review
Mol. Pharmacol., October 1, 2005; 68(4): 917 - 932.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Zhang, N. Fatima, and M. L. Dufau
Coordinated Changes in DNA Methylation and Histone Modifications Regulate Silencing/Derepression of Luteinizing Hormone Receptor Gene Transcription
Mol. Cell. Biol., September 15, 2005; 25(18): 7929 - 7939.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. He, J.-M. Sun, L. Li, and J. R. Davie
Differential Intranuclear Organization of Transcription Factors Sp1 and Sp3
Mol. Biol. Cell, September 1, 2005; 16(9): 4073 - 4083.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
M. T. Poch, N. S. Cutler, G. S. Yost, and R. N. Hines
MOLECULAR MECHANISMS REGULATING HUMAN CYP4B1 LUNG-SELECTIVE EXPRESSION
Drug Metab. Dispos., August 1, 2005; 33(8): 1174 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J.-P. Brouland, P. Gelebart, T. Kovacs, J. Enouf, J. Grossmann, and B. Papp
The Loss of Sarco/Endoplasmic Reticulum Calcium Transport ATPase 3 Expression Is an Early Event during the Multistep Process of Colon Carcinogenesis
Am. J. Pathol., July 1, 2005; 167(1): 233 - 242.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. W. Vance, S. Carreira, G. Brosch, and C. R. Goding
Tbx2 Is Overexpressed and Plays an Important Role in Maintaining Proliferation and Suppression of Senescence in Melanomas
Cancer Res., March 15, 2005; 65(6): 2260 - 2268.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Hong, I. Samudio, S. Liu, M. Abdelrahim, and S. Safe
Peroxisome Proliferator-Activated Receptor {gamma}-Dependent Activation of p21 in Panc-28 Pancreatic Cancer Cells Involves Sp1 and Sp4 Proteins
Endocrinology, December 1, 2004; 145(12): 5774 - 5785.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. J. O'Farrell, P. Ghosh, N. Dobashi, C. Y. Sasaki, and D. L. Longo
Comparison of the Effect of Mutant and Wild-Type p53 on Global Gene Expression
Cancer Res., November 15, 2004; 64(22): 8199 - 8207.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Di Padova, T. Bruno, F. De Nicola, S. Iezzi, C. D'Angelo, R. Gallo, D. Nicosia, N. Corbi, A. Biroccio, A. Floridi, et al.
Che-1 Arrests Human Colon Carcinoma Cell Proliferation by Displacing HDAC1 from the p21WAF1/CIP1 Promoter
J. Biol. Chem., September 19, 2003; 278(38): 36496 - 36504.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. L. Merchant, L. Bai, and M. Okada
ZBP-89 Mediates Butyrate Regulation of Gene Expression
J. Nutr., July 1, 2003; 133(7): 2456S - 2460.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J. R. Davie
Inhibition of Histone Deacetylase Activity by Butyrate
J. Nutr., July 1, 2003; 133(7): 2485S - 2493.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W.-G. Zhu, K. Srinivasan, Z. Dai, W. Duan, L. J. Druhan, H. Ding, L. Yee, M. A. Villalona-Calero, C. Plass, and G. A. Otterson
Methylation of Adjacent CpG Sites Affects Sp1/Sp3 Binding and Activity in the p21Cip1 Promoter
Mol. Cell. Biol., June 15, 2003; 23(12): 4056 - 4065.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Lagger, A. Doetzlhofer, B. Schuettengruber, E. Haidweger, E. Simboeck, J. Tischler, S. Chiocca, G. Suske, H. Rotheneder, E. Wintersberger, et al.
The Tumor Suppressor p53 and Histone Deacetylase 1 Are Antagonistic Regulators of the Cyclin-Dependent Kinase Inhibitor p21/WAF1/CIP1 Gene
Mol. Cell. Biol., April 15, 2003; 23(8): 2669 - 2679.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
N. Camarero, A. Nadal, M. J. Barrero, D. Haro, and P. F. Marrero
Histone deacetylase inhibitors stimulate mitochondrial HMG-CoA synthase gene expression via a promoter proximal Sp1 site
Nucleic Acids Res., March 15, 2003; 31(6): 1693 - 1703.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Won, J. Yim, and T. K. Kim
Sp1 and Sp3 Recruit Histone Deacetylase to Repress Transcription of Human Telomerase Reverse Transcriptase (hTERT) Promoter in Normal Human Somatic Cells
J. Biol. Chem., October 4, 2002; 277(41): 38230 - 38238.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. G. Cogan, S. V. Subramanian, J. A. Polikandriotis, R. J. Kelm Jr., and A. R. Strauch
Vascular Smooth Muscle alpha -Actin Gene Transcription during Myofibroblast Differentiation Requires Sp1/3 Protein Binding Proximal to the MCAT Enhancer
J. Biol. Chem., September 20, 2002; 277(39): 36433 - 36442.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang and M. L. Dufau
Silencing of Transcription of the Human Luteinizing Hormone Receptor Gene by Histone Deacetylase-mSin3A Complex
J. Biol. Chem., August 30, 2002; 277(36): 33431 - 33438.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L.-H. Yih, K. Peck, and T.-C. Lee
Changes in gene expression profiles of human fibroblasts in response to sodium arsenite treatment
Carcinogenesis, May 1, 2002; 23(5): 867 - 876.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C Domon-Dell, Q Wang, S Kim, M Kedinger, B M Evers, and J-N Freund
Stimulation of the intestinal Cdx2 homeobox gene by butyrate in colon cancer cells
Gut, April 1, 2002; 50(4): 525 - 529.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
E. U. Kurz, S. E. Wilson, K. B. Leader, B. P. Sampey, W. P. Allan, J. C. Yalowich, and D. J. Kroll
The Histone Deacetylase Inhibitor Sodium Butyrate Induces DNA Topoisomerase II{alpha} Expression and Confers Hypersensitivity to Etoposide in Human Leukemic Cell Lines
Mol. Cancer Ther., December 1, 2001; 1(2): 121 - 131.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J.-W. Han, S. H. Ahn, Y. K. Kim, G.-U. Bae, J. W. Yoon, S. Hong, H. Y. Lee, Y.-W. Lee, and H.-W. Lee
Activation of p21WAF1/Cip1 Transcription through Sp1 Sites by Histone Deacetylase Inhibitor Apicidin. INVOLVEMENT OF PROTEIN KINASE C
J. Biol. Chem., November 2, 2001; 276(45): 42084 - 42090.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Takakura, S. Kyo, Y. Sowa, Z. Wang, N. Yatabe, Y. Maida, M. Tanaka, and M. Inoue
Telomerase activation by histone deacetylase inhibitor in normal cells
Nucleic Acids Res., July 15, 2001; 29(14): 3006 - 3011.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. I. Lee, S. H. Park, J. W. Kim, E. A. Sausville, H. T. Kim, O. Nakanishi, J. B. Trepel, and S.-J. Kim
MS-275, A Histone Deacetylase Inhibitor, Selectively Induces Transforming Growth Factor {beta} Type II Receptor Expression in Human Breast Cancer Cells
Cancer Res., February 1, 2001; 61(3): 931 - 934.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
G. H. Su, T. A. Sohn, B. Ryu, and S. E. Kern
A Novel Histone Deacetylase Inhibitor Identified by High-Throughput Transcriptional Screening of a Compound Library
Cancer Res., June 1, 2000; 60(12): 3137 - 3142.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Q. Zhou, Z. K. Melkoumian, A. Lucktong, M. Moniwa, J. R. Davie, and J. S. Strobl
Rapid Induction of Histone Hyperacetylation and Cellular Differentiation in Human Breast Tumor Cell Lines following Degradation of Histone Deacetylase-1
J. Biol. Chem., November 3, 2000; 275(45): 35256 - 35263.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Bai and J. L. Merchant
Transcription Factor ZBP-89 Cooperates with Histone Acetyltransferase p300 during Butyrate Activation of p21waf1 Transcription in Human Cells
J. Biol. Chem., September 22, 2000; 275(39): 30725 - 30733.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Inagaki, T. Nemoto, A. Nakao, P. t. Dijke, K. Kobayashi, K. Takehara, and P. Greenwel
Interaction between GC Box Binding Factors and Smad Proteins Modulates Cell Lineage-specific alpha 2(I) Collagen Gene Transcription
J. Biol. Chem., May 4, 2001; 276(19): 16573 - 16579.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Brinkmann, A. L. Dahler, C. Popa, M. M. Serewko, P. G. Parsons, B. G. Gabrielli, A. J. Burgess, and N. A. Saunders
Histone Hyperacetylation Induced by Histone Deacetylase Inhibitors Is Not Sufficient to Cause Growth Inhibition in Human Dermal Fibroblasts
J. Biol. Chem., June 15, 2001; 276(25): 22491 - 22499.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. P. Santini, C. Talora, T. Seki, L. Bolgan, and G. P. Dotto
Cross talk among calcineurin, Sp1/Sp3, and NFAT in control of p21WAF1/CIP1 expression in keratinocyte differentiation
PNAS, August 14, 2001; 98(17): 9575 - 9580.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sowa, Y.
Right arrow Articles by Sakai, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sowa, Y.
Right arrow Articles by Sakai, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online