Cancer Research Meeting Calendar  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 6057-6062, December 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koo, H.-M.
Right arrow Articles by Vande Woude, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koo, H.-M.
Right arrow Articles by Vande Woude, G. F.
[Cancer Research 59, 6057-6062, December 15, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Ras Oncogene-Induced Sensitization to 1-{beta}-D-Arabinofuranosylcytosine1

Han-Mo Koo2, Mary Jane McWilliams, W. Gregory Alvord and George F. Vande Woude2,, 3

Advanced Bioscience Laboratories Basic Research Program [H-M. K., M. J. M.] and Data Management Services [W. G. A.], Inc., National Cancer Institute-Frederick Cancer Research and Development Center, and Division of Basic Sciences, National Cancer Institute, NIH [G. F. V. W.], Frederick, Maryland 21702


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Human tumor cells containing ras oncogenes display enhanced sensitivity to 1-{beta}-D-arabinofuranosylcytosine (Ara-C) and other deoxycytidine analogues (H-M. Koo, et al., Cancer Res., 56: 5211–5216, 1996). Human tumor cell lines with or without a ras oncogene as well as a pair of isogenic cell lines with one containing an activated ras oncogene were used to study the basis for differential sensitivity. We found that human tumor cells containing ras oncogenes upon entry into the S phase of the cell cycle underwent apoptosis in response to Ara-C treatment. By contrast, human tumor cells harboring wild-type ras alleles were only delayed in the S phase when exposed to Ara-C. Thus, the ras oncogene specifically renders human cells more sensitive to Ara-C by preventing S-phase arrest. This may occur by the ras oncogene compromising an S-phase checkpoint.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Ara-C4 , a deoxycytidine analogue, is presently the most effective chemotherapeutic agent in the treatment of AML as well as other hematopoietic malignancies (1 , 2) . Conversion of Ara-C to its active nucleotide derivative, Ara-CTP, is required for Ara-C-mediated cytotoxicity, and the process is influenced by multiple factors, including nucleoside transport, phosphorylation, deamination, and levels of competing metabolites, particularly dCTP (3) . Among the enzymes that are involved in the pyrimidine salvage pathway, dCK, which converts Ara-C to Ara-CMP, represents the rate-limiting step in Ara-C activation (3) . Ara-CTP inhibits a variety of DNA polymerase activities but also acts as a substrate for the polymerases and incorporates exclusively into DNA, thereby interfering with DNA synthesis (3 , 4) . A substantial body of evidence indicates that the incorporation of Ara-C into DNA is the major mechanism underlying Ara-C-mediated cytotoxicity (3 , 4) . Although Ara-C-mediated cell killing occurs mainly through the induction of apoptosis in target cells (3 , 5) , the mechanism by which Ara-C exerts its cytotoxic effects and the cellular factors that might affect Ara-C cytotoxicity or tumor cell sensitivity remain to be elucidated. The activation of a ras oncogene is the most frequent gain-of-function mutation detected in human cancer (6 , 7) . Besides its well-documented role in cellular transformation and tumorigenesis (6 , 7) , the ras oncogene was recently shown to sensitize tumor cells to Ara-C (8) as well as topoisomerase (topo) II inhibitors (8 , 9) . Human tumor cell lines harboring activated ras oncogenes displayed significantly enhanced sensitivity to deoxycytidine analogues, including Ara-C, 2,2'-O-cyclocytidine, and gemcitabine, when compared to tumor cells with wild-type ras alleles (8) . In addition, human tumor cells with activated ras oncogenes displayed enhanced apoptotic susceptibility to topo II inhibitors (9) . These findings were also consistent with studies showing increased remission rate, longer remission duration, and improved overall survival in AML patients treated with Ara-C when their leukemic cells were ras oncogene-positive (10, 11, 12) . In this report, we compare human tumor cell lines with and without ras oncogenes for differences in relative levels of dCK expression, incorporation of Ara-C into DNA, and susceptibility to Ara-C-induced apoptosis. We find that cells possessing an activated ras oncogene fail to arrest in the S phase when treated with Ara-C and undergo apoptotic death. In addition, we show that when IHKE cells are transformed with a ras oncogene (IHKEras), they behave like other human tumor cell lines possessing a ras oncogene and display enhanced sensitivity to Ara-C.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Lines and Compounds.
NSCL and colon carcinoma cell lines of the NCI-ADS (13) were used in this study, for which the status of ras mutations and Ara-C sensitivity had been described previously (Ref. 8 ; Table 1Citation ). Population doubling times of these cell lines (Table 1)Citation has been presented by O’Connor et al. (14) . The isogenic IHKE, IHKEDCR, and IHKEras cell lines were described elsewhere (9) . All compounds used in this study were obtained through the Drug Synthesis and Chemistry Branch of the National Cancer Institute (Bethesda, MD).


View this table:
[in this window]
[in a new window]

 
Table 1 Cellular characteristics of NSCL and colon carcinoma lines of NCI-ADS used in this study

 
Quantitative RT-PCR.
Total RNA was isolated from the NCI-ADS tumor cell lines by use of the RNAzol reagent following the manufacturer’s recommendations (Tel-Test, Inc., Friendswood, TX). An RT-PCR reaction was performed using the rTth reverse transcriptase/DNA polymerase RNA PCR kit (Perkin-Elmer Biosystems, Foster City, CA). The RT reaction from total RNA was carried out at 70°C for 15 min using a specific downstream primer. The cDNA was then amplified and radiolabeled by PCR reaction in the presence of a specific upstream primer and [{alpha}32P]dCTP (3000 Ci/mmol, Amersham Life Science, Inc., Arlington Heights, IL). The PCR amplification was carried out with a single denaturation step at 95°C for 1 min preceding 35 cycles of 95°C for 15 s, of 50°C for 15 s, and of 72°C for 30 s with 1 s per cycle extension, followed by the incubation at 72°C for 6 min. DNA sequences of the human dCK-specific primers used were: upstream primer, TGGGATCCCACAAGACTAAGGAATGGCC; downstream primer, AGAATTCAGCAAGATCACAAAGTACTCAAAAACTC. The GAPDH cDNA was also amplified from each RNA as a reference, and DNA sequences of the specific primers used were: upstream primer, GGTGAAGGTCGGAGTCAACG; downstream primer, CTTCTGCATGGTGGTGAAGA. The products were then separated in a 8% polyacrylamide gel. The gel was dried and exposed in a Bio-Imaging Analyzer BAS1000 (Fuji Medical Systems USA, Inc., Stamford, CT). A band intensity was determined using a MacBAS software (Fuji Medical Systems USA, Inc., Stamford, CT). The relative intensity of the dCK band to the GAPDH band for each cell line was calculated by the formula, (dCK band intensity - background)/(GAPDH band intensity - background) x 100. By this calculation, the dCK band intensity found in NCI-H23 cells was the lowest. The relative expression level of dCK mRNA in each cell line was expressed as a ratio to the level found in NCI-H23 cells, which was set as 1.00.

Flow Cytometry.
Total cells including floating cells were harvested, washed in PBS, and fixed in ice-cold 70% ethanol overnight. The fixed cells were rehydrated in PBS, incubated with DNase-free RNase at room temperature for 30 min, and then stained with 50 µg/ml propidium iodide for 30 min on ice. To determine the relative S-phase fraction, samples were analyzed in a FACScan, and the cell cycle distribution was estimated using the SOBR method of CellFIT software (Becton Dickinson, San Jose, CA). All other samples were analyzed using a FACSCalibur (Becton Dickinson, San Jose, CA).

Incorporation of Ara-C into DNA.
Actively growing cells were incubated with 10 µM [3H]Ara-C (16 Ci/mmol, Amersham Life Science, Inc., Arlington Heights, IL) for 5 h. Labeled cells were washed twice in PBS and then incubated with 100 µg/ml proteinase K in 10 mM Tris-HCl (pH 8.0), 25 mM EDTA, 0.5% SDS, 100 mM NaCl at 50°C for 12 h. Genomic DNA was purified by phenol/chloroform extraction followed by ethanol precipitation. The DNA amount was quantitated, and radioactivity from each sample was determined. Based on the counting efficiency for [3H] and the specific activity of [3H]Ara-C, the incorporation was expressed in picomoles of Ara-C incorporated per milligram of genomic DNA.

Quantitation of Apoptosis.
Apoptosis was quantitated by staining DNA with DAPI and then examining nuclear morphology and DNA condensation with fluorescent microscopy, as described previously (9) . Approximately 400 nuclei from each sample were examined, and apoptosis was expressed as a percentage to the total number of nuclei examined.

In Vitro Growth Inhibition Assay.
Each compound was tested at five 10-fold dilutions in quadruplicate wells in a microtiter culture plate. After 48 h of continuous exposure to a test compound, cells were fixed in situ and then stained with sulforhodamine B, followed by solubilization of the stain with Tris buffer, as described previously (13) . The percentage of relative growth was determined based on an untreated control, as described previously (13) .

Western Blot Analysis.
Western blot analysis was performed as described previously (9) . The primary antibodies used in this report are antihuman cyclin D (Upstate Biotechnology, Lake Placid, NY), anticyclin A (BF683; Santa Cruz Biotechnology, Santa Cruz, CA), anti-p27Kip1, and anti-Cdk2 (Transduction Laboratories, Lexington, KY).

Statistical Analysis.
Pearson correlation coefficients (r) and associated probabilities (P) were calculated using S-PLUS 4 (Data Analysis Products, Mathsoft, Seattle, WA). Tests of hypotheses were performed using analyses of variance, regression analyses, and nonparametric analyses. All statistical tests were two-sided.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cellular Characteristics, Ara-C Incorporation, and Ara-C Sensitivity.
Tumor cells containing activated ras oncogenes exhibit enhanced sensitivity to Ara-C (8) . The cytotoxic actions of Ara-C are dependent upon DNA synthesis and are therefore directed toward cells in the S phase of the cell cycle (2 , 3) . We first tested whether the growth rate and/or the S-phase fraction distribution in the NSCL and colon carcinoma cell lines of the NCI-ADS were influenced by the presence of activated ras oncogenes to explain the enhanced sensitivity to Ara-C. However, neither the population doubling times nor the relative S-phase fractions correlated with either Ara-C sensitivity or ras mutation status (Ps > .05; Table 1Citation ). We also tested whether the expression levels of the rate-limiting enzyme dCK were up-regulated in the tumor cells harboring an activated ras oncogene, which would serve to more efficiently convert Ara-C to cytotoxic Ara-CTP. However, no correlation was found between the relative levels of dCK expression and either the Ara-C sensitivity or the ras mutation status (Ps > .05; Table 1Citation ). Furthermore, there were no mutations found in dCK cDNAs determined from three of the least sensitive human tumor lines (data not shown).

The level of Ara-C incorporation has been shown to correlate with both in vitro sensitivity and in vivo response (2, 3, 4) . We measured the amount of [3H]Ara-C incorporated into the genomic DNA in four of the human tumor cell lines that displayed the greatest differences in Ara-C sensitivity (Table 1)Citation . [3H]Ara-C incorporation was not significantly different among the cell lines tested (Table 2)Citation . Therefore, the enhanced sensitivity to Ara-C exhibited by the ras oncogene-containing lines was not due to an influence on growth rate, S-phase fraction, dCK expression, or differential Ara-C incorporation (Tables 1Citation and 2)Citation .


View this table:
[in this window]
[in a new window]

 
Table 2 Incorporation of Ara-C into DNA of tumor cell lines

 
Apoptosis Induced by Ara-C in Human Tumor Cell Lines.
We determined whether the preferential sensitivity of the ras oncogene-containing human tumor cells to Ara-C was associated with enhanced apoptosis. In general, Ara-C-mediated cell killing is thought to occur through the induction of apoptosis in target tumor cells (3 , 5) . We found that apoptosis directly correlated with Ara-C sensitivity (r = 0.842, P < 0.001; compare Fig. 1Citation and Table 1Citation ) and that the human tumor cell lines containing ras oncogenes were uniformly much more sensitive to Ara-C-induced apoptosis than the tumor lines with wild-type ras alleles (Wilcoxon rank-sum test, P = 0.0002; Fig. 1Citation ). Thus, the presence of an activated ras oncogene markedly enhances the sensitivity of tumor cells to apoptosis induced by Ara-C.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Apoptosis induced by Ara-C in NSCL and colon carcinoma cell lines of NCI-ADS. After 48 h of continuous incubation of the cells with 10 µM Ara-C, apoptosis was quantitated by staining DNA with DAPI and then examining nuclear morphology and DNA condensation. Apoptosis was scored and expressed as a percentage to the total number of nuclei examined. Tumor cell lines containing wild-type ras alleles are depicted with a open column, and tumor lines with ras oncogenes are depicted with a closed column. The experiment was performed on triplicate samples, and the data are shown with SDs. The SDs too small to show are not indicated.

 
Sensitivity of IHKEras Cells to Ara-C-Induced Apoptosis.
We established IHKEras cells ectopically expressing the H-rasV12 oncogene (9) and compared their response to the parental IHKE cell response to Ara-C using an in vitro growth inhibition assay (13) . For comparison, we also tested the sensitivity of IHKE-derived cells to aphidicolin, a DNA polymerase {alpha} inhibitor, and hydroxyurea, a ribonucleotide reductase inhibitor, which also act in the S phase of the cell cycle. Strikingly, the IHKEras cells displayed marked sensitivity to Ara-C at all concentrations tested, relative to the parental IHKE and vector control cells (IHKEDCR), but we observed no differences among the IHKE-derived cell lines in their sensitivity to either aphidicolin or hydroxyurea (Fig. 2)Citation . Furthermore, apoptosis accounted for the enhanced sensitivity of IHKEras cells to Ara-C (Fig. 2)Citation . By contrast, we observed little or no differences in susceptibility to either aphidicolin-induced or hydroxyurea-induced apoptosis in IHKEras cells compared to IHKE or IHKEDCR cells (Fig. 2)Citation .



View larger version (23K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Sensitivity to and apoptosis induced by Ara-C, aphidicolin, and hydroxyurea in IHKE-derived cell lines. Upper panels, the parental IHKE ({square}), vector-transfected IHKEDCR ({diamond}), and ras oncogene-expressing IHKEras ({circ}) cells were tested for their in vitro sensitivity to the S-phase-directed Ara-C, aphidicolin, and hydroxyurea. Sensitivity is expressed as a percentage of the relative growth in treated cells compared to the untreated control cells. Data shown are the average values calculated from three independent tests with SEs indicated. Lower panels, at each corresponding concentration, apoptosis induced by each compound was also quantitated. Apoptosis is expressed as a percentage to the total number of nuclei examined, as described in the legend to Fig. 1Citation . Data shown are the average values calculated from two independent assays with SEs indicated. SEs are not indicated when they are smaller than plot symbols.

 
Progressive Cellular Responses to Ara-C.
To determine where in the cell cycle the sensitivity to Ara-C is observed, we analyzed the cell cycle profiles of tumor cell lines during 48 h of exposure to 10 µM Ara-C. For these analyses, we compared representative cell lines with wild-type and mutant ras alleles, respectively, from the NSCL carcinoma (NCI-H322M and NCI-H23) or colon carcinoma (HT-29 and HCT-116) panels with similar growth rates (Table 1)Citation . None of the cell lines showed a dramatic response to Ara-C during the first 12 h, whether or not mutant ras was present. By 12 h, there was an overall trend for cells to accumulate in the G1-S phase and a concomitant decrease of cells in the G2-M phase (Fig. 3A)Citation . However, by 24 h, we observed significant differences in the cellular response to Ara-C according to the ras mutation status. Tumor cells containing wild-type ras alleles (NCI-H322M and HT-29) displayed either growth arrest (NCI-H322M) or a delayed progression through the S phase (HT-29) with little or no apoptosis (Fig. 3A)Citation . By contrast, apoptosis was observed in tumor cells containing ras oncogenes (NCI-H23 and HCT-116), and by 48 h with Ara-C, apoptosis was significantly greater (44–46%) than those with wild-type ras alleles (4–5%; Fig. 3ACitation ). We observed a similar apoptotic response in the other mutant ras-containing human tumor cell lines (Table 1)Citation after 48 h of incubation (data not shown). Thus, the onset of apoptosis occurs earlier in the ras oncogene-containing tumor cells, and the extent of apoptosis is ~10 times greater than in cells with wild-type ras alleles (Fig. 3A)Citation .



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A, progressive cell cycle responses of NSCL (NCI-H322M and NCI-H23) and colon (HT-29 and HCT-116) carcinoma cell lines to Ara-C. The ras mutation status of each cell line is indicated in parenthesis. Cells treated with 10 µM Ara-C for 0, 6, 12, 24, 36, or 48 h were collected for the flow cytometric analysis of the cell cycle profile. B, progressive cell cycle responses of the IHKE-derived cell lines to Ara-C. The IHKEDCR and IHKEras cells were treated with 1 µM Ara-C for 0, 24, and 48 h, and a cell cycle profile of each sample was analyzed by flow cytometry. An additional sample was prepared from each cell line by treating cells with Ara-C for 24 h and then washing them thoroughly with fresh medium followed by further incubation in fresh medium for 24 h (-Ara-C, 24 h). Based on the cell cycle profile of the 0-h (untreated) sample for each cell line, G1 and G2-M fractions are indicated with a gray background. A portion of each sample was stained with DAPI to quantitate apoptosis, and a percentage of apoptosis was shown at the top left corner of each panel. The experiment was repeated twice for the tumor cell lines and three times for the IHKE-derived cells with similar results. Data shown are each from a representative experiment.

 
We tested the influence of Ara-C (1 µM) on the progression of IHKE-derived cell lines through cell cycle. Control IHKEDCR cells (or parental IHKE cells; data not shown) were dramatically delayed in the S phase after 48-h exposure to Ara-C, whereas the IHKras cells underwent extensive apoptosis (~34%; Fig. 3BCitation ). We also tested whether the Ara-C-induced damage was reversible by removing the drug after 24 h of incubation. Whereas the IHKEDCR cells showed a significant cell population shift to the G1 phase 24 h after the removal of Ara-C, the IHKEras cells continued to undergo extensive apoptosis or remained in the S phase (Fig. 3B)Citation . These results indicate that the IHKEras cells are committed to apoptosis after 24 h of incubation with Ara-C, whereas the effect of Ara-C on the IHKE cells with wild-type ras alleles was cytostatic and mostly reversible.

Expression of Cell Cycle Regulators in IHKEras Cells.
The above results suggested that the IHKEras cells continued through the S phase in the presence of Ara-C-induced damage. We would expect, therefore, higher expression of the molecules that regulate cell cycle in the cells with a ras oncogene compared to wild-type IHKE cells. In IHKEras cells, we found that cyclins D1 and A were overexpressed (Fig. 4A)Citation . Moreover, cyclin A-associated cyclin-dependent kinase 2 (A/Cdk2) activity was slightly elevated, whereas p27Kip1 expression was down-regulated when compared to control IHKE cells (Fig. 4ACitation ; data not shown). These data are consistent with results from others (15, 16, 17) on the role of ras oncogenes in inducing or interfering with these cell cycle regulators. We found no differences, however, in the levels of cyclins D2, D3, E, p16INK4a, p15INK4b, p21Waf1/Cip1, Cdk2, Cdk4, Cdk6, RB, and c-Myc (Fig. 4ACitation ; data not shown). The p27Kip1 protein in IHKEras cells did not increase upon withdrawal of serum (Fig. 4B)Citation , nor did it increase in the parental IHKE or IHKras cells during response to Ara-C (data not shown). These data suggest that an activated ras oncogene enhances progression through the S phase by compromising the cell cycle checkpoint controls associated with Ara-C-induced DNA damage.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Expression levels of cell cycle regulators in IHKE, IHKEDCR (DCR), and IHKEras (H-rasV12) cells. A, lysates were prepared from cells in the exponential growth phase and then subjected to Western blot analysis. B, lysates were prepared from cells grown in media containing 5% serum (serum+) or 0.1% serum (serum-) for 52 h and then immunoblotted and probed with the anti-p27Kip1 antibody. The antibody used in each blot is indicated, and the corresponding band is marked. Each blot was reprobed with the anti-{alpha}-tubulin antibody to demonstrate loadings (data not shown).

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Human tumor cells harboring activated ras oncogenes exhibit enhanced sensitivity to Ara-C and other deoxycytidine analogues (8) . In this report, we show that the ras oncogene allows the S phase to proceed in the presence of Ara-C-induced damage leading to drug-induced apoptosis (Figs. 1Citation and 3ACitation ). We also show that the IHKEras cells ectopically expressing a ras oncogene also display enhanced sensitivity to Ara-C, as well as the failure to arrest in the S phase followed by apoptotic response (Figs. 2Citation and 3BCitation ). These results and previous results (9) indicate that the presence of an activated ras oncogene in human tumor cells renders these cells more sensitive to apoptosis conferred by both Ara-C and topo II inhibitors. These findings provide a molecular basis for the synergistic effects of these drugs when used in combination as in the treatment of AML (1) .

The cytotoxic metabolite, Ara-CTP acts as an inhibitor of DNA polymerases and also as a substrate, resulting in its incorporation into the elongating DNA strands (3 , 4) . The interference with DNA synthesis by these activities also leads to a feedback inhibition of ribonucleotide reductase functions (18) . However, the relative contribution of these activities to Ara-C-mediated cytotoxicity is not fully understood. The susceptibility of IHKE-derived cell lines to apoptosis induced by a DNA polymerase inhibitor, aphidicolin, or by a ribonucleotide reductase inhibitor, hydroxyurea (Fig. 2)Citation , and the profiles of cell cycle responses to Ara-C (Fig. 3)Citation suggest that the incorporation of Ara-C into DNA and the ras oncogene-mediated failure to arrest at the S phase in response to Ara-C damage are the major factors responsible for its enhanced apoptotic cytotoxicity in the ras oncogene-containing human tumor cells. However, apoptotic response to Ara-C was enhanced in the ras oncogene-containing tumor cells (Fig. 1)Citation without significant differences in the degree of incorporation between the cell lines (Table 2)Citation . We analyzed the expression levels of Bcl-2 family proteins (i.e., Bcl-2, Bax, Bcl-XS/L, Bad, Bak, and Mcl-1), which control common aspects of apoptosis, and did not find any variations in the IHKE-derived cell lines (data not shown). These results suggest that the activated ras oncogene either potentiates an upstream step in apoptotic signaling or compromises an S-phase checkpoint to translate Ara-C-induced damage into an apoptotic signal. We also note that this is most likely a specific phenotype of human cells because rodent cells transformed by ras oncogenes, in our hands, do not display enhanced sensitivity to Ara-C (data not shown). These differences could be due to differences in checkpoint functions in human versus rodent cells (Ref. 19 ; see below).

Analysis of expression of cell cycle machinery in IHKE-derived cell lines revealed multiple changes affecting S-phase control in IHKEras cells (Fig. 4Citation ; data not shown). These results suggest that failure of the ras oncogene-containing cells to arrest or delay in the S phase in response to Ara-C-induced damage may be responsible for enhanced susceptibility to apoptosis. Furthermore, the increase in A/Cdk2 activity has been shown to be associated with apoptosis in general (20, 21, 22, 23) . However, it still remains to be clarified whether any of these changes, either singularly or in combination, are involved in the ras oncogene-mediated checkpoint deregulation and sensitization to Ara-C-induced apoptosis. For example, our preliminary data indicate that overexpression of cyclin D1 alone confers a slight resistance to Ara-C-induced apoptosis5 .

Analysis of progressive cell cycle responses to Ara-C revealed profound differences in the cellular responses based on the ras mutation status. Ara-C caused marked S-phase growth arrest in cells containing wild-type ras alleles (Fig. 3)Citation , which was reversible upon removal of the drug (Fig. 3B)Citation . By contrast, Ara-C did not arrest cells in the S phase that contained an activated ras oncogene promoting irreversible apoptosis (Fig. 3)Citation . These results demonstrate that the activated ras oncogene alters cellular response to a chemotherapeutic drug from cytostatic to cytotoxic. As previously proposed (8) , this may occur by compromising cellular checkpoint functions. However, it is the very same process that enhances the tumor-dependent genetic instability and it is, therefore, fortuitous that the same mechanism renders tumor cells more susceptible to cytotoxic drugs. The putative checkpoint function(s) altered by an activated ras oncogene to enhance Ara-C sensitivity is not known, but our cell cycle analysis (Fig. 3)Citation suggests that it is functional during the DNA synthesis phase.


    ACKNOWLEDGMENTS
 
We thank G. Taylor, M. Murakami, C. Webb, and B. Williams for their critical reading of the manuscript. We also thank A. Cline for manuscript preparation.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Research was sponsored in part by the National Cancer Institute, Department of Health and Human Services, under contract with ABL. Back

2 Present address: Van Andel Research Institute, 201 Monroe Avenue, NW, Suite 400, Grand Rapids, MI 49503. Back

3 To whom requests for reprints should be addressed, at Van Andel Research Institute, 201 Monroe Avenue, NW, Suite 400, Grand Rapids, MI 49503; Phone: (616) 235-8242; Fax: (616) 235-8245. Back

4 The abbreviations used are: Ara-C, 1-{beta}-D-arabinofuranosylcytosine; AML, acute myeloid leukemia; dCK, deoxycytidine kinase; IHKE, immortalized human kidney epithelial; NSCL, non-small cell lung; NCI-ADS, National Cancer Institute’s In Vitro Antineoplastic Drug Screen; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; DAPI, 4'6-diamidine-2'-phenyline dihydrochloride. Back

5 H-M. Koo, M. J. McWilliams, and G. F. Vande Woude, unpublished observations. Back

Received 6/ 1/99. Accepted 10/27/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Rohatiner A. Z. S., Lister T. A. The treatment of acute myelogenous leukemia 5th ed. Henderson E. S. Lister T. A. eds. . Leukemia, : 485-514, W. B. Saunders Co. Philadelphia 1990.
  2. Rustum Y. M., Raymakers R. A. 1-{beta}-Arabinofuranosylcytosine in therapy of leukemia: preclinical and clinical overview. Pharmacol. Ther., 56: 307-321, 1992.[Medline]
  3. Grant S. Ara-C. Cellular and molecular pharmacology Woude G. F. V. Klein G. eds. . Advances in Cancer Research, 72: 195-233, Academic Press San Diego, CA 1998.
  4. Kufe D. W., Spriggs D. R. Biochemical and cellular pharmacology of 1-{beta}-D-arabinofuranosylcytosine. Semin. Oncol., 12: 34-48, 1985.[Medline]
  5. Mesner J. P. W., Budihardjo I. I., Kaufmann S. H. Chemotherapy-induced apoptosis. Adv. Pharmacol., 41: 461-498, 1997.
  6. Bos J. L. ras Oncogenes in human cancer: A review. Cancer Res., 49: 4682-4689, 1989.[Abstract/Free Full Text]
  7. Barbacid M. ras Oncogenes: Their role in neoplasia. Eur. J. Clin. Invest., 20: 225-235, 1990.[Medline]
  8. Koo H-M., Monks A., Mikheev A., Rubinstein L. V., Gray-Goodrich M., McWilliams M. J., Alvord W. G., Oie H. K., Gazdar A. F., Paull K. D., Zarbl H., Vande Woude G. F. Enhanced sensitivity to 1-{beta}-D-arabinofuranosylcytosine and topoisomerase II inhibitors in tumor cell lines harboring activated ras oncogenes. Cancer Res., 56: 5211-5216, 1996.[Abstract/Free Full Text]
  9. Koo H-M., Gray-Goodrich M., Kohlhagen G., McWilliams M. J., Jeffers M., Vaigro-Wolff A., Alvord W. G., Monks A., Paull K. D., Pommier Y., Vande Woude G. F. The ras oncogene-mediated sensitization of human cells to topoisomerase II inhibitor-induced apoptosis. J. Natl. Cancer Inst., 91: 236-244, 1999.[Abstract/Free Full Text]
  10. Neubauer A., Dodge R. K., George S. L., Davey F. R., Silver R. T., Schiffer C. A., Mayer R. J., Ball E. D., Wurster-Hill D., Bloomfield C. D., Liu E. T. Prognostic importance of mutations in the ras proto-oncogenes in de novo acute myeloid leukemia. Blood, 83: 1603-1611, 1994.[Abstract/Free Full Text]
  11. Coghlan D. W., Morley A. A., Matthews J. P., Bishop J. F. The incidence and prognostic significance of mutations in codon 13 of the N-ras gene in acute myeloid leukemia. Leukemia, 8: 1682-1687, 1994.[Medline]
  12. Liu E. T., Dodge R., Meyer A., Zhang X. X., Schiffer C., Mayer R., Bloomfield C. D. De novo acute myeloid leukemias harboring ras mutations exhibit preferential sensitivity to dose intensive cytarabine as consolidation therapy. Blood, 86: 2380 1995.
  13. Monks A., Scudiero D., Skehan P., Shoemaker R., Paull K., Vistica D., Hose C., Langley J., Cronise P., Vaigro-Wolff A., Gray-Goodrich M., Campbell H., Mayo J., Boyd M. Feasibility of a high-flux anticancer drug screen using a diverse panel of cultured human tumor cell lines. J. Natl. Cancer. Inst., 83: 757-766, 1991.[Abstract/Free Full Text]
  14. O’Connor P. M., Jackman J., Bae I., Myers T. G., Fan S., Mutoh M., Scudiero D. A., Monks A., Sausville E. A., Weinstein J. N., Friend S., Fornace A. J., Kohn K. W. Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123 anticancer agents. Cancer Res., 57: 4285-4300, 1997.[Abstract/Free Full Text]
  15. Filmus J., Robles A. I., Shi W., Wong M. J., Colombo L. L., Conti C. J. Induction of cyclin D1 overexpression by activated ras. Oncogene, 9: 3627-3633, 1994.[Medline]
  16. Winston J. T., Coats S. R., Wang Y-Z., Pledger W. J. Regulation of the cell cycle machinery by oncogenic ras. Oncogene, 12: 127-134, 1996.[Medline]
  17. Leone G., DeGregori J., Sears R., Jakoi L., Nevins J. R. Myc and ras collaborate in inducing accumulation of active cyclin E/Cdk2 and E2F. Nature (Lond.), 387: 422-426, 1997.[Medline]
  18. Wang L-M., White J. C., Capizzi R. L. The effect of ara-C-induced inhibition of DNA synthesis on its cellular pharmacology. Cancer Chemother. Pharmacol., 25: 418-424, 1990.[Medline]
  19. Weinert T., Lydall D. Cell cycle checkpoints, genetic instability and cancer. Semin. Cancer Biol., 4: 129-140, 1993.[Medline]
  20. Meikrantz W., Gisselbrecht S., Tam S. W., Schlegel R. Activation of cyclin A-dependent protein kinases during apoptosis. Proc. Natl. Acad. Sci. USA, 91: 3754-3758, 1994.[Abstract/Free Full Text]
  21. Hoang A. T., Cohen K. J., Barrett J. F., Bergstrom D. A., Dang C. V. Participation of cyclin A in Myc-induced apoptosis. Proc. Natl. Acad. Sci. USA, 91: 6875-6879, 1994.[Abstract/Free Full Text]
  22. Bortner D. M., Rosenberg M. P. Overexpression of cyclin A in the mammary glands of transgenic mice results in the induction of nuclear abnormalities and increased apoptosis. Cell Growth & Differ., 6: 1579-1589, 1995.[Abstract]
  23. Meikrantz W., Schlegel R. Suppression of apoptosis by dominant negative mutants of cyclin-dependent protein kinases. J. Biol. Chem., 271: 10205-10209, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
JCOHome page
A. Neubauer, K. Maharry, K. Mrozek, C. Thiede, G. Marcucci, P. Paschka, R. J. Mayer, R. A. Larson, E. T. Liu, and C. D. Bloomfield
Patients With Acute Myeloid Leukemia and RAS Mutations Benefit Most From Postremission High-Dose Cytarabine: A Cancer and Leukemia Group B Study
J. Clin. Oncol., October 1, 2008; 26(28): 4603 - 4609.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Illmer, C. Thiede, A. Fredersdorf, S. Stadler, A. Neubauer, G. Ehninger, and M. Schaich
Activation of the RAS Pathway Is Predictive for a Chemosensitive Phenotype of Acute Myelogenous Leukemia Blasts
Clin. Cancer Res., May 1, 2005; 11(9): 3217 - 3224.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. F. V. Woude, G. J. Kelloff, R. W. Ruddon, H.-M. Koo, C. C. Sigman, J. C. Barrett, R. W. Day, A. P. Dicker, R. S. Kerbel, D. R. Parkinson, et al.
Reanalysis of Cancer Drugs: Old Drugs, New Tricks
Clin. Cancer Res., June 1, 2004; 10(11): 3897 - 3907.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Koo, H.-M.
Right arrow Articles by Vande Woude, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Koo, H.-M.
Right arrow Articles by Vande Woude, G. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online