
[Cancer Research 59, 5461-5463, November 1, 1999]
© 1999 American Association for Cancer Research
[Cancer Research 59, 5461-5463, November 1, 1999]
© 1999 American Association for Cancer Research
Apoptotic Conversion
Evidence for Exchange of Genetic Information between Prostate Cancer Cells Mediated by Apoptosis1
Alexandre de la Taille,
Min-Wei Chen,
Martin Burchardt,
Dominique K. Chopin and
Ralph Buttyan2
Departments of Urology [A. d. l. T., M. W. C., M. B., R. B.] and Pathology [A. d. l. T., R. B.], The College of Physicians and Surgeons of Columbia University, New York, New York 10032, and Department of Urology, Henri Mondor Hospital, 94010 Créteil, France [A. d. l. T., D. K. C.]
 |
ABSTRACT
|
|---|
Changes in the outer membrane of apoptotic cells can induce neighboring cells to become phagocytic. Using genetically marked prostate cancer cell lines, we explored the possibility that genetic information might be transferred from an apoptotic cell to a phagocytic neighbor. Neomycin-resistant LNCaP cells that overexpress bcl-2 (LNCaPbcl-2/neo-r) were cocultured with hygromycin-resistant LNCaP cells (LNCaPhygr-r). The cocultures were then transiently exposed to serum starvation to induce apoptosis of LNCaPhygr-r cells. Surviving cells were then coselected in medium containing both antibiotics. Whereas monocultures of LNCaPbcl-2/neo-r or LNCaPhygr-r treated this way yielded no colonies, cocultures yielded dual-antibiotic-resistant clones at a frequency of approximately 1 in 105. Pre-exposure to an apoptotic agent was required; cocultures not exposed to serum starvation yielded no dual-selectable colonies. Analysis of DNA extracted from a dual-resistant clone demonstrated that the restriction endonuclease pattern of the neo-r gene was unaltered when compared with the parental LNCaPbcl-2/neo-r. However the hygr-r gene demonstrated an altered restriction endonuclease pattern in the dual-resistant derivative compared with the parental LNCaPhygr-r cell line. This is evidence that genetic information can be transferred from one prostate cancer cell to another through the process of apoptosis, and we term this form of genetic transfer "apoptotic conversion."
 |
Introduction
|
|---|
Viable cells normally maintain an asymmetric distribution of PS3
within the outer membrane; most of the PS residues are oriented toward the inner surface of the plasma membrane. However, during the later stages of apoptosis, this asymmetry is lost, and PS residues appear on the outer surface of the plasma membrane as well (1, 2, 3, 4, 5)
. This biochemical alteration in the membranes of apoptotic cells provides the basis for the use of annexin V binding to identify cells undergoing apoptosis (6
, 7)
. Likewise, this change is known to be a potent inducer of phagocytosis by neighboring cells in a likely attempt to rapidly eliminate the apoptotic cell from the tissue before it can further degrade and activate inflammatory processes (8, 9, 10)
. Indeed, apoptotic bodies are often found in tissues as phagocytic inclusion bodies present in neighboring cells. This phenomenon remains one of the lesser-studied aspects of apoptosis. However, given the manner in which even highly differentiated secretory epithelial cells can be stimulated to become phagocytic by the proximity of an apoptotic body, it is one of the more remarkable components of the programmed cell death process (11, 12, 13, 14)
. Given the extent to which apoptotic cells are removed from tissues by the phagocytic action of parenchymal cells, we wanted to explore the possibility that genetic material might be exchanged between the dying or dead cell and the viable phagocytic partner. To determine this possibility, we developed two different genetically marked clonal variants of the prostate cancer cell line LNCaP. One of these, LNCaPbcl-2/neo-r (15)
, is resistant to neomycin subsequent to transfection with a human bcl-2 expression vector. The high levels of bcl-2 expression in LNCaPbcl-2/neo-r make it extremely resistant to stimuli (as exemplified by serum starvation or exposure to phorbol esters) that readily induce apoptosis in parental LNCaP cells. We also developed a clonal cell line referred to as LNCaPhygr-r by simple transfection of parental LNCaP cells with an expression vector encoding hygromycin resistance. The LNCaPhygr-r cells remain sensitive to serum starvation-induced apoptosis. We then tested whether cocultures of these cells had the potential of producing dual-antibiotic-resistant progeny when they were exposed to a condition that preferentially induces apoptosis of the LNCaPhygr-r cells.
 |
Materials and Methods
|
|---|
Cell Lines.
Parental LNCaP cells were obtained from the American Type Culture Collection (Manassas, VA). The derivation of LNCaPbcl-2/neo-r was described previously (15)
. These cells have been characterized previously, and they are known to be highly resistant to in vitro apoptotic stimuli such as serum starvation or phorbol ester treatment. LNCaPhygr-r cells were derived from the parental LNCaP cells after transfection with an expression plasmid containing the hygromycin resistance gene (Selecta Vecta-hyg; Novagen, Madison, WI). The clonal variant selected for further study was tested for its ability to undergo apoptosis in response to serum starvation and was found to be as sensitive as parental LNCaP cells (15)
. All cell lines described were cloned after selection in antibiotic-containing medium using a cloning ring procedure as described previously (15)
.
Cell Culture Protocol.
Cocultures were established by seeding LNCaPbcl-2/neo-r and LNCaPhygr-r cells at a 1:1 concentration in normal medium, and monolayers were allowed to form for 24 h (cell count at 24 h after seeding was 1.4 million cells/flask). The cocultures were then exposed to a minimum volume (1 ml in a 25-cm2 flask) of serum-free medium (RPMI 1640) for 48 h, a condition that preferentially induces the apoptosis of LNCaPhygr-r cells (15)
. The surviving cells were then washed and incubated with normal medium (containing serum) for an additional 48 h. After this period, the cells were trypsinized and split into three flasks. Selection medium containing both neomycin (Geneticin at a concentration of 400 µg/ml medium; Life Technologies, Inc., Grand Island, NY) and hygromycin B (at a concentration of 150 µg/ml medium; Sigma, St. Louis, MO) was then added, and incubation was continued for 3 weeks (with fresh medium added at 3-day intervals). Colonies were isolated and expanded in selective medium. As controls, each of the cell lines used in this study (i.e., parental LNCaP, LNCaPbcl-2/neo-r, and LNCaPhygr-r) were cultured separately and then treated with the same protocol as the cocultures. Finally, we studied cocultures that were subject to a similar protocol, with the exception that they were never exposed to a period of serum starvation and therefore lacked exposure to an apoptotic stimuli. Colony counts from the cocultures exposed to serum starvation were statistically compared with the control results using the Students t test.
RT-PCR and PCR.
RNA was extracted from clones and parental cell lines using the RNAzole B reagent of Tel-Test, Inc. (Friendswood, TX). DNA was extracted from these cells using a high molecular weight DNA extraction kit (DNA isolation kit; Boehringer Mannheim, Indianapolis, IN).
For cDNA synthesis, an aliquot containing 1 µg of total RNA was added to 0.5 µg of oligodeoxythymidylic acid primer (Life Technologies, Inc.) and brought to a final volume of 20 µl. The samples were placed at 65°C for 5 min and then chilled on ice. The primer-annealed RNA was added to 30 µl of master reaction mixture, so that the final concentrations of the following components were achieved: (a) 1 mM of each deoxynucleotide triphosphate; (b) 50 mM Tris-HCl (pH 8.3); (c) 75 mM KCl; (d) 3 mM MgCl2; (e) 10 mM DTT; and (f) 10 units/reaction of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). The reaction was incubated at 42°C for 15 min, and the enzyme was then heat-inactivated at 95°C for 15 s.
Specific PCR primers were designed from each of the bacterial antibiotic resistance genes (neo-r and hygr-r), based on their available sequences in GenBank using the computer program Oligo (version 4.0; National Biosciences, Plymouth, MN). The primers for these genes were as follows: neo-r gene, GGCTATTCGGCTATGACTGG (5' primer) and TGGTCGAATGGGCAGGTA (3' primer); and (b) hygr-r gene, TTCGGACCGCAAGGAA (5' primer) and AGATGTTGGCGACCTCGTATT (3' primer).
Oligonucleotide primers for human glyceraldehyde-3-phosphate dehydrogenase were obtained from Clonetech, Inc. (Palo Alto, CA). The PCR reaction was done in a total volume of 50 µl containing one-fifth of the reverse transcription reaction, with a final concentration of 20 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each deoxynucleotide triphosphate, 2.5 units of Taq polymerase, and 10 pM of each primer. A total number of 30 cycles were completed with the following specifications: (a) cycle 1, 95°C (4 min); (b) cycles 231, 95°C (1 min), 60°C for neo-r primers and 58°C for hygr-r primers (1 min), and 72°C (1 min); and (c) cycle 32, 72°C (15 min). Aliquots of the reaction were electrophoresed on 2% agarose gels in 40 mM Tris acetate (pH 8.0)/1 mM EDTA buffer. The gels were stained with ethidium bromide, viewed under UV light, and photographed. For PCR, 0.1 µg of DNA was used, and the PCR procedure was the same as that described for the RT-PCR.
Southern Blot Analysis of DNA.
DNAs extracted from the parental cell lines and from the dual-antibiotic-resistant clones were digested to completion with BamHI or NcoI restriction endonucleases (Boehringer Mannheim). The digested DNAs were electrophoresed on a 0.7% agarose gel, and then the DNA was transferred to a nylon membrane (Boehringer Mannheim) by capillary blotting. The Southern blots were probed with 32P-labeled cDNA probes for human PSA, neo-r, or hygr-r that were obtained by PCR amplification of plasmids containing the cDNAs. The probes were labeled with 32P as described previously using the nick translation kit (Boehringer Mannheim). After overnight hybridization to the denatured probes, the blots were washed in a successive series of solutions containing decreasing amounts of SSC, and the filters were exposed to Kodak XAR-5 film to produce an autoradiograph.
 |
Results
|
|---|
The two LNCaP-derivative cell lines (LNCaPbcl-2/neo-r and LNCaPhygr-r) were coseeded into a cell culture plate at a 1:1 ratio. The coculture was exposed for a brief period to serum starvation to selectively induce apoptosis of the LNCaPhygr-r cells. The surviving cells were then exposed to a medium containing both neomycin and hygromycin. After 3 weeks of growth in this dual-selective medium, several colonies were observed in the dishes derived from cocultured treated cells, whereas no colonies were observed in flasks treated similarly that had only monocultures of parental LNCaP cells, LNCaPbcl-2/neo-r cells, or LNCaPhygr-r cells treated in this manner; nor were any colonies present in cocultures that were not pre-exposed to serum starvation. The mean colony number/flask resulting from the cocultures exposed to serum starvation was 7 ± 5. This was found to be statistically different from any of the control cultures (P = 0.02). By dividing the number of apoptosis-resistant LNCaPbcl-2/neo-r cells (the presumed recipient cells) that were present at the time that the apoptotic stimuli was given (24 h after seeding) by the number of colonies formed in dual-selection medium, we estimated the frequency of apoptotic conversion under these conditions to be approximately 1 in 105 LNCaPbcl-2/neo-r cells.
To confirm that the dual-selected clones contained and expressed both drug resistance markers, RT-PCR was performed on RNAs extracted from the parental cells and from several dual-selected clonal derivatives (after more than 10 passages) to amplify the cDNAs encoding neomycin or hygromycin resistance. As shown in Fig. 1A
, neither of these markers was amplified from cDNA of the parental LNCaP line; only one marker (corresponding to the appropriate drug resistance phenotype of the cells) was amplified from the LNCaPbcl-2/neo-r or LNCaPhygr-r cDNAs, whereas both markers were consistently amplified from cDNAs obtained from dual-resistant clones. Similar results were obtained when we directly performed PCR on DNA extracted from each of the cell lines (Fig. 1B)
. These findings indicate that the dual-resistant clones contain and express a genetic marker contributed from each of the parental cell types. Finally, we used Southern blot analysis to determine whether one of the genetic markers might have been preferentially passed to the other cell type. As shown in Fig. 2
, when a Southern blot containing BamHI-restricted DNA was hybridized to cDNA for human PSA, the parental LNCaP cells, LNCaPbcl-2/neo-r, LNCaPhygr-r, and one dual-resistant derivative (LNCaPn/h-4) all showed the presence of the PSA gene in an equivalent hybridization banding pattern. These same DNAs were restricted with NcoI (NcoI does not internally cut the neo-r gene), and the Southern blot made with these DNAs was probed with labeled cDNA for neomycin resistance. As might be expected, only the LNCaPbcl-2/neo-r and LNCaPn/h-4 DNAs hybridized to this probe, and the banding pattern was equivalent between these cells. Likewise, when the BamHI-digested DNAs were probed with labeled cDNA for hygromycin resistance, only the LNCaPhygr-r and LNCaPn/h-4 DNAs hybridized to this probe. However the banding pattern was distinctly different between the LNCaPhygr-r cells present in the original cocultures and the LNCaPn/h-4 cell line that was selected after exposure to both antibiotics. These results suggest that the hygr-r gene marker was disrupted and transferred to a new chromosomal site during the apoptotic process from the LNCaPhygr-r cells to the LNCaPbcl-2/neo-r cells, as we would expect, given our prediction that the LNCaPhygr-r cells would be the apoptotic "donor" cells under these conditions.

View larger version (31K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. PCR amplification of antibiotic resistance markers (neo-r or hygr-r) present in clonal derivatives of the LNCaP cell line. A, RT-PCR amplification of glyceraldehyde-3-phosphate dehydrogenase (G3PDH, top panel), neomycin resistance marker (neo-r, middle panel), or the hygromycin resistance marker (hygr-r, bottom panel) from RNAs extracted from parental LNCaP cells (Lane 1), LNCaPbcl-2/neo-r cells (Lane 2), LNCaPhygr-r cells (Lane 3), or from three different clones selected for dual resistance to neomycin and hygromycin (LNCaPn/h-2-4 cells; Lanes 46). Lane 7 shows PCR amplification of RNA only (RNA was not reverse-transcribed; negative control). B, PCR amplification of the neomycin (neo-r, top panel) or hygromycin resistance marker (hygr-r, bottom panel) from DNAs extracted from parental LNCaP cells (Lane 1), LNCaPbcl-2/neo-r cells (Lane 2), LNCaPhygr-r cells (Lane 3), or from three different clones selected for dual resistance to neomycin and hygromycin (LNCaPn/h-2-4 cells, Lanes 46). Lane 7, PCR amplification of water blank (negative control). Lane M, molecular weight.
|
|

View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Southern blot analysis demonstrates the presence of two genetic markers (neomycin and hygromycin resistance) in dual-selected clones of LNCaP cells. DNA was extracted from parental LNCaP (Lane 1), LNCaPbcl-2/neo-r (Lane 2), LNCaPhygr-r (Lane 3), or LNCaPn/h-4 cells (Lane 4). These DNAs were digested with NcoI (left panel) or BamHI (middle and right panels), electrophoresed, and blotted onto a nylon filter. The Southern blots were hybridized with a 32P-labeled cDNA probe for neomycin resistance (neo-r probe, left panel), hygromycin resistance (hygr-r probe, middle panel), or human PSA (PSA probe, right panel) and exposed to X-ray film for autoradiography.
|
|
 |
Discussion
|
|---|
We have demonstrated here that cocultures of unique, genetically tagged prostate cancer cells can give rise to progeny cells containing both genetic markers when they are exposed to an apoptotic stimuli that preferentially kills one of the cell types in the coculture. We believe this is direct evidence that genetic information can be transferred from one (apoptotic) cell to another by the process of phagocytosis, and we have termed such an event apoptotic conversion. Whereas it is intuitive that such events are likely to occur, given the manner in which the DNA in apoptotic cells is degraded as well as the tendency of apoptotic bodies to be phagocytosed by neighboring cells, we believe that such events are not likely to influence normal cells of the body. Cells in normal adult tissues experiencing apoptosis are not undergoing proliferation, a condition that is generally necessary for the appropriate incorporation and subsequent transmission of genetic information (following standard transfection). However, apoptotic conversion likely has a high potential to lead to genetic transfer of abnormal information among cancer cells in tumors with high rates of apoptosis, such as prostate cancer (16
, 17)
. Given the extensive genetic heterogeneity that has been found among the cancer cells in primary prostate tumors (18)
, it is possible that this process contributes to the acquisition of multiple genetic defects within some of the tumor cells, especially if the cancer patient is treated with a regimen that preferentially induces the apoptosis of only one of the genetic variants present in the tumor. Such an action might also explain the preferential development of more aggressive cancer cell types after therapy that occurs in some cancer patients. Moreover, it is possible that a similar event is responsible for the development of mouse cell-derived tumors in immune-deficient mice that are xenografted with human cancer specimens (19)
.
Additional experiments involving the use of mixed cell types in a tumor xenograft might help show the relevance of this phenomenon to human cancers. However, based on our results, we now propose that apoptotic conversion describes a new means of passing genetic information directly from a dying eukaryotic cell to a living eukaryotic cell, and that this process has the potential to mediate the passage of genetic defects between cancer cells in a tumor.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by T. J. Martell Foundation and by fellowship grants from MSD-Merck (Bourse AFU-MSD 1998, France) and from lAssociation pour la Recherche sur les Tumeurs de la Prostate (ARTP 1996, France). 
2 To whom requests for reprints should be addressed, at Department of Urology, Columbia Presbyterian Medical Center, Atchley Pavilion, 11th Floor, 161 Fort Washington Avenue, New York, NY 10032. Phone: (212) 305-1575; Fax: (212) 305-1564; E-mail: rb46{at}columbia.edu 
3 The abbreviations used are: PS, phosphatidylserine; RT-PCR, reverse transcription-PCR; PSA, prostate-specific antigen. 
Received 8/ 6/99.
Accepted 9/21/99.
 |
REFERENCES
|
|---|
-
Bratton D. L., Fadok V. A., Richter D. A., Kailey J. M., Guthrie L. A., Henson P. M. Appearance of phosphatidylserine on apoptotic cells requires calcium-mediated nonspecific flip-flop and is enhanced by loss of the aminophospholipid translocase. J. Biol. Chem., 272: 26159-26165, 1997.[Abstract/Free Full Text]
-
Emoto K., Toyama-Sorimachi N., Karasuyama H., Inoue K., Umeda M. Exposure of phosphatidylethanolamine on the surface of apoptotic cells. Exp. Cell Res., 232: 430-434, 1997.[Medline]
-
Naito M., Nagashima K., Mashima T., Tsuruo T. Phosphatidylserine externalization is a downstream event of interleukin-1
-converting enzyme family protease activation during apoptosis. Blood, 89: 2060-2066, 1997.[Abstract/Free Full Text]
-
Adayev T., Estephan R., Meserole S., Mazza B., Yurkow E. J., Banerjee P. Externalization of phosphatidylserine may not be an early signal of apoptosis in neuronal cells, but only the phosphatidylserine-displaying apoptotic cells are phagocytosed by microglia. J. Neurochem., 71: 1854-1864, 1998.[Medline]
-
Chan A., Reiter R., Wiese S., Fertig G., Gold R. Plasma membrane phospholipid asymmetry precedes DNA fragmentation in different apoptotic cell models. Histochem. Cell Biol., 110: 553-558, 1998.[Medline]
-
Stuart M. C., Damoiseaux J. G., Frederik P. M., Arends J. W., Reutelingsperger C. P. Surface exposure of phosphatidylserine during apoptosis of rat thymocytes precedes nuclear changes. Eur. J. Cell Biol., 76: 77-83, 1998.[Medline]
-
van Engeland M., Nieland L. J., Ramaekers F. C., Schutte B., Reutelingsperger C. P. Annexin V-affinity assay: a review on an apoptosis detection system based on phosphatidylserine exposure. Cytometry, 31: 1-9, 1998.[Medline]
-
Bevers E. M., Comfurius P., Dekkers D. W., Harmsma M., Zwaal R. F. Regulatory mechanisms of transmembrane phospholipid distributions and pathophysiological implications of transbilayer lipid scrambling. Lupus, 7 (Suppl. 2): S126-S131, 1998.
-
Dini L., Ruzittu M. T., Falasca L. Recognition and phagocytosis of apoptotic cells. Scanning Microsc., 10: 239-251, 1996.[Medline]
-
Shiratsuchi A., Osada S., Kanazawa S., Nakanishi Y. Essential role of phosphatidylserine externalization in apoptosing cell phagocytosis by macrophages. Biochem. Biophys. Res. Commun., 246: 549-555, 1998.[Medline]
-
Franc N. C., Heitzler P., Ezekowitz R. A., White K. Requirement for croquemort in phagocytosis of apoptotic cells in Drosophila. Science (Washington DC), 284: 1991-1994, 1999.[Abstract/Free Full Text]
-
Fadok V. A., Henson P. M. Apoptosis: getting rid of the bodies. Curr. Biol., 8: R693-R695, 1998.[Medline]
-
Ren Y., Savill J. Apoptosis: the importance of being eaten. Cell Death Differ., 5: 563-568, 1998.[Medline]
-
Savill J. Apoptosis. Phagocytic docking without shocking. Nature (Lond.), 392: 442-443, 1998.[Medline]
-
Raffo A. J., Perlman H., Chen M. W., Day M. L., Streitman J. S., Buttyan R. Overexpression of bcl-2 protects prostate cancer cells from apoptosis in vitro and confers resistance to androgen depletion in vivo. Cancer Res., 55: 4438-4445, 1995.[Abstract/Free Full Text]
-
Aihara M., Truong L. D., Dunn J. K., Wheeler T. M., Scardino P. T., Thompson T. C. Frequency of apoptotic bodies positively correlates with Gleason grade in prostate cancer. Hum. Pathol., 25: 797-801, 1994.[Medline]
-
Aihara M., Scardino P. T., Truong L. D., Wheeler T. M., Goad J. R., Yang G., Thompson T. C. The frequency of apoptosis correlates with the prognosis of Gleason grade 3 adenocarcinoma of the prostate. Cancer (Phila.), 75: 522-529, 1995.[Medline]
-
Ruijter E., van de Kaa C., Aalders T., Ruiter D., Miller G., Debruyne F., Schalken J. Heterogeneous expression of E-cadherin and p53 in prostate cancer: clinical implications. BIOMED-II Markers for Prostate Cancer Study Group. Mod. Pathol., 11: 276-281, 1998.[Medline]
-
Gao J., Tombal B., Isaacs J. T. Rapid in situ hybridization technique for detecting malignant mouse cell contamination in human xenograft tissue from nude mice and in vitro cultures from such xenografts. Prostate, 39: 67-70, 1999.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
A. Bergsmedh, J. Ehnfors, K. Kawane, N. Motoyama, S. Nagata, and L. Holmgren
DNase II and the Chk2 DNA Damage Pathway Form a Genetic Barrier Blocking Replication of Horizontally Transferred DNA
Mol. Cancer Res.,
March 1, 2006;
4(3):
187 - 195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bergsmedh, A. Szeles, A.-L. Spetz, and L. Holmgren
Loss of the p21Cip1/Waf1 Cyclin Kinase Inhibitor Results in Propagation of Horizontally Transferred DNA
Cancer Res.,
January 1, 2002;
62(2):
575 - 579.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Chakraborty, S. Sodi, M. Rachkovsky, N. Kolesnikova, J. T. Platt, J. L. Bolognia, and J. M. Pawelek
A Spontaneous Murine Melanoma Lung Metastasis Comprised of Host Tumor Hybrids
Cancer Res.,
May 1, 2000;
60(9):
2512 - 2519.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
V. J. Yuste, J. R. Bayascas, N. Llecha, I. Sanchez-Lopez, J. Boix, and J. X. Comella
The Absence of Oligonucleosomal DNA Fragmentation during Apoptosis of IMR-5 Neuroblastoma Cells. DISAPPEARANCE OF THE CASPASE-ACTIVATED DNase
J. Biol. Chem.,
June 15, 2001;
276(25):
22323 - 22331.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bergsmedh, A. Szeles, M. Henriksson, A. Bratt, M. J. Folkman, A.-L. Spetz, and L. Holmgren
Horizontal transfer of oncogenes by uptake of apoptotic bodies
PNAS,
May 22, 2001;
98(11):
6407 - 6411.
[Abstract]
[Full Text]
[PDF]
|
 |
|