| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Section of Urology, Department of Surgery [B. A. Y., Z. D., M. A. C., T. R. C., C. W. R-S] and Section of Hematology/Oncology, Department of Medicine, [W. M. S.], University of Chicago, and The Prostate Cancer Program, The University of Chicago Cancer Research Center [W. M. S., C. W. R-S.], Chicago, Illinois 60637
| ABSTRACT |
|---|
|
|
|---|
70-cM portion of human chromosome 17 significantly suppresses the metastatic ability of AT6.1 rat prostate cancer cells without affecting tumorigenicity (M. A. Chekmareva et al., Prostate, 33: 271280, 1997). We have recently demonstrated that AT6.1 cells containing the
70-cM region (AT6.1-17-4 cells) escape from the primary tumor and arrest in the lung but are growth-inhibited unless the metastasis suppressor region is lost (M. A. Chekmareva et al., Cancer Res., 58: 49634969, 1998). A series of in vivo studies indicated that the observed growth inhibition was due to the effect of a gene(s) at the metastatic site (M. A. Chekmareva et al., Cancer Res., 58: 49634969, 1998). We have now identified the mitogen-activated protein kinase kinase 4/stress-activated protein/Erk kinase 1 (MKK4/SEK1) gene as a candidate metastasis suppressor gene encoded by the
70-cM region. AT6.1 cells were transfected with a MKK4/SEK1 expression construct, and the cells were tested in standard spontaneous metastasis assays. Whereas the metastatic ability of the AT6.1-MKK4/SEK1 cells was significantly reduced as compared with that of transfection controls, the growth rate of the primary tumors was not affected; the average tumor volume at day 29 after injection was
2 cm. Furthermore, histological examination of the lungs of AT6.1-MKK4/SEK1 tumor-bearing animals revealed that the suppression by MKK4/SEK1 is due to an effect at the metastatic site, consistent with the phenotype conferred by the original
70-cM chromosomal region. These studies implicate MKK4/SEK1 as a metastasis suppressor gene encoded by human chromosome 17. | Introduction |
|---|
|
|
|---|
70-cM portion of human chromosome 17 consisting of three conserved regions: (a) (D17S952
D17S805); (b) D17S930
D17S797; and (c) D17S944
qter). Specifically, the introduction of the
70-cM region significantly suppresses the spontaneous metastatic ability of AT6.1 rat prostate cancer cells, without affecting tumorigenicity (5)
. In this case, tumor cells are injected s.c. into the flank of an animal, and spontaneous metastatic ability is defined as the ability of the cells to disseminate from the primary tumor and form macroscopic foci at a secondary site. The metastasis suppressor activity encoded by this region is distinct from that of previously identified metastasis suppressor activities in that it regulates the growth of metastases at the secondary site, the lung, potentially by inducing a state of dormancy (6)
. In addition, in vivo studies demonstrated that the growth inhibition of these cells is due to an effect mediated at the site of metastasis and not from the action of a circulating inhibitory factor (6)
. Taken together, these observations suggest that expression of a gene(s) encoded by the
70-cM suppressor region inhibits the progressive growth of AT6.1-17-4 micrometastases in a context (tissue)-dependent manner.
A combination of complementary approaches were used to identify genes differentially expressed by parental, AT6.1, and metastasis-suppressed AT6.1-17-4 cells. MKK4/SEK1 was identified as a candidate metastasis suppressor gene that is specifically expressed by AT6.1-17-4 cells and that has been determined to be located within the
70-cM metastasis suppressor region at 17p12 (7)
. In this study, we demonstrate that transfection of the MKK4/SEK1 cDNA into highly metastatic AT6.1 cells results in a suppressed phenotype consistent with that conferred by the
70-cM region of human chromosome 17.
| Materials and Methods |
|---|
|
|
|---|
Identification of MKK4/SEK1 as a Candidate Metastasis Suppressor Gene Encoded by the
70-cM Region.
A search of genome databases identified a series of genes and ESTs3
located within the metastasis suppressor region. Genes whose known biological function suggested a potential role in metastasis suppression were selected as candidates, and ESTs that were redundant or reported to have restricted tissue expression were eliminated from further consideration. In addition, cDNA sequences specifically expressed in metastasis-suppressed AT6.1-17-4 cells were identified by the differential hybridization of AT6.1- and AT6.1-17-4-specific cDNA probes, generated using subtractive hybridization/suppression PCR (PCR-Select cDNA Subtraction Kit; Clontech, Palo Alto, CA), with a commercially available cDNA array blot (Clontech). RT-PCR was performed to assess the expression of the ESTs and cDNAs identified as potential candidates. Candidates that were not retained in AT6.1-17-4 cells or specifically expressed by AT6.1-17-4 cells and normal prostate tissue were eliminated from further consideration.
Transfections.
AT6.1 cells were transfected with plasmid vector pcDNA3 (Invitrogen, Carlsbad, CA), either alone or containing the cDNA for MKK4/SEK1 (construct provided by R. J. Davis, Howard Hughes Medical Institute, University of Massachusetts, Worcester, MA) using LipofectAMINE reagent (Life Technologies, Inc.). Briefly, cells were grown to
60% confluence in 6-cm tissue culture dishes, rinsed twice with serum-free medium, overlaid with a mixture of 2 µg of DNA and 10 µl of LipofectAMINE reagent diluted in serum-free medium, and incubated at 37°C in 5% CO2/95% air for 18 h. The transfection medium was then replaced with fresh medium, and 36 h later, the cells were harvested, diluted in growth medium containing 500 µg/ml G418, and split 1:30 for the selection and establishment of clonal cell lines.
PCR Analyses.
The expression of human MKK4/SEK1 in AT6.1 and AT6.1-17-4 cells was examined by PCR amplification from samples of double-stranded cDNA. cDNA was prepared from AT6.1 parental cells and metastasis-suppressed AT6.1-17-4 cells using the RiboClone system cDNA synthesis kit (Promega, Madison, WI). Commercially available cDNA from noncancerous human prostate tissue (Clontech) was used as a positive control, and a water-blank was run as a negative control (data not shown). Reactions for the detection of glyceraldehyde-3-phosphate dehydrogenase cDNA were performed to control for the integrity of the samples. Approximately 500 ng of cDNA were used for each amplification reaction. The EST/primer pair, TIGR-A003B48 (Research Genetics, Huntsville, AL), was used for the amplification of human MKK4/SEK1 cDNA, and glyceraldehyde-3-phosphate dehydrogenase primers were obtained from Clontech. The expression of rat MKK4/SEK1 was also examined by PCR. Approximately 1 µg of cDNA prepared from rat AT6.1 cells was analyzed in parallel with cDNA from adult rat prostate tissue (a gift of G. S. Prins, University of Illinois, Chicago, IL). The following primers were used to amplify rat MKK4/SEK1: 5'-GCAACTGTGAAAGCACTAAACC and 5'-CATGTATGGCCTACAGCCAG.
-Actin was amplified using the primers XAHR17 and XAHR20 (Research Genetics). The PCR product generated with the MKK4/SEK1-specific primers was subcloned and sequenced to confirm its identity. The partial cDNA sequence obtained, GCTTGCAACTGTGAAAGCACTAAACCACTTAAAAGAAAACTTGAA-AATTATTCACAGAGACATCAAACCTTCCAATATTCTTCTGGACAGGAGTGGAAATATAAAGCTCTGTGACTTCGGCATCAGTGGACAGCTCGTGGACTCTATTGCCAAGACGAGAGATGCTGGCTGTAGGCCATACATGAAG, is 96% identical with the human MKK4/SEK1 sequence in the aligned region. The expression of MKK4/SEK1 message in AT6.1-transfected clones was assessed by RT-PCR. Approximately 500 ng of poly(A)+ RNA was used for each reaction and run in duplicate, with and without the addition of reverse transcriptase. The primers, 5'-GACTACAAAGACGATGACGACAAG and 5'-AATCCCAGTGTTGTTCAGGG, are specific for the human MKK4/SEK1 transgene. The identity of the PCR product obtained was confirmed by automated DNA sequencing.
Spontaneous Metastasis Assays.
To characterize the in vivo growth rate and metastatic ability of the transfected clones, 46-week-old CB17 severe combined immunodeficient mice (Taconic Laboratory Animals and Services, Germantown, NY) were injected s.c. in the flank with 2 x 105 cells. Three independent clonal lines of both the MKK4/SEK1 and the vector control transfectants were tested in a total of five to eight animals each in two separate experiments. The tumor volume was determined as an index of the tumor growth rate as described previously (5)
. At 42 days after injection, animals were sacrificed, the lungs were excised, and fixed in 10% formalin, and the number of macroscopic metastases (>1 mm) was counted while being viewed through a dissection scope. The significance of the data was determined using the nonparametric, Mann-Whitney
-test.
Histology.
The lungs of tumor-bearing mice were fixed in 10% buffered formalin and embedded in paraffin. Six random discontinuous 5-µm sections were taken and stained with H&E (University of Chicago Histology Laboratory, Chicago, IL).
| Results and Discussion |
|---|
|
|
|---|
70-cM portion responsible for the observed metastasis suppression included complementary candidate gene/EST and differential expression approaches. Initially, genes with a physical location on chromosome 17 and a known biological function suggesting a potential role in metastasis suppression were examined. A stringent set of rules was established to prioritize the testing of candidate genes. In brief, putative candidate genes that were not specifically retained or expressed by AT6.1-17-4 cells and normal prostate tissue were eliminated from further consideration. More than 50 candidate genes and ESTs were identified and evaluated as potential candidates (1
, 5)
. We identified MKK4/SEK1 as a candidate gene based on its physical location, 17p11.2, within the
70-cM metastasis suppressor region, and the fact that its normal cellular function within the stress-activated signaling pathway suggests that alteration of this gene may have pleiotrophic effects on the cell (9)
. To assess the potential of MKK4/SEK1 as a candidate metastasis suppressor gene in our model, PCR analyses were performed to examine its expression in AT6.1-17-4 and AT6.1 cells. Using a primer pair specific for the human gene, MKK4/SEK1 was found to be expressed in metastasis-suppressed AT6.1-17-4 cells and normal human prostate tissues but was not expressed in the parental AT6.1 cells (Fig. 1A)
|
Based on the aforementioned results and our previous finding that a gene encoded by the
70-cM region regulates the growth of metastases at the secondary site, we formulated the following working hypothesis. In the lung, parental AT6.1 cells, which do not express the endogenous MKK4/SEK1 gene, fail to respond to stress stimuli and are therefore able to proliferate and form macroscopic metastases within 42 days of injection (6)
. In contrast, in AT6.1-17-4 cells, expression of the human MKK4/SEK1 gene complements this defect, restoring the ability of the disseminated AT6.1-17-4 cells to respond to stress stimuli, thus inhibiting their metastatic colonization. If this hypothesis is correct, then AT6.1 parental cells transfected with MKK4/SEK1 cDNA should exhibit a metastasis-suppressed phenotype similar to that of AT6.1-17-4 cells. As a first step in testing this hypothesis, AT6.1 cells were transfected with a constitutive expression construct containing MKK4/SEK1 cDNA [a generous gift from Dr. Roger Davis, Howard Hughes Medical Institute, University of Massachusetts, Worcester, MA (10)
]. Stable transfectants were selected, and expression of the transgene was confirmed by RT-PCR. Three AT6.1-MKK4/SEK1 clonal cell lines that expressed the transgene (Fig. 2)
were tested for metastatic ability in spontaneous metastasis assays in severe combined immunodeficient mice (Table 1)
. AT6.1, AT6.1-17-4, and AT6.1pcDNA3 (vector-only transfectants) served as controls. As shown in Table 1
, there was no significant difference between the tumor doubling times of AT6.1-MKK4/SEK1 and control tumors. In contrast, there was a significant reduction in the number of macroscopic lung metastases in the mice carrying AT6.1-MKK4/SEK1 tumors as compared with the lungs from AT6.1- and AT6.1-pcDNA3 tumor bearers (Table 1
, Figure 3, A and B
). Such results are consistent with the definition of metastasis suppressor genes, which, unlike tumor suppressor genes, inhibit the formation of metastases without affecting the growth of the primary tumor.
|
|
|
70-cM region of chromosome 17 is mediated at the secondary site. Cells containing this region escape from the primary tumor and arrest in the lung, but they are growth-inhibited unless the
70-cM region is lost (6)
. If MKK4/SEK1 is working through the same mechanism, then micrometastatic foci should be present in the lungs of mice bearing AT6.1-MKK4/SEK1 tumors. To address this issue, histological sections were prepared from the lungs of tumor-bearing animals and examined for the presence of micrometastatic foci (Fig 3C)
1000 cells (Fig. 3C
500 cells (Fig. 3C
70-cM region of chromosome 17 (6)
. The use of complementary biological (in vivo) and molecular (gene discovery) approaches enabled us to identify MKK4/SEK1 as a candidate metastasis suppressor gene encoded by human chromosome 17. Interestingly, previous studies had identified MKK4/SEK1 as a candidate tumor suppressor gene (12 , 13) . These studies, which used traditional positional cloning approaches, identified homozygous deletions and other inactivating mutations in MKK4/SEK1 in a small percentage of lung, pancreatic, and breast cancer cell lines and/or xenografts (12 , 13) . Importantly, Su et al. (12) found that MKK4/SEK1 can be an independent target for loss of heterozygosity; its inactivation is not just the by-product of large deletions of the nearby p53 gene. Recent studies using transgenic approaches found that disruption of the MKK4/SEK1 gene caused embryonic death in mice, demonstrating a requirement for MKK4/SEK1 in development (reviewed in Ref. 9 ). These studies also included analyses of cells with a homozygous deficiency in MKK4/SEK1 and demonstrated that it is required for the normal regulation of cellular responses to environmental stress. To our knowledge, ours is the first study that has identified a functional role for MKK4/SEK1 in the regulation of metastasis. We are currently examining the importance of deletions and/or mutations of MKK4/SEK1 in human prostate cancer metastases.
Taken together, the known role of MKK4/SEK1 as a mediator of extracellular stress stimuli and the in vivo biology exhibited by MKK4/SEK1-transfected AT6.1 cells (i.e. dormant micrometastases) support our working hypothesis: that expression of the MKK4/SEK1 gene compliments a defect in AT6.1 cells, thus restoring the ability of the disseminated AT6.1-MKK4/SEK1 cells to respond to stress stimuli and inhibiting metastatic colonization. Whereas it is tempting to speculate on the mechanism of action of MKK4/SEK1 in contributing to the dormant phenotype, adequate examination of how it suppresses the growth of disseminated micrometastases will require the construction of appropriate biochemical constructs and, most importantly, the identification of in vitro conditions that will enable us to conduct relevant signaling studies. These studies are currently underway.
The immediate goal of our research efforts is to identify new molecular markers that will enhance our ability to diagnose and treat prostate cancer (1) . It is hoped that these studies will also provide information fundamental to our understanding of what factors regulate the growth of prostate cancer metastases. Such information is of particular importance in light of the increased emphasis on the early detection of prostate cancer (14) . Ultrasensitive methods to detect prostate cancer cells in the circulation and bone marrow of patients have recently been developed (reviewed in Ref. 6 ). The relevance of such cells is unclear, however, because there is a real possibility that such disseminated cells may remain dormant, requiring additional genetic or epigenetic changes to become life-threatening (6) . Whereas much of the current literature concerning micrometastatic dormancy has focused on the inhibition of angiogenesis, it is important to note that dormancy can result from other phenomena including cellular quiescence, diminished cellular doubling time, and immunological surveillance (15) . Taken together, our data indicate that expression of MKK4/SEK1 is likely to affect the growth of micrometastases at a point before the potential induction of angiogenesis (6) . Future in vivo studies will focus on the elucidation of biological mechanism(s) through which MKK4/SEK1 induces dormancy, as well as the identification of factors that trigger the context-dependent growth inhibition of AT6.1-MKK4/SEK1 micrometastases.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by American Cancer Society Institutional Grant IGR41-35-3, NIH Grant P20 CA 66132, a University of Chicago Surgery Research Committee Grant, Cancer Research Foundation Young Investigator Award, and NIH First Award R29 CA69487 02 (to C. W. R.-S.), American Foundation for Urologic Disease (B. A. Y., C. W. R-S.) and University of Chicago RESearch CUre and Education Fund (B. A. Y., Z. D., M. A. C.). ![]()
2 To whom requests for reprints should be addressed, at Section of Urology, Department of Surgery, University of Chicago, 5841 South Maryland MC6038, Chicago, IL 60637. Phone (312) 702-3140; Fax: (312) 702-1001; E-mail: crinker{at}surgery.bsd.uchicago.edu ![]()
3 The abbreviations used are: EST, expressed sequence tag; RT-PCR, reverse transcription-PCR. ![]()
Received 7/19/99. Accepted 9/20/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Xu, Y. Ding, W. J. Catalona, X. J. Yang, W. F. Anderson, B. Jovanovic, K. Wellman, J. Killmer, X. Huang, K. A. Scheidt, et al. MEK4 Function, Genistein Treatment, and Invasion of Human Prostate Cancer Cells J Natl Cancer Inst, August 19, 2009; 101(16): 1141 - 1155. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Z. Li, Y. Gao, X. L. Zhao, Y. X. Liu, B. C. Sun, J. Yang, and Z. Yao Effects of Raf Kinase Inhibitor Protein Expression on Metastasis and Progression of Human Breast Cancer Mol. Cancer Res., June 1, 2009; 7(6): 832 - 840. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, L. Wang, M. Zhang, J. Melamed, X. Liu, R. Reiter, J. Wei, Y. Peng, X. Zou, A. Pellicer, et al. LEF1 in Androgen-Independent Prostate Cancer: Regulation of Androgen Receptor Expression, Prostate Cancer Growth, and Invasion Cancer Res., April 15, 2009; 69(8): 3332 - 3338. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Sethi, K. S. Ahn, D. Xia, J. M. Kurie, and B. B. Aggarwal Targeted Deletion of MKK4 Gene Potentiates TNF-Induced Apoptosis through the Down-Regulation of NF-{kappa}B Activation and NF-{kappa}B-Regulated Antiapoptotic Gene Products J. Immunol., August 1, 2007; 179(3): 1926 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xia, H. Srinivas, Y.-h. Ahn, G. Sethi, X. Sheng, W. K. A. Yung, Q. Xia, P. J. Chiao, H. Kim, P. H. Brown, et al. Mitogen-activated Protein Kinase Kinase-4 Promotes Cell Survival by Decreasing PTEN Expression through an NF{kappa}B-dependent Pathway J. Biol. Chem., February 9, 2007; 282(6): 3507 - 3519. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Wang, M. Iordanov, and Q. Zhang c-Jun NH2-terminal Kinase Promotes Apoptosis by Down-regulating the Transcriptional Co-repressor CtBP J. Biol. Chem., November 17, 2006; 281(46): 34810 - 34815. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Strock, J.-I. Park, E. K. Nakakura, G. S. Bova, J. T. Isaacs, D. W. Ball, and B. D. Nelkin Cyclin-dependent kinase 5 activity controls cell motility and metastatic potential of prostate cancer cells. Cancer Res., August 1, 2006; 66(15): 7509 - 7515. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Rinker-Schaeffer, J. P. O'Keefe, D. R. Welch, and D. Theodorescu Metastasis Suppressor Proteins: Discovery, Molecular Mechanisms, and Clinical Application. Clin. Cancer Res., July 1, 2006; 12(13): 3882 - 3889. [Full Text] [PDF] |
||||
![]() |
S. C. Cunningham, E. Gallmeier, T. Hucl, D. A. Dezentje, E. S. Calhoun, G. Falco, K. Abdelmohsen, M. Gorospe, and S. E. Kern Targeted Deletion of MKK4 in Cancer Cells: A Detrimental Phenotype Manifests as Decreased Experimental Metastasis and Suggests a Counterweight to the Evolution of Tumor-Suppressor Loss Cancer Res., June 1, 2006; 66(11): 5560 - 5564. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Gioeli, B. E. Black, V. Gordon, A. Spencer, C. T. Kesler, S. T. Eblen, B. M. Paschal, and M. J. Weber Stress Kinase Signaling Regulates Androgen Receptor Phosphorylation, Transcription, and Localization Mol. Endocrinol., March 1, 2006; 20(3): 503 - 515. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Hickson, D. Huo, D. J. Vander Griend, A. Lin, C. W. Rinker-Schaeffer, and S. D. Yamada The p38 Kinases MKK4 and MKK6 Suppress Metastatic Colonization in Human Ovarian Carcinoma Cancer Res., February 15, 2006; 66(4): 2264 - 2270. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Vander Griend, M. Kocherginsky, J. A. Hickson, W. M. Stadler, A. Lin, and C. W. Rinker-Schaeffer Suppression of Metastatic Colonization by the Context-Dependent Activation of the c-Jun NH2-Terminal Kinase Kinases JNKK1/MKK4 and MKK7 Cancer Res., December 1, 2005; 65(23): 10984 - 10991. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Uhlirova, H. Jasper, and D. Bohmann Non-cell-autonomous induction of tissue overgrowth by JNK/Ras cooperation in a Drosophila tumor model PNAS, September 13, 2005; 102(37): 13123 - 13128. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Lee, S.-H. Oh, Y.-A. Suh, J. H. Baek, V. Papadimitrakopoulou, S. Huang, and W. K. Hong Response of Non-Small Cell Lung Cancer Cells to the Inhibitors of Phosphatidylinositol 3-Kinase/Akt- and MAPK Kinase 4/c-Jun NH2-Terminal Kinase Pathways: An Effective Therapeutic Strategy for Lung Cancer Clin. Cancer Res., August 15, 2005; 11(16): 6065 - 6074. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Nathoo, A Chahlavi, G H Barnett, and S A Toms Pathobiology of brain metastases J. Clin. Pathol., March 1, 2005; 58(3): 237 - 242. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Xin, K. J. Yun, F. Ricci, M. Zahurak, W. Qiu, G. H. Su, C. J. Yeo, R. H. Hruban, S. E. Kern, and C. A. Iacobuzio-Donahue MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course Clin. Cancer Res., December 15, 2004; 10(24): 8516 - 8520. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Aguirre-Ghiso, L. Ossowski, and S. K. Rosenbaum Green Fluorescent Protein Tagging of Extracellular Signal-Regulated Kinase and p38 Pathways Reveals Novel Dynamics of Pathway Activation during Primary and Metastatic Growth Cancer Res., October 15, 2004; 64(20): 7336 - 7345. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. S. Steeg PERSPECTIVES ON CLASSIC ARTICLES: Metastasis Suppressor Genes J Natl Cancer Inst, March 17, 2004; 96(6): E4 - E4. [Full Text] |
||||
![]() |
D. J. Vander Griend and C. W. Rinker-Schaeffer A New Look at an Old Problem: The Survival and Organ-Specific Growth of Metastases Sci. Signal., January 20, 2004; 2004(216): pe3 - pe3. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Ho, A. J. Bardwell, M. Abdollahi, and L. Bardwell A Docking Site in MKK4 Mediates High Affinity Binding to JNK MAPKs and Competes with Similar Docking Sites in JNK Substrates J. Biol. Chem., August 29, 2003; 278(35): 32662 - 32672. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Lee, H. Srinivas, D. Xia, Y. Lu, R. Superty, R. LaPushin, C. Gomez-Manzano, A. M. Gal, G. L. Walsh, T. Force, et al. Evidence That Phosphatidylinositol 3-Kinase- and Mitogen-activated Protein Kinase Kinase-4/c-Jun NH2-terminal Kinase-dependent Pathways Cooperate to Maintain Lung Cancer Cell Survival J. Biol. Chem., June 20, 2003; 278(26): 23630 - 23638. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Welch and K. W. Hunter A New Member of the Growing Family of Metastasis Suppressors Identified in Prostate Cancer J Natl Cancer Inst, June 18, 2003; 95(12): 839 - 841. [Full Text] [PDF] |
||||
![]() |
N. J. Kennedy, H. K. Sluss, S. N. Jones, D. Bar-Sagi, R. A. Flavell, and R. J. Davis Suppression of Ras-stimulated transformation by the JNK signal transduction pathway Genes & Dev., March 1, 2003; 17(5): 629 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. F. Goldberg, M. E. Miele, N. Hatta, M. Takata, C. Paquette-Straub, L. P. Freedman, and D. R. Welch Melanoma Metastasis Suppression by Chromosome 6: Evidence for a Pathway Regulated by CRSP3 and TXNIP Cancer Res., January 15, 2003; 63(2): 432 - 440. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Yamada, J. A. Hickson, Y. Hrobowski, D. J. Vander Griend, D. Benson, A. Montag, T. Karrison, D. Huo, J. Rutgers, S. Adams, et al. Mitogen-activated Protein Kinase Kinase 4 (MKK4) Acts as a Metastasis Suppressor Gene in Human Ovarian Carcinoma Cancer Res., November 15, 2002; 62(22): 6717 - 6723. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Lee, Y.-A. Suh, J. I. Lee, K. A. Hassan, L. Mao, T. Force, B. E. Gilbert, T. Jacks, and J. M. Kurie Inhibition of Oncogenic K-ras Signaling by Aerosolized Gene Delivery in a Mouse Model of Human Lung Cancer Clin. Cancer Res., September 1, 2002; 8(9): 2970 - 2975. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-Q. Wu, H. Chen, M. A. Rubin, K. J. Wojno, and K. A. Cooney Loss of Heterozygosity of the Putative Prostate Cancer Susceptibility Gene HPC2/ELAC2 Is Uncommon in Sporadic and Familial Prostate Cancer Cancer Res., December 1, 2001; 61(24): 8651 - 8653. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. W. Hunter, K. W. Broman, T. L. Voyer, L. Lukes, D. Cozma, M. T. Debies, J. Rouse, and D. R. Welch Predisposition to Efficient Mammary Tumor Metastatic Progression Is Linked to the Breast Cancer Metastasis Suppressor Gene Brms1 Cancer Res., December 1, 2001; 61(24): 8866 - 8872. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. G. Meadows, H. Zhang, and X. Ge Specific Amino Acid Deficiency Alters the Expression of Genes in Human Melanoma and Other Tumor Cell Lines J. Nutr., November 1, 2001; 131(11): 3047S - 3050. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Kim, D. J. Vander Griend, X. Yang, D. A. Benson, Z. Dubauskas, B. A. Yoshida, M. A. Chekmareva, Y. Ichikawa, M. H. Sokoloff, P. Zhan, et al. Mitogen-activated Protein Kinase Kinase 4 Metastasis Suppressor Gene Expression Is Inversely Related to Histological Pattern in Advancing Human Prostatic Cancers Cancer Res., April 1, 2001; 61(7): 2833 - 2837. [Abstract] [Full Text] |
||||
![]() |
B. A. Yoshida, M. M. Sokoloff, D. R. Welch, and C. W. Rinker-Schaeffer Metastasis-Suppressor Genes: a Review and Perspective on an Emerging Field J Natl Cancer Inst, November 1, 2000; 92(21): 1717 - 1730. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |