| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Obstetrics and Gynecology, School of Medicine [S K., M T., T K., W Z., M I.], and Department of Cellular and Molecular Biology, Cancer Research Institute [K F.], Kanazawa University, Kanazawa, Ishikawa 920-8641, Japan; Department of the 2nd Biochemistry, Saitama Medical Schools, Saitama, Japan [A O.]; Department of Obstetrics and Gynecology, Osaka University Medical School, Osaka, Japan [Y N.]
| ABSTRACT |
|---|
|
|
|---|
-estradiol. This activation accompanied up-regulation of the telomerase catalytic subunit, hTERT mRNA. Gel shift assays revealed that the imperfect palindromic estrogen-responsive element in the hTERT promoter specifically binds to ER. Transient expression assays using luciferase reporter plasmids containing various fragments of hTERT promoter showed that this imperfect palindromic estrogen-responsive element is responsible for transcriptional activation by ligand-activated ER. We also found that estrogen activates c-Myc expression in MCF-7 cells and that E-boxes in the hTERT promoter that bind c-Myc/Max play additional roles in estrogen-induced transactivation of hTERT. Estrogen thus activates telomerase via direct and indirect effects on the hTERT promoter. These findings may help elucidate the mechanisms of hormonal control of telomerase activity and aid understanding of the roles of sex steroids in cellular senescence and aging as well as estrogen-induced carcinogenesis. | Introduction |
|---|
|
|
|---|
Although telomerase is known to be a regulated enzyme, the factors and mechanisms involved in telomerase regulation are not well understood. There is mounting evidence that hormones may regulate telomerase activity in estrogen target tissues (6, 7, 8, 9) . In particular, human endometrium expresses telomerase activity despite its somatic origin, and this activity is tightly regulated in a menstrual phase-dependent manner, suggesting the presence of controlling mechanisms of telomerase by sex steroids (6 , 7) .
Recent studies have identified three major components of human telomerase: the template RNA (hTR),2 telomerase-associated protein, and the reverse transcriptase subunit (hTERT; Refs. 10, 11, 12, 13, 14 ). hTR and hTERT are known to be sufficient to reconstitute telomerase activity in vitro (15 , 16) . There is a good correlation between expression of hTERT mRNA and the presence of telomerase activity in extracts from tissue culture cells and normal and cancer tissues, whereas hTR is expressed constitutively in both cancer and normal cells, irrespective of the status of telomerase expression (17, 18, 19) . In a previous study, down-regulation of telomerase activity by treatment with differentiating agents accompanied repression of hTERT mRNA expression but not that of hTR in leukemia cells (14) . These findings suggest that hTERT is a rate-limiting determinant of telomerase activity.
Recent success in cloning hTERT promoter enabled us to investigate mechanisms controlling the transcriptional activity of hTERT (20, 21, 22, 23) . We previously found that the proximal 181-bp region of the hTERT promoter, which contains E-boxes that bind c-Myc/Max, is essential for transactivation in telomerase-positive cells (22) . However, few findings have been obtained concerning other cis-elements that regulate hTERT transcription. In the present study, we examined the effects of estrogen on hTERT transcription as well as telomerase activity, using the estrogen-receptor-positive MCF-7 cell line, and demonstrated that estrogen activates telomerase via direct and indirect effects on hTERT promoter.
| Materials and Methods |
|---|
|
|
|---|
Stretch PCR Assay.
For quantitative analyses of telomerase activity, stretch PCR assays were performed using the Telochaser system according to the manufacturers protocol (Toyobo, Tokyo, Japan; Refs. 24
, 25
). The PCR products were electrophoresed on a 7% polyacrylamide gel and visualized with SYBR Green I Nucleic Acid Gel Stain (FMC BioProducts, Rockland, ME). To monitor the efficacy of PCR amplification, 10 ng of internal control from
phage DNA sequence (Toyobo) together with 50 pmol of specific primers (Toyobo) were added to the PCR mixture per reaction. Relative telomerase activity was determined by measuring band intensities of telomerase ladders and comparing them with those of internal standards. Band intensity was measured using NIH Image picture analyzing soft.
RNA PCR Analysis.
The expression of hTERT mRNA and c-Myc mRNA was analyzed by semi-quantitative RT-PCR amplification as described previously (14
, 26)
. Briefly, hTERT and c-Myc mRNAs were amplified using the primer pairs: 5'-CGGAAGAGTGTCTGGAGCAA-3' (LT5) and 5'-GGATGAAGCGGAGTCTGGA-3'(LT6) for hTERT and 5'-AAGTCCTGCGCCTCGCAA-3' and 5'-GCTGTGGCCTCCAGCAGA-3' for c-Myc. Total RNA was isolated from the tissues using Isogen (Nippon Gene, Japan) according to the manufacturers protocol, and cDNA was synthesized from 1 µg of RNA using the RNA PCR kit version 2 (TaKaRa, Ohtsu, Japan) with random primers. Serially diluted cDNA reverse-transcribed from 1 µg of RNA (corresponding to 50 ng to 1 µg) was first subjected to RT-PCR to obtain standard curves. Band intensity was counted with NIH Image picture analyzing soft. A linear correlation was confirmed between band intensity and dose of cDNA templates under the conditions described below. Typically, 2-µl aliquots of the reverse-transcribed cDNA were subjected to 28 cycles of PCR in 50 µl of 1x buffer [10 mM Tris-HCl (pH 8.3), 2.5 mM MgCl2, 50 mM KCl] containing 1 mM each of dATP, dCTP, dGTP, and dTTP; 2.5 units of Taq DNA polymerase (TaKaRa, Japan); and 0.2 µM each of specific primers. Each cycle consisted of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 90 s. PCR products were electrophoresed in 7% polyacrylamide gel and stained with SYBR green I (FMC BioProducts). The efficiency of cDNA synthesis from each sample was estimated by PCR with glyceraldehyde-3-phosphate dehydrogenase-specific primers as described previously (16)
.
Plasmid Construction.
The structures of hTERT promoter-LUC constructs are shown in Fig. 3
. Various lengths of DNA fragments upstream of the initiating ATG codon of the hTERT gene were PCR-amplified and inserted into LUC reporter vector pGL3-Basic, a promoter- and enhancer-less vector (Promega) in sense orientation relative to the LUC coding sequence at Mlu1 and BglII sites. As a positive control plasmid, pGL3-Control (Promega) was used, in which the LUC gene is driven by the SV40 LT enhancer/promoter. pGL3-ERE-promoter and p-Sp1/ER-promoter were constructed by inserting the head-in-tail tetramers of potential ERE at -2677 or Sp1/ER site at -873 into enhancer-less vector pGL3-promoter (Promega) upstream of SV40 promoter sequences. The c-Myc promoter-LUC reporter plasmid (p-MycP-LUC) containing 877 bp of p1 promoter and upstream Alu sequences was kindly provided by Dr. H. Ariga (Hokkaido University, Sapporo, Japan). ER
expression vector (pSG5-HEO) was a gift from P. Chambon (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Strasbourg, France). Reporter plasmid p-181 MycMT contains substitution mutations in two c-Myc binding sites at -165 and +44, which were introduced by PCR-based site-specific mutagenesis. E-box consensus sequences (CACGTG) were altered to TTTGTG at -165 and CACAAG at +44.
|
Gel Shift Assay.
Recombinant ER protein (
) produced by a baculovirus-expression system (TaKaRa, Ohtsu, Japan) was used for the gel shift assay. Two to 10 pmol of ER proteins were incubated with 0.5 µg of poly(dI·dC) in the presence or absence of unlabeled competitors on ice for 20 min in a 25-µl reaction volume containing 10% glycerol, 25 mM HEPES (pH 7.9), 50 mM KCl, 0.5 mM phenylmethylsulfonyl fluoride, 1 mM DTT, and 4 mg/ml BSA. After incubation, 10,000 cpm of 32P end-labeled oligonucleotide probes (5'-TGTTGGTCAGGCTGATCTCAAA-3') containing the potential ERE in the core promoter at -2678 were added, and the reaction was incubated at 4°C for an additional 20 min. The underlined sequences of the probe were altered to CTCA in the mutated oligonucleotides for competition assay. After electrophoresis on a 4% polyacrylamide gel, the gel was dried and subjected to autoradiography. Consensus oligonucleotides for ERE (GTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT) from the Xenopus vitellogenin A2 gene (21)
and for c-Myc (GGAAGCAGACCACGTGGTCTGCTTCC; SantaCruz; catalog number sc-2509) or antibodies specific against ER
(SantaCruz; catalog number sc-786x) were added to the binding reactions before incubation with labeled probes for competition and supershift assays, respectively.
| Results |
|---|
|
|
|---|
1 nM, telomerase activity was up-regulated within 6 h and persisted until at least 48 h. Maximal activation (more than 6-fold versus control) was observed at 24 h after treatment. This effect was largely abrogated by the addition of TM, an antagonist of ER (Fig. 1B
|
|
proteins were incubated with oligonucleotide probes spanning each site. A specific band was observed with probes containing the putative ERE at -2677, which was competed by homologous competitors but not by its mutant oligonucleotides in which GGTCA palindromic sequences were abrogated by substitution mutations. This band was also competed by ERE consensus sequences in the Xenopus vitellogenin A2 gene promoter (33)
but not by unrelated oligonucleotides such as the c-Myc consensus motif. Furthermore, the band was supershifted by addition of ER
antibody but not by that of c-Myc. In contrast, we failed to observe a specific ER band when we used the Sp1/ER site at -873, although Sp1 binding was detected with recombinant Sp1 proteins (data not shown). These findings suggest that ER can bind directly to the hTERT promoter through the degenerated ERE motif.
To examine the effect of estrogen on the transcriptional activity of the hTERT promoter, LUC assays were performed in which the hTERT-promoter reporter plasmids were transfected into a variety of cell types. When reporter plasmids with 3.3 kb of hTERT promoter (pGL3-3328) were transfected into ER-positive MCF-7 cells, transcriptional activity was significantly increased by E2 (Fig. 4A)
. Addition of tamoxifen largely inhibited this activation. In contrast, E2 treatment did not activate promoter activity of hTERT in ER-negative SiHa (from cervical cancer cells) or normal foreskin NHK cells. However, once ER
expression vectors were introduced into these cells, estrogen significantly activated the hTERT promoter (Fig. 4B)
. These findings suggest that the effects of estrogen on hTERT promoter depend on ER expression and are not specific to MCF-7 cells.
|
10-fold transcriptional activation was observed with E2 treatment (Fig. 5C)
|
|
| Discussion |
|---|
|
|
|---|
, and Hsp 27 (29, 30, 31, 32)
. A weak interaction of estrogen-ER with the ERE half site is known to be stabilized by an interaction with an adjacent bound Sp1 or Sp1-like factor (29)
. Protein-protein interaction of ER and Sp1 enhances DNA binding of Sp1 to GC-rich sequences. Thus, the effects of the Sp1/ER site may depend on the status of Sp1 expression in cells (34)
. The findings presented have important implications concerning hormone-dependent telomerase activation and help explain the molecular mechanisms by which telomerase activity in human endometrium is regulated in a menstrual phase-dependent manner. Telomerase activity in the endometrium is weak or undetectable during the menstruation period (6 , 7) . However, once the proliferative phase begins, telomerase is dramatically up-regulated, with maximal activity in late proliferative phase or preovulatory phase and subsequent reduction in activity in the secretory phase. Both circulating and local levels of estrogen increase during the proliferative phase, with a peak level in the preovulatory phase, followed by a drastic decrease in the secretory phase, consistent with the profile of telomerase expression during the menstrual cycle. Interestingly, c-Myc in endometrium exhibits similar changes in expression during the menstrual cycle that are probably regulated by estrogen, based on the present finding that estrogen activates c-Myc. Estrogen may thus play a causative role in regulating telomerase in human endometrium.
Prolonged exposure to estrogen is one of the risk factors for development of endometrial cancer. There is accumulating evidence that estrogen administration without progesterone treatment increases the frequency of occurrence of endometrial cancer (35) . Although the effects of estrogen on the proliferation of endometrial cells are complex, activation of hTERT and subsequent telomerase activation may contribute to estrogen-induced endometrial carcinogenesis. Continuous administration of estrogen has been used as hormone replacement therapy to prevent osteoporosis and other estrogen-deficient syndromes, termed climacteric disorders. An increasing number of postmenopausal patients have been treated with hormone replacement therapy. Of particular interest is whether patients treated with estrogen have extended life spans, a possibility suggested by the present observation that estrogen activates telomerase. A long-term prospective study with a large number of patients will be necessary to answer this important issue.
In summary, the present study demonstrated that hTERT is both a direct and indirect target of estrogen, implying the existence of hormone-dependent mechanisms of control of telomerase activity. Our findings also suggest that sex steroids may play the important roles in cellular aging and cancer. Further analysis of the hormonal control of telomerase may provide insights into the molecular mechanisms of aging as well as carcinogenesis of hormone-dependent tumors.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 To whom requests for reprints should be addressed, at Department of Obstetrics and Gynecology, School of Medicine, Kanazawa University, 13-1, Takaramachi, Kanazawa, Ishikawa 920-8641, Japan. Phone: 81-0-76-265-2425; Fax: 81-0-76-234-4266; E-mail: satoruky{at}med.kanazawa-u.ac.jp ![]()
2 The abbreviations used are: hTR, human telomerase RNA; hTERT, human telomerase reverse transcriptase subunit; NHK, normal human foreskin keratinocyte; RT-PCR, reverse transcription-PCR; LUC, luciferase; ERE, estrogen-responsive element; ER, estrogen receptor; E2, 17
-estradiol; TM, 4-hydroxytamoxifen. ![]()
Received 9/ 9/99. Accepted 10/15/99.
| REFERENCES |
|---|
|
|
|---|
-estradiol, progestin R5020, Tamoxifen and RU38486 on lactate dehydrogenase activity in MCF-7 human breast cancer cells. J. Steroid Biochem., 32: 271-277, 1989.[Medline]
gene in human breast carcinoma cells is mediated via an imperfect half-palindromic estrogen response element and Sp1 motifs. Cancer Res., 55: 4999-5006, 1995.This article has been cited by other articles:
![]() |
R. T. Calado, W. T. Yewdell, K. L. Wilkerson, J. A. Regal, S. Kajigaya, C. A. Stratakis, and N. S. Young Sex hormones, acting on the TERT gene, increase telomerase activity in human primary hematopoietic cells Blood, September 10, 2009; 114(11): 2236 - 2243. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Katzenellenbogen, P. Vliet-Gregg, M. Xu, and D. A. Galloway NFX1-123 Increases hTERT Expression and Telomerase Activity Posttranscriptionally in Human Papillomavirus Type 16 E6 Keratinocytes J. Virol., July 1, 2009; 83(13): 6446 - 6456. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. De Vivo, J. Prescott, J. Y.Y. Wong, P. Kraft, S. E. Hankinson, and D. J. Hunter A Prospective Study of Relative Telomere Length and Postmenopausal Breast Cancer Risk Cancer Epidemiol. Biomarkers Prev., April 1, 2009; 18(4): 1152 - 1156. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ishibashi, K. Nakayama, S. Yeasmin, A. Katagiri, K. Iida, N. Nakayama, and K. Miyazaki Expression of a BTB/POZ Protein, NAC1, Is Essential for the Proliferation of Normal Cyclic Endometrial Glandular Cells and Is Up-regulated by Estrogen Clin. Cancer Res., February 1, 2009; 15(3): 804 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Akbay, C. M. Contreras, S. A. Perera, J. P. Sullivan, R. R. Broaddus, J. O. Schorge, R. Ashfaq, H. Saboorian, K.-K. Wong, and D. H. Castrillon Differential Roles of Telomere Attrition in Type I and II Endometrial Carcinogenesis Am. J. Pathol., August 1, 2008; 173(2): 536 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Grasselli, S. Nanni, C. Colussi, A. Aiello, V. Benvenuti, G. Ragone, F. Moretti, A. Sacchi, S. Bacchetti, C. Gaetano, et al. Estrogen Receptor-{alpha} and Endothelial Nitric Oxide Synthase Nuclear Complex Regulates Transcription of Human Telomerase Circ. Res., July 3, 2008; 103(1): 34 - 42. [Abstract] [Full Text] [PDF] |
||||
![]() |
D.K. Hapangama, M.A. Turner, J.A. Drury, S. Quenby, G. Saretzki, C. Martin-Ruiz, and T. Von Zglinicki Endometriosis is associated with aberrant endometrial expression of telomerase and increased telomere length Hum. Reprod., July 1, 2008; 23(7): 1511 - 1519. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Farzaneh-Far, R. M. Cawthon, B. Na, W. S. Browner, N. B. Schiller, and M. A. Whooley Prognostic Value of Leukocyte Telomere Length in Patients With Stable Coronary Artery Disease: Data From the Heart and Soul Study Arterioscler Thromb Vasc Biol, July 1, 2008; 28(7): 1379 - 1384. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Svenson, K. Nordfjall, B. Stegmayr, J. Manjer, P. Nilsson, B. Tavelin, R. Henriksson, P. Lenner, and G. Roos Breast Cancer Survival Is Associated with Telomere Length in Peripheral Blood Cells Cancer Res., May 15, 2008; 68(10): 3618 - 3623. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J Samani and P. van der Harst Biological ageing and cardiovascular disease Heart, May 1, 2008; 94(5): 537 - 539. [Full Text] [PDF] |
||||
![]() |
J. Z. Guan, T. Maeda, M. Sugano, J.-i. Oyama, Y. Higuchi, T. Suzuki, and N. Makino An Analysis of Telomere Length in Sarcoidosis J. Gerontol. A Biol. Sci. Med. Sci., November 1, 2007; 62(11): 1199 - 1203. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Emerald, Y. Chen, T. Zhu, Z. Zhu, K.-O. Lee, P. D. Gluckman, and P. E. Lobie {alpha}CP1 Mediates Stabilization of hTERT mRNA by Autocrine Human Growth Hormone J. Biol. Chem., January 5, 2007; 282(1): 680 - 690. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Fuster and V. Andres Telomere Biology and Cardiovascular Disease Circ. Res., November 24, 2006; 99(11): 1167 - 1180. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Doshida, M. Ohmichi, S. Tsutsumi, J. Kawagoe, T. Takahashi, B. Du, A. Mori-Abe, T. Ohta, M. Saitoh-Sekiguchi, K. Takahashi, et al. Raloxifene Increases Proliferation and Up-regulates Telomerase Activity in Human Umbilical Vein Endothelial Cells J. Biol. Chem., August 25, 2006; 281(34): 24270 - 24278. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Lippman, J. J. Lee, J. W. Martin, A. K. El-Naggar, X. Xu, D. M. Shin, M. Thomas, L. Mao, H. A. Fritsche Jr., X. Zhou, et al. Fenretinide Activity in Retinoid-Resistant Oral Leukoplakia. Clin. Cancer Res., May 15, 2006; 12(10): 3109 - 3114. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jagadeesh, S. Kyo, and P. P. Banerjee Genistein Represses Telomerase Activity via Both Transcriptional and Posttranslational Mechanisms in Human Prostate Cancer Cells Cancer Res., February 15, 2006; 66(4): 2107 - 2115. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aviv, A. Valdes, J. P. Gardner, R. Swaminathan, M. Kimura, and T. D. Spector Menopause Modifies the Association of Leukocyte Telomere Length with Insulin Resistance and Inflammation J. Clin. Endocrinol. Metab., February 1, 2006; 91(2): 635 - 640. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kirschenbaum, X.-H. Liu, S. Yao, G. Narla, S. L. Friedman, J. A. Martignetti, and A. C. Levine Sex steroids have differential effects on growth and gene expression in primary human prostatic epithelial cell cultures derived from the peripheral versus transition zones Carcinogenesis, February 1, 2006; 27(2): 216 - 224. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Tarry-Adkins, S. E. Ozanne, A. Norden, H. Cherif, and C. N. Hales Lower antioxidant capacity and elevated p53 and p21 may be a link between gender disparity in renal telomere shortening, albuminuria, and longevity Am J Physiol Renal Physiol, February 1, 2006; 290(2): F509 - F516. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Saitoh, M. Ohmichi, K. Takahashi, J. Kawagoe, T. Ohta, M. Doshida, T. Takahashi, H. Igarashi, A. Mori-Abe, B. Du, et al. Medroxyprogesterone Acetate Induces Cell Proliferation through Up-Regulation of Cyclin D1 Expression via Phosphatidylinositol 3-Kinase/Akt/Nuclear Factor-{kappa}B Cascade in Human Breast Cancer Cells Endocrinology, November 1, 2005; 146(11): 4917 - 4925. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Gomez-Garcia, F M Sanchez, M T Vallejo-Cremades, I A G. de Segura, and E De Miguel del Campo Direct activation of telomerase by GH via phosphatidylinositol 3'-kinase J. Endocrinol., June 1, 2005; 185(3): 421 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Edo and V. Andres Aging, telomeres, and atherosclerosis Cardiovasc Res, May 1, 2005; 66(2): 213 - 221. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang and J. Zhu The hTERT Gene Is Embedded in a Nuclease-resistant Chromatin Domain J. Biol. Chem., December 31, 2004; 279(53): 55401 - 55410. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Jiang, J. Bao, P. Li, S. V. Nicosia, and W. Bai Induction of Ovarian Cancer Cell Apoptosis by 1,25-Dihydroxyvitamin D3 through the Down-regulation of Telomerase J. Biol. Chem., December 17, 2004; 279(51): 53213 - 53221. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ren, J. S. Johnston, D. E. Shippen, and T. D. McKnight TELOMERASE ACTIVATOR1 Induces Telomerase Activity and Potentiates Responses to Auxin in Arabidopsis PLANT CELL, November 1, 2004; 16(11): 2910 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. O'Lone, M. C. Frith, E. K. Karlsson, and U. Hansen Genomic Targets of Nuclear Estrogen Receptors Mol. Endocrinol., August 1, 2004; 18(8): 1859 - 1875. [Abstract] [Full Text] [PDF] |
||||
![]() |
R Sato, C Maesawa, K Fujisawa, K Wada, K Oikawa, Y Takikawa, K Suzuki, H Oikawa, K Ishikawa, and T Masuda Prevention of critical telomere shortening by oestradiol in human normal hepatic cultured cells and carbon tetrachloride induced rat liver fibrosis Gut, July 1, 2004; 53(7): 1001 - 1009. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bourdeau, J. Deschenes, R. Metivier, Y. Nagai, D. Nguyen, N. Bretschneider, F. Gannon, J. H. White, and S. Mader Genome-Wide Identification of High-Affinity Estrogen Response Elements in Human and Mouse Mol. Endocrinol., June 1, 2004; 18(6): 1411 - 1427. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tsuchiya, M. Nakajima, S. Kyo, T. Kanaya, M. Inoue, and T. Yokoi Human CYP1B1 Is Regulated by Estradiol via Estrogen Receptor Cancer Res., May 1, 2004; 64(9): 3119 - 3125. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. Serrano and V. Andres Telomeres and Cardiovascular Disease: Does Size Matter? Circ. Res., March 19, 2004; 94(5): 575 - 584. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Takahashi, F. Higashino, M. Aoyagi, K. Yoshida, M. Itoh, S. Kyo, T. Ohno, T. Taira, H. Ariga, K. Nakajima, et al. EWS/ETS Fusions Activate Telomerase in Ewing's Tumors Cancer Res., December 1, 2003; 63(23): 8338 - 8344. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kawagoe, M. Ohmichi, T. Takahashi, C. Ohshima, S. Mabuchi, K. Takahashi, H. Igarashi, A. Mori-Abe, M. Saitoh, B. Du, et al. Raloxifene Inhibits Estrogen-induced Up-regulation of Telomerase Activity in a Human Breast Cancer Cell Line J. Biol. Chem., October 31, 2003; 278(44): 43363 - 43372. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Wittmann, N. Wang, and M. M. Montano Identification of a Novel Inhibitor of Breast Cell Growth That Is Down-Regulated by Estrogens and Decreased in Breast Tumors Cancer Res., August 15, 2003; 63(16): 5151 - 5158. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-A. Martin, I. Farmer, S. R. D. Johnston, S. Ali, C. Marshall, and M. Dowsett Enhanced Estrogen Receptor (ER) {alpha}, ERBB2, and MAPK Signal Transduction Pathways Operate during the Adaptation of MCF-7 Cells to Long Term Estrogen Deprivation J. Biol. Chem., August 15, 2003; 278(33): 30458 - 30468. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Takeda, H. Inaba, M. Yamazaki, S. Kyo, T. Miyamoto, S. Suzuki, T. Ehara, T. Kakizawa, M. Hara, L. J. DeGroot, et al. Tumor-Specific Gene Therapy for Undifferentiated Thyroid Carcinoma Utilizing the Telomerase Reverse Transcriptase Promoter J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3531 - 3538. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ikeda, H. Uemura, H. Ishiguro, M. Hori, M. Hosaka, S. Kyo, K.-i. Miyamoto, E. Takeda, and Y. Kubota Combination Treatment with 1{alpha},25-Dihydroxyvitamin D3 and 9-cis-Retinoic Acid Directly Inhibits Human Telomerase Reverse Transcriptase Transcription in Prostate Cancer Cells Mol. Cancer Ther., August 1, 2003; 2(8): 739 - 746. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Wetterau, M. J. Francis, L. Ma, and P. Cohen Insulin-Like Growth Factor I Stimulates Telomerase Activity in Prostate Cancer Cells J. Clin. Endocrinol. Metab., July 1, 2003; 88(7): 3354 - 3359. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Horikawa and J. C. Barrett Transcriptional regulation of the telomerase hTERT gene as a target for cellular and viral oncogenic mechanisms Carcinogenesis, July 1, 2003; 24(7): 1167 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Fan, Y. Wang, J. Kratz, D. J. Brat, Y. Robitaille, A. Moghrabi, E. J. Perlman, C. V. Dang, P. C. Burger, and C. G. Eberhart hTERT Gene Amplification and Increased mRNA Expression in Central Nervous System Embryonal Tumors Am. J. Pathol., June 1, 2003; 162(6): 1763 - 1769. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Wang and J. Zhu Evidence for a Relief of Repression Mechanism for Activation of the Human Telomerase Reverse Transcriptase Promoter J. Biol. Chem., May 23, 2003; 278(21): 18842 - 18850. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cherif, J. L. Tarry, S. E. Ozanne, and C. N. Hales Ageing and telomeres: a study into organ- and gender-specific telomere shortening Nucleic Acids Res., March 1, 2003; 31(5): 1576 - 1583. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Maesawa, T. Inaba, H. Sato, S. Iijima, K. Ishida, M. Terashima, R. Sato, M. Suzuki, A. Yashima, S. Ogasawara, et al. A rapid biosensor chip assay for measuring of telomerase activity using surface plasmon resonance Nucleic Acids Res., January 15, 2003; 31(2): e4 - e4. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Stewart Multiple Levels of Telomerase Regulation Mol. Interv., December 1, 2002; 2(8): 481 - 483. [Abstract] [Full Text] |
||||
![]() |
J. M. Edelberg Auto Repair on the Aging Stem Cell Superhighway Sci. Aging Knowl. Environ., September 4, 2002; 2002(35): pe13 - 13. [Abstract] [Full Text] |
||||
![]() |
Y.-S. Cong, W. E. Wright, and J. W. Shay Human Telomerase and Its Regulation Microbiol. Mol. Biol. Rev., September 1, 2002; 66(3): 407 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Abdelrahim, I. Samudio, R. Smith III, R. Burghardt, and S. Safe Small Inhibitory RNA Duplexes for Sp1 mRNA Block Basal and Estrogen-induced Gene Expression and Cell Cycle Progression in MCF-7 Breast Cancer Cells J. Biol. Chem., August 2, 2002; 277(32): 28815 - 28822. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kumaki, K. Takeda, Z.-X. Yu, J. Moss, and V. J. Ferrans Expression of Human Telomerase Reverse Transcriptase in Lymphangioleiomyomatosis Am. J. Respir. Crit. Care Med., July 15, 2002; 166(2): 187 - 191. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Mauro and D. N. Foster Regulators of Telomerase Activity Am. J. Respir. Cell Mol. Biol., May 1, 2002; 26(5): 521 - 524. [Full Text] [PDF] |
||||
![]() |
J.-L. Mergny, J.-F. Riou, P. Mailliet, M.-P. Teulade-Fichou, and E. Gilson Natural and pharmacological regulation of telomerase Nucleic Acids Res., February 15, 2002; 30(4): 839 - 865. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schrader, M. Muller, W. Schulze, R. Heicappell, H. Krause, B. Straub, and K. Miller Quantification of the expression level of the gene encoding the catalytic subunit of telomerase in testicular tissue specimens predicts successful sperm recovery Hum. Reprod., January 1, 2002; 17(1): 150 - 156. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-L. Ducrest, M. Amacker, Y. D. Mathieu, A. P. Cuthbert, D. A. Trott, R. F. Newbold, M. Nabholz, and J. Lingner Regulation of Human Telomerase Activity: Repression by Normal Chromosome 3 Abolishes Nuclear Telomerase Reverse Transcriptase Transcripts but Does Not Affect c-Myc Activity Cancer Res., October 1, 2001; 61(20): 7594 - 7602. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yokoyama, X. Wan, Y. Takahashi, A. Shinohara, and T. Tamaya Alternatively spliced variant deleting exons 7 and 8 of the human telomerase reverse transcriptase gene is dominantly expressed in the uterus Mol. Hum. Reprod., September 1, 2001; 7(9): 853 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-C. Soria, C. Moon, L. Wang, W. N. Hittelman, S. J. Jang, S.-Y. Sun, J. J. Lee, D. Liu, J. M. Kurie, R. C. Morice, et al. Effects of N-(4-Hydroxyphenyl)retinamide on hTERT Expression in the Bronchial Epithelium of Cigarette Smokers J Natl Cancer Inst, August 15, 2001; 93(16): 1257 - 1263. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Williams, J. F. Boggess, L. R. LaMarque, W. R. Meyer, M. J. Murray, M. A. Fritz, and B. A. Lessey A Prospective, Randomized Study of Endometrial Telomerase during the Menstrual Cycle J. Clin. Endocrinol. Metab., August 1, 2001; 86(8): 3912 - 3917. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Crowe, D. C. Nguyen, K. J. Tsang, and S. Kyo E2F-1 represses transcription of the human telomerase reverse transcriptase gene Nucleic Acids Res., July 1, 2001; 29(13): 2789 - 2794. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Aviv Hypothesis : Pulse Pressure and Human Longevity Hypertension, April 1, 2001; 37(4): 1060 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Clarke, F. Leonessa, J. N. Welch, and T. C. Skaar Cellular and Molecular Pharmacology of Antiestrogen Action and Resistance Pharmacol. Rev., March 1, 2001; 53(1): 25 - 72. [Abstract] [Full Text] [PDF] |
||||
![]() |
B.-S. Herbert, A. C. Wright, C. M. Passons, W. E. Wright, I. U. Ali, L. Kopelovich, and J. W. Shay Effects of Chemopreventive and Antitelomerase Agents on the Spontaneous Immortalization of Breast Epithelial Cells J Natl Cancer Inst, January 3, 2001; 93(1): 39 - 45. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zhang, C. Zheng, C. Lindvall, M. Hou, J. Ekedahl, R. Lewensohn, Z. Yan, X. Yang, M. Henriksson, E. Blennow, et al. Frequent Amplification of the Telomerase Reverse Transcriptase Gene in Human Tumors Cancer Res., November 1, 2000; 60(22): 6230 - 6235. [Abstract] [Full Text] |
||||
![]() |
Z. Wang, S. Kyo, M. Takakura, M. Tanaka, N. Yatabe, Y. Maida, M. Fujiwara, J. Hayakawa, M. Ohmichi, K. Koike, et al. Progesterone Regulates Human Telomerase Reverse Transcriptase Gene Expression via Activation of Mitogen-activated Protein Kinase Signaling Pathway Cancer Res., October 1, 2000; 60(19): 5376 - 5381. [Abstract] [Full Text] |
||||
![]() |
S. Misiti, S. Nanni, G. Fontemaggi, Y.-S. Cong, J. Wen, H. W. Hirte, G. Piaggio, A. Sacchi, A. Pontecorvi, S. Bacchetti, et al. Induction of hTERT Expression and Telomerase Activity by Estrogens in Human Ovary Epithelium Cells Mol. Cell. Biol., June 1, 2000; 20(11): 3764 - 3771. [Abstract] [Full Text] |
||||
![]() |
Y.-S. Cong and S. Bacchetti Histone Deacetylation Is Involved in the Transcriptional Repression of hTERT in Normal Human Cells J. Biol. Chem., November 10, 2000; 275(46): 35665 - 35668. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yin, A. K. Hubbard, and C. Giardina NF-kappa B Regulates Transcription of the Mouse Telomerase Catalytic Subunit J. Biol. Chem., November 17, 2000; 275(47): 36671 - 36675. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Castro-Rivera, I. Samudio, and S. Safe Estrogen Regulation of Cyclin D1 Gene Expression in ZR-75 Breast Cancer Cells Involves Multiple Enhancer Elements J. Biol. Chem., August 10, 2001; 276(33): 30853 - 30861. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Pendino, M. Flexor, F. Delhommeau, D. Buet, M. Lanotte, and E. Segal-Bendirdjian Retinoids down-regulate telomerase and telomere length in a pathway distinct from leukemia cell differentiation PNAS, June 5, 2001; 98(12): 6662 - 6667. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |