Cancer Research Infection and Cancer: Biology, Therapeutics, and Prevention  Tumor Immunology: New Perspectives
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 5483-5487, November 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, B. A.
Right arrow Articles by Rinker-Schaeffer, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, B. A.
Right arrow Articles by Rinker-Schaeffer, C. W.
[Cancer Research 59, 5483-5487, November 1, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Mitogen-activated Protein Kinase Kinase 4/Stress-activated Protein/Erk Kinase 1 (MKK4/SEK1), a Prostate Cancer Metastasis Suppressor Gene Encoded by Human Chromosome 171

Barbara A. Yoshida, Zita Dubauskas, Marina A. Chekmareva, Thomas R. Christiano, Walter M. Stadler and Carrie W. Rinker-Schaeffer2

Section of Urology, Department of Surgery [B. A. Y., Z. D., M. A. C., T. R. C., C. W. R-S] and Section of Hematology/Oncology, Department of Medicine, [W. M. S.], University of Chicago, and The Prostate Cancer Program, The University of Chicago Cancer Research Center [W. M. S., C. W. R-S.], Chicago, Illinois 60637


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
The introduction of a discontinuous ~70-cM portion of human chromosome 17 significantly suppresses the metastatic ability of AT6.1 rat prostate cancer cells without affecting tumorigenicity (M. A. Chekmareva et al., Prostate, 33: 271–280, 1997). We have recently demonstrated that AT6.1 cells containing the ~70-cM region (AT6.1-17-4 cells) escape from the primary tumor and arrest in the lung but are growth-inhibited unless the metastasis suppressor region is lost (M. A. Chekmareva et al., Cancer Res., 58: 4963–4969, 1998). A series of in vivo studies indicated that the observed growth inhibition was due to the effect of a gene(s) at the metastatic site (M. A. Chekmareva et al., Cancer Res., 58: 4963–4969, 1998). We have now identified the mitogen-activated protein kinase kinase 4/stress-activated protein/Erk kinase 1 (MKK4/SEK1) gene as a candidate metastasis suppressor gene encoded by the ~70-cM region. AT6.1 cells were transfected with a MKK4/SEK1 expression construct, and the cells were tested in standard spontaneous metastasis assays. Whereas the metastatic ability of the AT6.1-MKK4/SEK1 cells was significantly reduced as compared with that of transfection controls, the growth rate of the primary tumors was not affected; the average tumor volume at day 29 after injection was ~2 cm. Furthermore, histological examination of the lungs of AT6.1-MKK4/SEK1 tumor-bearing animals revealed that the suppression by MKK4/SEK1 is due to an effect at the metastatic site, consistent with the phenotype conferred by the original ~70-cM chromosomal region. These studies implicate MKK4/SEK1 as a metastasis suppressor gene encoded by human chromosome 17.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Despite significant advances in our understanding of the fundamental aspects of cancer, the development of metastatic lesions remains the predominant cause of death for most cancer patients. The development of metastases requires a cell to complete a series of well-established steps. In brief, a metastatic cell must escape from the primary tumor, enter the circulation, arrest in the microcirculation, invade into a tissue compartment, and grow. There is growing evidence that loss of metastasis suppressor gene function is an important event during the progression toward a malignant phenotype (1, 2, 3, 4) . We have recently demonstrated metastasis suppressor activity encoded by a ~70-cM portion of human chromosome 17 consisting of three conserved regions: (a) (D17S952->D17S805); (b) D17S930->D17S797; and (c) D17S944->qter). Specifically, the introduction of the ~70-cM region significantly suppresses the spontaneous metastatic ability of AT6.1 rat prostate cancer cells, without affecting tumorigenicity (5) . In this case, tumor cells are injected s.c. into the flank of an animal, and spontaneous metastatic ability is defined as the ability of the cells to disseminate from the primary tumor and form macroscopic foci at a secondary site. The metastasis suppressor activity encoded by this region is distinct from that of previously identified metastasis suppressor activities in that it regulates the growth of metastases at the secondary site, the lung, potentially by inducing a state of dormancy (6) . In addition, in vivo studies demonstrated that the growth inhibition of these cells is due to an effect mediated at the site of metastasis and not from the action of a circulating inhibitory factor (6) . Taken together, these observations suggest that expression of a gene(s) encoded by the ~70-cM suppressor region inhibits the progressive growth of AT6.1-17-4 micrometastases in a context (tissue)-dependent manner.

A combination of complementary approaches were used to identify genes differentially expressed by parental, AT6.1, and metastasis-suppressed AT6.1-17-4 cells. MKK4/SEK1 was identified as a candidate metastasis suppressor gene that is specifically expressed by AT6.1-17-4 cells and that has been determined to be located within the ~70-cM metastasis suppressor region at 17p12 (7) . In this study, we demonstrate that transfection of the MKK4/SEK1 cDNA into highly metastatic AT6.1 cells results in a suppressed phenotype consistent with that conferred by the ~70-cM region of human chromosome 17.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Cell Lines.
The AT6.1 cell line is a highly metastatic, androgen-independent rat prostatic cancer cell line established from a lung metastasis that developed spontaneously during the serial passage of the nonmetastatic, well-differentiated, androgen-responsive, Dunning R 3327-H rat prostatic cancer (8) . The AT6.1-17-4 cell line was generated by the microcell transfer of human chromosome 17 into AT6.1 cells and is suppressed in its ability to metastasize (5 , 6) . All cell lines were grown in standard DMEM supplemented with 8% FCS/100 units/ml penicillin/100 µg/ml streptomycin (Life Technologies, Inc., Gaithersburg, MD) and 250 nM dexamethasone (Sigma, St. Louis, MO) at 37°C in an atmosphere of 5% CO2. In addition, 500 µg/ml G418 was added to cultures of AT6.1-17-4 cells and AT6.1-pcDNA3 and AT6.1-MKK4/SEK1 transfected clones.

Identification of MKK4/SEK1 as a Candidate Metastasis Suppressor Gene Encoded by the ~70-cM Region.
A search of genome databases identified a series of genes and ESTs3 located within the metastasis suppressor region. Genes whose known biological function suggested a potential role in metastasis suppression were selected as candidates, and ESTs that were redundant or reported to have restricted tissue expression were eliminated from further consideration. In addition, cDNA sequences specifically expressed in metastasis-suppressed AT6.1-17-4 cells were identified by the differential hybridization of AT6.1- and AT6.1-17-4-specific cDNA probes, generated using subtractive hybridization/suppression PCR (PCR-Select cDNA Subtraction Kit; Clontech, Palo Alto, CA), with a commercially available cDNA array blot (Clontech). RT-PCR was performed to assess the expression of the ESTs and cDNAs identified as potential candidates. Candidates that were not retained in AT6.1-17-4 cells or specifically expressed by AT6.1-17-4 cells and normal prostate tissue were eliminated from further consideration.

Transfections.
AT6.1 cells were transfected with plasmid vector pcDNA3 (Invitrogen, Carlsbad, CA), either alone or containing the cDNA for MKK4/SEK1 (construct provided by R. J. Davis, Howard Hughes Medical Institute, University of Massachusetts, Worcester, MA) using LipofectAMINE reagent (Life Technologies, Inc.). Briefly, cells were grown to ~60% confluence in 6-cm tissue culture dishes, rinsed twice with serum-free medium, overlaid with a mixture of 2 µg of DNA and 10 µl of LipofectAMINE reagent diluted in serum-free medium, and incubated at 37°C in 5% CO2/95% air for 18 h. The transfection medium was then replaced with fresh medium, and 36 h later, the cells were harvested, diluted in growth medium containing 500 µg/ml G418, and split 1:30 for the selection and establishment of clonal cell lines.

PCR Analyses.
The expression of human MKK4/SEK1 in AT6.1 and AT6.1-17-4 cells was examined by PCR amplification from samples of double-stranded cDNA. cDNA was prepared from AT6.1 parental cells and metastasis-suppressed AT6.1-17-4 cells using the RiboClone system cDNA synthesis kit (Promega, Madison, WI). Commercially available cDNA from noncancerous human prostate tissue (Clontech) was used as a positive control, and a water-blank was run as a negative control (data not shown). Reactions for the detection of glyceraldehyde-3-phosphate dehydrogenase cDNA were performed to control for the integrity of the samples. Approximately 500 ng of cDNA were used for each amplification reaction. The EST/primer pair, TIGR-A003B48 (Research Genetics, Huntsville, AL), was used for the amplification of human MKK4/SEK1 cDNA, and glyceraldehyde-3-phosphate dehydrogenase primers were obtained from Clontech. The expression of rat MKK4/SEK1 was also examined by PCR. Approximately 1 µg of cDNA prepared from rat AT6.1 cells was analyzed in parallel with cDNA from adult rat prostate tissue (a gift of G. S. Prins, University of Illinois, Chicago, IL). The following primers were used to amplify rat MKK4/SEK1: 5'-GCAACTGTGAAAGCACTAAACC and 5'-CATGTATGGCCTACAGCCAG. {beta}-Actin was amplified using the primers XAHR17 and XAHR20 (Research Genetics). The PCR product generated with the MKK4/SEK1-specific primers was subcloned and sequenced to confirm its identity. The partial cDNA sequence obtained, GCTTGCAACTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAA-AATTATTCACAGAGACATCAAACCTTCCAATATTCTTCTGGACAGGAGTGGAAATATAAAGCTCTGTGACTTCGGCATCAGTGGACAGCTCGTGGACTCTATTGCCAAGACGAGAGATGCTGGCTGTAGGCCATACATGAAG, is 96% identical with the human MKK4/SEK1 sequence in the aligned region. The expression of MKK4/SEK1 message in AT6.1-transfected clones was assessed by RT-PCR. Approximately 500 ng of poly(A)+ RNA was used for each reaction and run in duplicate, with and without the addition of reverse transcriptase. The primers, 5'-GACTACAAAGACGATGACGACAAG and 5'-AATCCCAGTGTTGTTCAGGG, are specific for the human MKK4/SEK1 transgene. The identity of the PCR product obtained was confirmed by automated DNA sequencing.

Spontaneous Metastasis Assays.
To characterize the in vivo growth rate and metastatic ability of the transfected clones, 4–6-week-old CB17 severe combined immunodeficient mice (Taconic Laboratory Animals and Services, Germantown, NY) were injected s.c. in the flank with 2 x 105 cells. Three independent clonal lines of both the MKK4/SEK1 and the vector control transfectants were tested in a total of five to eight animals each in two separate experiments. The tumor volume was determined as an index of the tumor growth rate as described previously (5) . At 42 days after injection, animals were sacrificed, the lungs were excised, and fixed in 10% formalin, and the number of macroscopic metastases (>1 mm) was counted while being viewed through a dissection scope. The significance of the data was determined using the nonparametric, Mann-Whitney {alpha}-test.

Histology.
The lungs of tumor-bearing mice were fixed in 10% buffered formalin and embedded in paraffin. Six random discontinuous 5-µm sections were taken and stained with H&E (University of Chicago Histology Laboratory, Chicago, IL).


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Our strategy to identify the gene encoded by the ~70-cM portion responsible for the observed metastasis suppression included complementary candidate gene/EST and differential expression approaches. Initially, genes with a physical location on chromosome 17 and a known biological function suggesting a potential role in metastasis suppression were examined. A stringent set of rules was established to prioritize the testing of candidate genes. In brief, putative candidate genes that were not specifically retained or expressed by AT6.1-17-4 cells and normal prostate tissue were eliminated from further consideration. More than 50 candidate genes and ESTs were identified and evaluated as potential candidates (1 , 5) . We identified MKK4/SEK1 as a candidate gene based on its physical location, 17p11.2, within the ~70-cM metastasis suppressor region, and the fact that its normal cellular function within the stress-activated signaling pathway suggests that alteration of this gene may have pleiotrophic effects on the cell (9) . To assess the potential of MKK4/SEK1 as a candidate metastasis suppressor gene in our model, PCR analyses were performed to examine its expression in AT6.1-17-4 and AT6.1 cells. Using a primer pair specific for the human gene, MKK4/SEK1 was found to be expressed in metastasis-suppressed AT6.1-17-4 cells and normal human prostate tissues but was not expressed in the parental AT6.1 cells (Fig. 1A)Citation . Thus, MKK4/SEK1 demonstrates the expression profile required of a candidate gene.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. MKK4/SEK1 expression in AT6.1 cells. A, the expression of human MKK4/SEK1 was examined by PCR. AT6.1 cDNA (500 ng) was analyzed in parallel with cDNA from AT6.1-17-4 cells and commercially available cDNA from noncancerous human prostate tissue. B, the expression of rat MKK4/SEK1 was examined by PCR. AT6.1 cDNA (1 µg) was analyzed in parallel with cDNA from adult rat prostate tissue (positive control). The rat MKK4/SEK1 PCR product was subcloned and sequenced to confirm its identity.

 
In the simplest scenario, the metastasis suppression we observe results from the expression of human MKK4/SEK1, which complements a defect in AT6.1 cells. If this is true, we predicted that there may be a loss of inactivation of the endogenous MKK4/SEK1 gene in metastatic AT6.1 cells. In support of this notion, the expression of endogenous rat MKK4/SEK1 was assessed by PCR analysis and was detected in cDNA prepared from normal adult rat prostate tissue, but not in cDNA prepared from AT6.1 cells (Fig. 1B)Citation .

Based on the aforementioned results and our previous finding that a gene encoded by the ~70-cM region regulates the growth of metastases at the secondary site, we formulated the following working hypothesis. In the lung, parental AT6.1 cells, which do not express the endogenous MKK4/SEK1 gene, fail to respond to stress stimuli and are therefore able to proliferate and form macroscopic metastases within 42 days of injection (6) . In contrast, in AT6.1-17-4 cells, expression of the human MKK4/SEK1 gene complements this defect, restoring the ability of the disseminated AT6.1-17-4 cells to respond to stress stimuli, thus inhibiting their metastatic colonization. If this hypothesis is correct, then AT6.1 parental cells transfected with MKK4/SEK1 cDNA should exhibit a metastasis-suppressed phenotype similar to that of AT6.1-17-4 cells. As a first step in testing this hypothesis, AT6.1 cells were transfected with a constitutive expression construct containing MKK4/SEK1 cDNA [a generous gift from Dr. Roger Davis, Howard Hughes Medical Institute, University of Massachusetts, Worcester, MA (10) ]. Stable transfectants were selected, and expression of the transgene was confirmed by RT-PCR. Three AT6.1-MKK4/SEK1 clonal cell lines that expressed the transgene (Fig. 2)Citation were tested for metastatic ability in spontaneous metastasis assays in severe combined immunodeficient mice (Table 1)Citation . AT6.1, AT6.1-17-4, and AT6.1pcDNA3 (vector-only transfectants) served as controls. As shown in Table 1Citation , there was no significant difference between the tumor doubling times of AT6.1-MKK4/SEK1 and control tumors. In contrast, there was a significant reduction in the number of macroscopic lung metastases in the mice carrying AT6.1-MKK4/SEK1 tumors as compared with the lungs from AT6.1- and AT6.1-pcDNA3 tumor bearers (Table 1Citation , Figure 3, A and BCitation ). Such results are consistent with the definition of metastasis suppressor genes, which, unlike tumor suppressor genes, inhibit the formation of metastases without affecting the growth of the primary tumor.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Expression of the human MKK4/SEK1 transgene in AT6.1 transfectants. AT6.1 cells were transfected with either an expression construct containing human MKK4/SEK1 cDNA or vector, pcDNA3 alone. The expression of MKK4/SEK1 message in AT6.1-transfected clones was assessed by RT-PCR. Poly(A)+RNA (500 ng) was used for each reaction and run in duplicate with and without the addition of reverse transcriptase (RT, + and -, respectively). The primers used are specific for the human MKK4/SEK1 transgene. The identity of the PCR product obtained was confirmed by automated DNA sequencing.

 

View this table:
[in this window]
[in a new window]
 
Table 1 Reduced metastatic ability of AT6.1 rat prostate cancer cells after transfection with human MKK4/SEK1 cDNAa

 


View larger version (137K):
[in this window]
[in a new window]
 
Fig. 3. In vivo biology of AT6.1-MKK4/SEK1-transfected cells. Representative lungs are shown from mice at 42 days after s.c. injection of 2 x 105 cells. A, lungs shown are from mice bearing AT6.1 or AT6.1-pcDNA3 tumors. B, lungs shown are from mice bearing AT6.1-17-4 or AT6.1-MKK4/SEK1 transfected tumors. Arrows, macrometastatic foci. C, H&E-stained histological sections of formalin-fixed lungs from tumor-bearing mice. Arrows, micrometastatic foci. Representative fields are shown at either x20 (AT6.1-pcDNA3 cl 2) or x40.

 
As discussed previously, metastasis suppression conferred by the ~70-cM region of chromosome 17 is mediated at the secondary site. Cells containing this region escape from the primary tumor and arrest in the lung, but they are growth-inhibited unless the ~70-cM region is lost (6) . If MKK4/SEK1 is working through the same mechanism, then micrometastatic foci should be present in the lungs of mice bearing AT6.1-MKK4/SEK1 tumors. To address this issue, histological sections were prepared from the lungs of tumor-bearing animals and examined for the presence of micrometastatic foci (Fig 3C)Citation . Lungs from control mice with AT6.1-pcDNA3 tumors had large metastatic foci of >=1000 cells (Fig. 3CCitation , left panel). In contrast, lungs from mice bearing AT6.1-MKK4/SEK1 tumors contained small foci with <=500 cells (Fig. 3CCitation , center and right panels). In addition, cuffs of cells approximately two to three layers thick were observed around blood vessels in several of the sections from the AT6.1-MKK4/SEK1 samples (Fig. 3CCitation , center panel), suggesting that the tumor cells may coopt existing host vasculature for growth (11) . These results demonstrate that expression of MKK4/SEK1 cDNA in AT6.1 cells can recapitulate the dormant phenotype conferred by the ~70-cM region of chromosome 17 (6) .

The use of complementary biological (in vivo) and molecular (gene discovery) approaches enabled us to identify MKK4/SEK1 as a candidate metastasis suppressor gene encoded by human chromosome 17. Interestingly, previous studies had identified MKK4/SEK1 as a candidate tumor suppressor gene (12 , 13) . These studies, which used traditional positional cloning approaches, identified homozygous deletions and other inactivating mutations in MKK4/SEK1 in a small percentage of lung, pancreatic, and breast cancer cell lines and/or xenografts (12 , 13) . Importantly, Su et al. (12) found that MKK4/SEK1 can be an independent target for loss of heterozygosity; its inactivation is not just the by-product of large deletions of the nearby p53 gene. Recent studies using transgenic approaches found that disruption of the MKK4/SEK1 gene caused embryonic death in mice, demonstrating a requirement for MKK4/SEK1 in development (reviewed in Ref. 9 ). These studies also included analyses of cells with a homozygous deficiency in MKK4/SEK1 and demonstrated that it is required for the normal regulation of cellular responses to environmental stress. To our knowledge, ours is the first study that has identified a functional role for MKK4/SEK1 in the regulation of metastasis. We are currently examining the importance of deletions and/or mutations of MKK4/SEK1 in human prostate cancer metastases.

Taken together, the known role of MKK4/SEK1 as a mediator of extracellular stress stimuli and the in vivo biology exhibited by MKK4/SEK1-transfected AT6.1 cells (i.e. dormant micrometastases) support our working hypothesis: that expression of the MKK4/SEK1 gene compliments a defect in AT6.1 cells, thus restoring the ability of the disseminated AT6.1-MKK4/SEK1 cells to respond to stress stimuli and inhibiting metastatic colonization. Whereas it is tempting to speculate on the mechanism of action of MKK4/SEK1 in contributing to the dormant phenotype, adequate examination of how it suppresses the growth of disseminated micrometastases will require the construction of appropriate biochemical constructs and, most importantly, the identification of in vitro conditions that will enable us to conduct relevant signaling studies. These studies are currently underway.

The immediate goal of our research efforts is to identify new molecular markers that will enhance our ability to diagnose and treat prostate cancer (1) . It is hoped that these studies will also provide information fundamental to our understanding of what factors regulate the growth of prostate cancer metastases. Such information is of particular importance in light of the increased emphasis on the early detection of prostate cancer (14) . Ultrasensitive methods to detect prostate cancer cells in the circulation and bone marrow of patients have recently been developed (reviewed in Ref. 6 ). The relevance of such cells is unclear, however, because there is a real possibility that such disseminated cells may remain dormant, requiring additional genetic or epigenetic changes to become life-threatening (6) . Whereas much of the current literature concerning micrometastatic dormancy has focused on the inhibition of angiogenesis, it is important to note that dormancy can result from other phenomena including cellular quiescence, diminished cellular doubling time, and immunological surveillance (15) . Taken together, our data indicate that expression of MKK4/SEK1 is likely to affect the growth of micrometastases at a point before the potential induction of angiogenesis (6) . Future in vivo studies will focus on the elucidation of biological mechanism(s) through which MKK4/SEK1 induces dormancy, as well as the identification of factors that trigger the context-dependent growth inhibition of AT6.1-MKK4/SEK1 micrometastases.


    ACKNOWLEDGMENTS
 
We thank Dr. Gail S. Prins for the adult rat prostate cDNA library, Dr. Roger J. Davis for the MKK4 cDNA construct, and Drs. Marsha R. Rosner and Mitchell Sokoloff for helpful discussion and constructive criticism of the manuscript. We offer special thanks to Dr. Dan Hui. We are also grateful to the contributors of the RESearch CUre and Education Fund and to Dr. Charles B. Brendler for enthusiastic support of this work.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by American Cancer Society Institutional Grant IGR41-35-3, NIH Grant P20 CA 66132, a University of Chicago Surgery Research Committee Grant, Cancer Research Foundation Young Investigator Award, and NIH First Award R29 CA69487 02 (to C. W. R.-S.), American Foundation for Urologic Disease (B. A. Y., C. W. R-S.) and University of Chicago RESearch CUre and Education Fund (B. A. Y., Z. D., M. A. C.). Back

2 To whom requests for reprints should be addressed, at Section of Urology, Department of Surgery, University of Chicago, 5841 South Maryland MC6038, Chicago, IL 60637. Phone (312) 702-3140; Fax: (312) 702-1001; E-mail: crinker{at}surgery.bsd.uchicago.edu Back

3 The abbreviations used are: EST, expressed sequence tag; RT-PCR, reverse transcription-PCR. Back

Received 7/19/99. Accepted 9/20/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Yoshida B. A., Chekmareva M. A., Wharam J. F., Kadkhodaian M., Stadler W. M., Boyer A., Watabe K., Nelson J. B., Rinker-Schaeffer C. W. Prostate cancer metastasis-suppressor genes: a current perspective. In Vivo, 12: 49-58, 1998.[Medline]
  2. Dong J. T., Lamb P. W., Rinker-Schaeffer C. W., Vukanovic J., Ichikawa T., Isaacs J. T., Barrett J. C. KAI1, a metastasis suppressor gene for prostate cancer on human chromosome 11p11.2. Science (Washington, 268: 884-886, 1995.[Abstract/Free Full Text]
  3. Lee J. H., Miele M. E., Hicks D. J., Phillips K. K., Trent J. M., Weissman B. E., Welch D. R. KiSS-1, a novel human malignant melanoma metastasis-suppressor gene. J. Natl. Cancer Inst., 88: 1731-1737, 1996.[Abstract/Free Full Text]
  4. Steeg P. S., de la Rosa A., Flatow U., MacDonald N. J., Benedict M., Leone A. Nm23 and breast cancer metastasis. Breast Cancer Res. Treat., 25: 175-187, 1993.[Medline]
  5. Chekmareva M. A., Hollowell C. M., Smith R. C., Davis E. M., LeBeau M. M., Rinker-Schaeffer C. W. Localization of prostate cancer metastasis-suppressor activity on human chromosome 17. Prostate, 33: 271-280, 1997.[Medline]
  6. Chekmareva M. A., Kadkhodaian M. M., Hollowell C. M., Kim H., Yoshida B. A., Luu H. H., Stadler W. M., Rinker-Schaeffer C. W. Chromosome 17-mediated dormancy of AT6.1 prostate cancer micrometastases. Cancer Res., 58: 4963-4969, 1998.[Abstract/Free Full Text]
  7. Rampoldi L., Zimbello R., Bortoluzzi S., Tiso N., Valle G., Lanfranchi G., Danieli G. A. Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet. Cell Genet., 78: 301-303, 1997.[Medline]
  8. Ichikawa T., Ichikawa Y., Dong J., Hawkins A. L., Griffin C. A., Isaacs W. B., Oshimura M., Barrett J. C., Isaacs J. T. Localization of metastasis suppressor gene(s) for prostatic cancer to the short arm of human chromosome 11. Cancer Res., 52: 3486-3490, 1992.[Abstract/Free Full Text]
  9. Davis R. J. Signal transduction by the c-Jun N-terminal kinase. Biochem. Soc. Symp., 64: 1-12, 1999.[Medline]
  10. Derijard B., Raingeaud J., Barrett T., Wu I. H., Han J., Ulevitch R. J., Davis R. J. Independent human MAP-kinase signal transduction pathways defined by MEK and MKK isoforms. Science (Washington DC), 267: 682-685, 1995.[Abstract/Free Full Text]
  11. Holash J., Maisonpierre P. C., Compton D., Boland P., Alexander C. R., Zagzag D., Yancopoulos G. D., Wiegand S. J. Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science (Washington DC), 284: 1994-1998, 1999.[Abstract/Free Full Text]
  12. Su G. H., Hilgers W., Shekher M. C., Tang D. J., Yeo C. J., Hruban R. H., Kern S. E. Alterations in pancreatic, biliary, and breast carcinomas support MKK4 as a genetically targeted tumor suppressor gene. Cancer Res., 58: 2339-2342, 1998.[Abstract/Free Full Text]
  13. Teng D. H., Perry W. L., III, Hogan J. K., Baumgard M., Bell R., Berry S., Davis T., Frank D., Frye C., Hattier T., Hu R., Jammulapati S., Janecki T., Leavitt A., Mitchell J. T., Pero R., Sexton D., Schroeder M., Su P. H., Swedlund B., Kyriakis J. M., Avruch J., Bartel P., Wong A. K., Oliphant A., Thomas A., Skolnick M. H., Tavtigan S. V. Human mitogen-activated protein kinase kinase 4 as a candidate tumor suppressor. Cancer Res., 57: 4177-4182, 1997.[Abstract/Free Full Text]
  14. Isaacs J. T. Molecular markers for prostate cancer metastasis. Developing diagnostic methods for predicting the aggressiveness of prostate cancer. Am. J. Pathol., 150: 1511-1521, 1997.[Medline]
  15. Wheelock E. F., Weinhold K. J., Levich J. The tumor dormant state. Adv. Cancer Res., 34: 107-140, 1981.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
G. Sethi, K. S. Ahn, D. Xia, J. M. Kurie, and B. B. Aggarwal
Targeted Deletion of MKK4 Gene Potentiates TNF-Induced Apoptosis through the Down-Regulation of NF-{kappa}B Activation and NF-{kappa}B-Regulated Antiapoptotic Gene Products
J. Immunol., August 1, 2007; 179(3): 1926 - 1933.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Xia, H. Srinivas, Y.-h. Ahn, G. Sethi, X. Sheng, W. K. A. Yung, Q. Xia, P. J. Chiao, H. Kim, P. H. Brown, et al.
Mitogen-activated Protein Kinase Kinase-4 Promotes Cell Survival by Decreasing PTEN Expression through an NF{kappa}B-dependent Pathway
J. Biol. Chem., February 9, 2007; 282(6): 3507 - 3519.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-Y. Wang, M. Iordanov, and Q. Zhang
c-Jun NH2-terminal Kinase Promotes Apoptosis by Down-regulating the Transcriptional Co-repressor CtBP
J. Biol. Chem., November 17, 2006; 281(46): 34810 - 34815.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. J. Strock, J.-I. Park, E. K. Nakakura, G. S. Bova, J. T. Isaacs, D. W. Ball, and B. D. Nelkin
Cyclin-dependent kinase 5 activity controls cell motility and metastatic potential of prostate cancer cells.
Cancer Res., August 1, 2006; 66(15): 7509 - 7515.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. W. Rinker-Schaeffer, J. P. O'Keefe, D. R. Welch, and D. Theodorescu
Metastasis Suppressor Proteins: Discovery, Molecular Mechanisms, and Clinical Application.
Clin. Cancer Res., July 1, 2006; 12(13): 3882 - 3889.
[Full Text] [PDF]


Home page
Cancer Res.Home page
S. C. Cunningham, E. Gallmeier, T. Hucl, D. A. Dezentje, E. S. Calhoun, G. Falco, K. Abdelmohsen, M. Gorospe, and S. E. Kern
Targeted Deletion of MKK4 in Cancer Cells: A Detrimental Phenotype Manifests as Decreased Experimental Metastasis and Suggests a Counterweight to the Evolution of Tumor-Suppressor Loss
Cancer Res., June 1, 2006; 66(11): 5560 - 5564.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
D. Gioeli, B. E. Black, V. Gordon, A. Spencer, C. T. Kesler, S. T. Eblen, B. M. Paschal, and M. J. Weber
Stress Kinase Signaling Regulates Androgen Receptor Phosphorylation, Transcription, and Localization
Mol. Endocrinol., March 1, 2006; 20(3): 503 - 515.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Hickson, D. Huo, D. J. Vander Griend, A. Lin, C. W. Rinker-Schaeffer, and S. D. Yamada
The p38 Kinases MKK4 and MKK6 Suppress Metastatic Colonization in Human Ovarian Carcinoma
Cancer Res., February 15, 2006; 66(4): 2264 - 2270.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Vander Griend, M. Kocherginsky, J. A. Hickson, W. M. Stadler, A. Lin, and C. W. Rinker-Schaeffer
Suppression of Metastatic Colonization by the Context-Dependent Activation of the c-Jun NH2-Terminal Kinase Kinases JNKK1/MKK4 and MKK7
Cancer Res., December 1, 2005; 65(23): 10984 - 10991.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Uhlirova, H. Jasper, and D. Bohmann
Non-cell-autonomous induction of tissue overgrowth by JNK/Ras cooperation in a Drosophila tumor model
PNAS, September 13, 2005; 102(37): 13123 - 13128.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H.-Y. Lee, S.-H. Oh, Y.-A. Suh, J. H. Baek, V. Papadimitrakopoulou, S. Huang, and W. K. Hong
Response of Non-Small Cell Lung Cancer Cells to the Inhibitors of Phosphatidylinositol 3-Kinase/Akt- and MAPK Kinase 4/c-Jun NH2-Terminal Kinase Pathways: An Effective Therapeutic Strategy for Lung Cancer
Clin. Cancer Res., August 15, 2005; 11(16): 6065 - 6074.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
N Nathoo, A Chahlavi, G H Barnett, and S A Toms
Pathobiology of brain metastases
J. Clin. Pathol., March 1, 2005; 58(3): 237 - 242.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W. Xin, K. J. Yun, F. Ricci, M. Zahurak, W. Qiu, G. H. Su, C. J. Yeo, R. H. Hruban, S. E. Kern, and C. A. Iacobuzio-Donahue
MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course
Clin. Cancer Res., December 15, 2004; 10(24): 8516 - 8520.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Aguirre-Ghiso, L. Ossowski, and S. K. Rosenbaum
Green Fluorescent Protein Tagging of Extracellular Signal-Regulated Kinase and p38 Pathways Reveals Novel Dynamics of Pathway Activation during Primary and Metastatic Growth
Cancer Res., October 15, 2004; 64(20): 7336 - 7345.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
P. S. Steeg
PERSPECTIVES ON CLASSIC ARTICLES: Metastasis Suppressor Genes
J Natl Cancer Inst, March 17, 2004; 96(6): E4 - E4.
[Full Text]


Home page
Sci SignalHome page
D. J. Vander Griend and C. W. Rinker-Schaeffer
A New Look at an Old Problem: The Survival and Organ-Specific Growth of Metastases
Sci. Signal., January 20, 2004; 2004(216): pe3 - pe3.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. T. Ho, A. J. Bardwell, M. Abdollahi, and L. Bardwell
A Docking Site in MKK4 Mediates High Affinity Binding to JNK MAPKs and Competes with Similar Docking Sites in JNK Substrates
J. Biol. Chem., August 29, 2003; 278(35): 32662 - 32672.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-Y. Lee, H. Srinivas, D. Xia, Y. Lu, R. Superty, R. LaPushin, C. Gomez-Manzano, A. M. Gal, G. L. Walsh, T. Force, et al.
Evidence That Phosphatidylinositol 3-Kinase- and Mitogen-activated Protein Kinase Kinase-4/c-Jun NH2-terminal Kinase-dependent Pathways Cooperate to Maintain Lung Cancer Cell Survival
J. Biol. Chem., June 20, 2003; 278(26): 23630 - 23638.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
D. R. Welch and K. W. Hunter
A New Member of the Growing Family of Metastasis Suppressors Identified in Prostate Cancer
J Natl Cancer Inst, June 18, 2003; 95(12): 839 - 841.
[Full Text] [PDF]


Home page
Genes Dev.Home page
N. J. Kennedy, H. K. Sluss, S. N. Jones, D. Bar-Sagi, R. A. Flavell, and R. J. Davis
Suppression of Ras-stimulated transformation by the JNK signal transduction pathway
Genes & Dev., March 1, 2003; 17(5): 629 - 637.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. F. Goldberg, M. E. Miele, N. Hatta, M. Takata, C. Paquette-Straub, L. P. Freedman, and D. R. Welch
Melanoma Metastasis Suppression by Chromosome 6: Evidence for a Pathway Regulated by CRSP3 and TXNIP
Cancer Res., January 15, 2003; 63(2): 432 - 440.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. D. Yamada, J. A. Hickson, Y. Hrobowski, D. J. Vander Griend, D. Benson, A. Montag, T. Karrison, D. Huo, J. Rutgers, S. Adams, et al.
Mitogen-activated Protein Kinase Kinase 4 (MKK4) Acts as a Metastasis Suppressor Gene in Human Ovarian Carcinoma
Cancer Res., November 15, 2002; 62(22): 6717 - 6723.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H.-Y. Lee, Y.-A. Suh, J. I. Lee, K. A. Hassan, L. Mao, T. Force, B. E. Gilbert, T. Jacks, and J. M. Kurie
Inhibition of Oncogenic K-ras Signaling by Aerosolized Gene Delivery in a Mouse Model of Human Lung Cancer
Clin. Cancer Res., September 1, 2002; 8(9): 2970 - 2975.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y.-Q. Wu, H. Chen, M. A. Rubin, K. J. Wojno, and K. A. Cooney
Loss of Heterozygosity of the Putative Prostate Cancer Susceptibility Gene HPC2/ELAC2 Is Uncommon in Sporadic and Familial Prostate Cancer
Cancer Res., December 1, 2001; 61(24): 8651 - 8653.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. W. Hunter, K. W. Broman, T. L. Voyer, L. Lukes, D. Cozma, M. T. Debies, J. Rouse, and D. R. Welch
Predisposition to Efficient Mammary Tumor Metastatic Progression Is Linked to the Breast Cancer Metastasis Suppressor Gene Brms1
Cancer Res., December 1, 2001; 61(24): 8866 - 8872.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
G. G. Meadows, H. Zhang, and X. Ge
Specific Amino Acid Deficiency Alters the Expression of Genes in Human Melanoma and Other Tumor Cell Lines
J. Nutr., November 1, 2001; 131(11): 3047S - 3050.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. L. Kim, D. J. Vander Griend, X. Yang, D. A. Benson, Z. Dubauskas, B. A. Yoshida, M. A. Chekmareva, Y. Ichikawa, M. H. Sokoloff, P. Zhan, et al.
Mitogen-activated Protein Kinase Kinase 4 Metastasis Suppressor Gene Expression Is Inversely Related to Histological Pattern in Advancing Human Prostatic Cancers
Cancer Res., April 1, 2001; 61(7): 2833 - 2837.
[Abstract] [Full Text]


Home page
JNCI J Natl Cancer InstHome page
B. A. Yoshida, M. M. Sokoloff, D. R. Welch, and C. W. Rinker-Schaeffer
Metastasis-Suppressor Genes: a Review and Perspective on an Emerging Field
J Natl Cancer Inst, November 1, 2000; 92(21): 1717 - 1730.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yoshida, B. A.
Right arrow Articles by Rinker-Schaeffer, C. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yoshida, B. A.
Right arrow Articles by Rinker-Schaeffer, C. W.


HOME HELP FEEDBACK