Cancer Research Annual Meeting 2010  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 6214-6222, December 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nomoto, M.
Right arrow Articles by Kohno, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nomoto, M.
Right arrow Articles by Kohno, K.
[Cancer Research 59, 6214-6222, December 15, 1999]
© 1999 American Association for Cancer Research


Molecular Biology and Genetics

Structural Basis for the Regulation of UDP-N-Acetyl-{alpha}-D-galactosamine: Polypeptide N-Acetylgalactosaminyl Transferase-3 Gene Expression in Adenocarcinoma Cells1

Minoru Nomoto, Hiroto Izumi, Tomoko Ise, Ken Kato, Hiroshi Takano, Gunji Nagatani, Kazunori Shibao, Ryo Ohta, Toshihiro Imamura, Michihiko Kuwano, Ken-ichi Matsuo, Yuji Yamada, Hideaki Itoh and Kimitoshi Kohno2

Departments of Molecular Biology [M. N., H. Iz., T. Is., K. Ka., H. T., G. N., T. Im., K. Ko.] and Surgery I [K. S., R. O., H. It.], University of Occupational and Environmental Health, Japan, School of Medicine, Kitakyushu 807-8555; Department of Biochemistry, Kyushu University, School of Medicine, Maidashi, Higashi-ku, Fukuoka 812-8582 [M. K.]; and Hanno Research Center, Taiho Pharmaceutical Co., Ltd., Saitama 357-0041 [K. M., Y. Y.], Japan


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyl transferase-3 (Gal NAc-T3) gene, a member of the Gal NAc transferase gene family, is expressed in a tissue-specific manner. To elucidate the function of this gene, we have focused on the molecular mechanism underlying regulation of gene expression. We have cloned Gal NAc-T3 cDNA and used it to show that Gal NAc-T3 mRNA is expressed in tumor cell lines derived from secretory epithelial tissue adenocarcinomas but not in cell lines derived from bladder and epidermoid carcinomas. Using a polyclonal antibody to Gal NAc-T3, we observed protein expression in adenocarcinoma but not non-adenocarcinoma cell lines, and in breast carcinoma cells but not in normal breast tissue. We used Gal NAc-T3 cDNA to isolate three overlapping genomic clones containing the 5'-portion of the human Gal NAc-T3 gene, and we sequenced 1.6 kb around the first exon. A transient expression assay using the luciferase gene showed that promoter activity was much higher in MCF-7 cells than in KB cells. In vivo footprint experiments showed significant protection of a distal GC box, an NRF-1 site, and an AP-2 site in MCF-7 cells. A novel stem and loop structure extending from nucleotide -103 to nucleotide -165 and contiguous to these transcription factor binding sites seemed to be functional in regulating Gal NAc-T3 gene transcription, and a KMnO4 footprint experiment showed that this stem and loop structure could be formed in vivo. We also observed dimethyl sulfate hypersensitive sites in the untranslated region around nucleotide +50 in MCF-7 but not in KB cells. These findings indicate that Gal NAc-T3 gene expression is regulated by multiple systems, including transcription factor binding sites and a stem-and-loop structure, and that this regulation is restricted to cell lines derived from epithelial gland adenocarcinomas but not cells derived from nonsecretory epithelial tissue carcinomas. In addition, our immunohistochemical results suggest that our anti-Gal NAc-T3 antibody may be useful for diagnostic purposes in the early stages of breast cancer.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The initial glycosylation of mucin type O-linked proteins is catalyzed by one of the UDP-Gal NAc: polypeptide N-acetyl-galactosaminyl transferases (Gal NAc-transferase family of enzymes; Refs. 1, 2, 3 ). To date, three distinct human Gal NAc-transferase genes, Gal NAc-T1, Gal NAc-T2 and Gal NAc-T3,3 have been cloned and characterized (1 , 4 , 5) , and recently another three homologues, Gal NAc-T4, Gal NAc-T5, and Gal NAc-T6, have been cloned (6, 7, 8) . In comparison with the expression of Gal NAc-T1 and Gal NAc-T2, the expression of Gal NAc-T3 has been found to be highly tissue specific, and mRNA encoded by the Gal NAc-T3 gene has been detected in organs that contain secretory epithelial glands (2, 3, 4, 5) . In addition, it was recently shown that, although both Gal NAc-T1 and Gal NAc-T2 gene products are constitutively expressed at low levels in human adenocarcinoma cell lines, Gal NAc-T3 gene products are highly expressed in the same cells (9) , suggesting that an anti-Gal NAc-T3 antibody may be useful in tumor diagnosis.

Although the three Gal NAc-transferases have been extensively investigated, it is not known whether they are isoenzymes with redundant or unique functions, and their principal substrates have not been identified. In fact, no obvious phenotypic abnormalities were detected in mice in which a close homologue of the Gal NAc-T1 gene had been knocked out (10) . To elucidate the function of the Gal NAc genes, we have focused our attention on the molecular mechanism underlying the epithelial gland-specific expression of the Gal NAc-T3 gene. We therefore cloned Gal NAc-T3 cDNA and showed that mRNA encoded by this gene is highly expressed in human tumor cell lines arising from epithelial glands, such as breast, colon, and prostate cancers, but not in tumor cell lines derived from nonsecretory epithelial tissues, such as epidermoid and bladder carcinomas. We further investigated the mechanism involved in tissue-specific expression of the Gal NAc-T3 gene by isolating genomic clones containing the promoter region of this gene and using these clones to assay the binding of transcription factors to regulatory elements in the promoter.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Materials.
Restriction enzymes and other nucleic acid-modifying enzymes were obtained from Takara Shuzo (Kyoto, Japan). Both [{alpha}-32P]dCTP and [{gamma}-32P]ATP were from Amersham Pharmacia Biotech.

Cell Culture.
Human cancer cell lines were cultured in their appropriate medium (11, 12, 13, 14) .

Northern Blot Analysis.
Northern blot analysis was carried out as described (15) .

Preparation of Rabbit Antiserum to Human Gal NAc-T3 and Western Blotting.
Antiserum to Gal NAc-T3 was generated by multiple immunization of a New Zealand White rabbit with the synthetic peptide KGYYTAAELKPVLDRPPQDS (K plus Residues 100–118; Fig. 1Citation ), as described (15 , 16) .



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. cDNA sequence of the 5'-terminal portion of human Gal NAc-T3 mRNA. Residues are numbered from the EcoRI site in the vector. The AUG initiation codon is underlined. Both EcoRI and HindIII sites are underlined with broken lines. The position of the amino acid sequence used to design the synthetic peptide is boxed. The sequences of the RT-PCR primers are denoted by arrowheaded lines.

 
For Western blotting, cell lysates were prepared in 10 mM Tris-HCl (pH 7.9), 150 mM NaCl, 1% NP40, 1 mM phenylmethylsulfonyl fluoride, and nuclei were removed by centrifugation at 15,000 rpm for 5 min at 4°C. Cytoplasmic proteins were separated on a 10% SDS-PAGE gel and transferred to a filter with a semidry blotter. Immunoblot analysis was performed with a 1:5000 dilution of anti-Gal NAc-T3 antibody (15 , 16) .

Immunohistochemistry.
Mammary epithelium resected from a patient with mammary cancer was fixed in formalin and embedded in paraffin. Two-µm-thick sections were stained with anti-human Gal NAc-T3 antibody, and immunohistochemistry was performed using a streptavidin-biotin-peroxidase complex method. Briefly, endogenous peroxidase activity was blocked by preincubating the slides in 3% H2O2 in absolute methanol for 5 min. Each slide was preincubated in rabbit serum for 10 min and then incubated with the primary antibody for 60 min, washed thoroughly, incubated in antirabbit immunoglobulin for 30 min, washed, and incubated with streptavidin-biotinylated horseradish peroxidase complex for 20 min. Diaminobenzidine was used as a chromogen, and the sections were lightly counterstained with hematoxylin. Substitution of PBS for the primary antibody was used as the negative control.

Cloning and Sequencing of a Human Gal NAc-T3 cDNA.
Human Gal NAc-T3 cDNA was prepared from MCF-7 poly(A)+ RNA by RT-PCR using the primers 5'-GGATTTAATGCTAGAAGCTGTAAAC-3' and 5'- AGGTTCTAGCCAACCATAGAAACAC-3' (Fig. 1)Citation . The RT-PCR product was used to screen a human colon cDNA library constructed in the expression vector, {lambda}gt 11 (Clontech).

Isolation of Genomic Clones and DNA Sequencing.
Using a 310-bp EcoRI-HindIII fragment from Gal NAc-T3 cDNA, genomic Gal NAc-T3 clones were isolated from a human placental genomic library in EMBL3 (17, 18, 19) . Three genomic clones were mapped with EcoRI and SalI and hybridized with a cDNA probe, and several fragments were subcloned into pUC 18 and sequenced. All plasmid DNAs were sequenced from both ends using an automated sequencer 373 (Applied Biosystems).

Primer Extension.
The synthetic primer, 5'-GCGGCTCAGTAGAGCTCCTCC-3', was labeled at its 5'-end and hybridized to poly(A)+ RNA in 80% formamide, 0.4 M NaCl, 40 mM 1,4-piperazinediethanesulfonic acid (pH 6.4), and 1 mM EDTA for 4 h at 50°C. After precipitation of the nucleic acids, the pellet was dissolved in reverse transcriptase buffer (Life Technologies, Inc.), and primer extension was performed using 20 units of mouse mammary tumor virus reverse transcriptase (Life Technologies, Inc.) and 1 mM of each of the four deoxynucleotides. After 1 h at 37°C, the reaction was terminated with 20 mM EDTA, and the RNA was hydrolyzed with 0.125 M NaOH for 1 h at 65°C. The reaction was neutralized, and the DNA was collected. Sequencing reactions using the same primer were analyzed on a 7 M urea-6% polyacrylamide gel to determine the size of the extended product (17 , 18) .

Construction of Luciferase Reporter Plasmids.
Basic vector 2 (pGV-B2) and pCH110 (pSV-{beta}-Gal) were purchased from Nippon Gene (Tokyo, Japan) and Amersham Pharmacia Biotech, respectively. Deletions of the 5' region of the Gal NAc-T3 gene, i.e., the fragments from the PstI (-812), XbaI (-348), BcgI (-202), StyI (-141), Bss HII (-88), and Eco O1091I (-69) sites to the XmaIII (+153) site, were obtained from a plasmid subclone, isolated, and filled in with the Klenow fragment of DNA polymerase I or blunt-ended with T4 DNA polymerase. After attachment of HindIII linkers, the fragments were ligated into the HindIII site of basic vector 2 and used to transform bacteria (17 , 18 , 20) . The resulting constructs were designated pT3-Luc 1, pT3-Luc 2, pT3-Luc 3, pT3-Luc 4, pT3-Luc 5, and pT3-Luc 6, respectively.

Transfection and Luciferase Assays.
KB or MCF 7 cells (1 x 105) were transferred to 35-mm dishes, incubated at 37°C for 48 h, and transfected with 1.0 µg of luciferase plasmid DNA using Superfect (Qiagen) as described (17) . Three h after transfection, the cells were washed, incubated at 37°C for 48 h in fresh medium, and harvested. The cells were lysed and centrifuged according to the manufacturer’s instructions (Toyoinki, Tokyo, Japan). Luciferase activity in the supernatants was assayed with a Picagene kit (Toyoinki; Ref. 20 ); light intensity was measured for 15 s with a luminometer (Dynatech Laboratories ML1500; Virginia). All cells were cotransfected with pSV-{beta}-Gal to control for transfection efficiency, and {beta}-galactosidase activity was measured according to the manufacturer’s instructions (Promega).

EMSA.
Nuclear extract preparation and EMSA were as described (20) . Briefly, 6 µg of each nuclear extract were incubated for 15 min at room temperature in a total volume of 20 µl containing 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 8% glycerol, 1 mM DTT, 0.1 µg of poly(deoxyinosinic-deoxycytidylic acid), and 1x 104 cpm of 32P-labeled oligonucleotide probe (Fig. 9Citation , top), in the absence or presence of competitor. The reaction mixtures were applied to a nondenaturing 4% polyacrylamide gel and electrophoresed at 7 W for 1.5 h in a buffer containing 44.5 mM Tris borate, 1 mM EDTA. The gel was exposed to X-ray film with intensifying screens.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Binding of an NRF 1 binding element to the Gal NAc-T3 promoter. EMSAs of a 32P-labeled oligonucleotide probe containing an NRF-1 binding element (top) were performed with nuclear extracts of KB and MCF-7 cells in the absence (-) and presence (+) of a 100-fold excess of unlabeled oligonucleotide. The NRF-1 binding site consensus sequence is underlined. Arrowhead, specific shifted band. Arrowhead with "F", free probe.

 
In Vivo Footprinting, Potassium Permanganate Treatment, and LM-PCR.
DNA extracted from cells treated with DMS in vivo (21 , 22) was cleaved with 1 M piperidine at 90°C for 30 min. As a control, naked genomic DNA from KB cells was treated with DMS in vitro and cleaved with piperidine as described above.

Potassium permanganate (KMnO4) modification of whole cells was performed as described (23) . Naked genomic DNA was treated in vitro with 200 µl of 10 mM KMnO4 for 1 or 3 min (24) , and the reaction was stopped by the addition of 25 µl of {beta}-mercaptoethanol.

LM-PCR was performed as described (25 , 26) . The nucleotide sequences of the Gal NAc-T3 upper strand primers were: 5'-CCGAGGCTCGGCTTCC-3' (nucleotides -1 to -16; primer 1); CTTGGAGTCTCCCAGGTGAGCTCC (nucleotides -18 to -41; primer 2); and GAGTCTCCCAGGTGAGCTCCAGCCTGCG (nucleotides -22 to -49; primer 3), whereas the Gal NAc-T3 lower strand primers were: 5'-CGACCACTCAGAGAGAAGCC-3' (nucleotides -213 to -194; primer 1'); CCGCGCGACAGCCAGGC (nucleotides -195 to -179; primer 2'); and CGCGACAGCCAGGCTTGGCCCGG (nucleotides -192 to -170; primer 3'). Primers 1 and 1' were used for first-strand synthesis, whereas primers 2 and 2' were used for PCR amplification. Primers 3 and 3' were labeled at their 5' ends with[{gamma}-32P]ATP and used for detection of the ladder. Samples were analyzed on a 6% polyacrylamide sequencing gel.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning of Gal NAc-T3 cDNA and Its Expression in Adenocarcinomas.
Six members of the Gal NAc transferase family have been identified to date (1, 2, 3, 4, 5, 6, 7, 8) . One of these, Gal NAc-T3, has been found to be regulated in a highly tissue-specific manner, and its level of expression was observed to correlate well with the differentiation grade of adenocarcinoma. To determine the basis of this regulation, we cloned Gal NAc-T3 cDNA from a human colon cDNA library. One of these clones, pT3–7, contained a 1273-bp insert, which consisted of 319 bp of the 5' untranslated region plus 942 bp of coding sequence, suggesting that this clone contains the 5' end of Gal NAc-T3 mRNA (Fig. 1)Citation .

Using our cloned cDNA fragment as a probe, we assayed the expression of Gal NAc-T3 mRNA in various human cancer cell lines by Northern blotting. We found that our labeled probe hybridized to a 3.6-kb RNA band in all cell lines derived from mammary gland adenocarcinomas but not in cell lines derived from bladder and epidermoid carcinomas (Fig. 2)Citation . Similarly, cell lines from prostate and colon adenocarcinomas expressed Gal NAc-T3 message, whereas cell lines from melanomas and osteosarcomas did not (data not shown).



View larger version (73K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Expression of Gal NAc-T3 mRNA in human cancer cell lines. RNAs from human cancer cell lines were separated on a formaldehyde-agarose gel, transferred to Hybond N+, and hybridized with a labeled Gal NAc-T3 probe. Lane 1, KB (epidermoid carcinoma); Lane 2, T24 (bladder carcinoma); Lane 3, MCF-7 (mammary carcinoma); Lane 4, BSY-1 (mammary carcinoma); Lane 5, HBC-4 L (mammary carcinoma).

 
Sequence Analysis of the Gal NAc-T3 Promoter Region and Determination of Transcription Initiation Sites.
To elucidate the molecular mechanism underlying adenocarcinoma-specific expression of the Gal NAc-T3 gene, we isolated three overlapping genomic clones, denoted EMBL-T3G1, EMBL-T3G2, and EMBL-T3G3 (Fig. 3)Citation , and we confirmed that these clones encoded Gal NAc-T3 by sequence analysis. After determination of the nucleotide sequence of the first exon and its 5' flanking region (Fig. 4)Citation , we performed primer extension analysis to precisely define the start site for transcription. We observed microheterogeneity of the transcription start site. The principal start sites for transcription were located at nucleotides +1 to +4 (Fig. 5)Citation . Although we also isolated a cDNA clone extending 12 bp upstream from the major initiation site (+1), we were unable to detect such products in primer extension experiments, suggesting that transcription of a minor population of Gal NAc-T3 mRNA could be initiated from nucleotide -12 or a more upstream position. Although we observed no obvious TATA and CCAAT boxes, we found several binding sites for known transcription factors, including two GC boxes, one NRF-1 site, and an AP-2 site (Fig. 4)Citation .



View larger version (11K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Restriction endonuclease map of three overlapping genomic clones of the human Gal NAc-T3 gene. Restriction enzyme cleavage sites are: E, EcoRI; S, SalI; X, XbaI; B, BamHI; and P, PstI. The closed box indicates the first exon.

 


View larger version (84K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. DNA sequence of the promoter, the first exon, and part of the first intron of the Gal NAc-T3 gene. Nucleotides are numbered on the left, with the transcription start site designated +1. The GC boxes (5'-GGGCGG-3'), NRF-1 site (5'-CGCGCAGGCGCG-3'), and AP-2 site (5'-CCCCTGCCG-3') are boxed, and the first exon is underlined. The position of the primer used in primer extension analysis is indicated by an arrowheaded line. The sequence participating in a stem and loop structure is underlined by a broken line.

 


View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Primer extension analysis of the Gal NAc-T3 gene. The same first exon primer, 5'-GCGGCTCAGTAGAGCTCCTCC-3', was used for both hybridization and sequencing.

 
Immunochemical Determination of Gal NAc-T3 Expression in Cell Lines and Tumors.
After immunization of a rabbit with a synthetic peptide, we obtained a polyclonal antibody to Gal NAc-T3 that recognized a Mr 68,000 protein, a size comparable with that reported previously (1) . Immunoblotting assays showed that this Mr 68,000 band was present in adenocarcinoma cell lines, such as MCF-7, BSY 1, and HBC-4 L (mammary carcinoma) but not in nonadenocarcinoma cell lines, such as KB (epidermoid carcinoma) and T24 (bladder carcinoma; Fig. 6A)Citation . To determine whether this antibody could be used diagnostically, we assayed Gal NAc-T3 expression in primary tumor specimens from patients with breast cancer. Gal NAc immunoreactivity was detected in carcinoma cells, primarily mainly in the cytoplasm, but not in normal epithelial cells (Fig. 6B)Citation .



View larger version (91K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. A, expression of Gal NAc-T3 in carcinoma cell lines. Cytoplasmic fractions were subjected to 10% SDS-PAGE and immunoblotted with a polyclonal antibody to Gal NAc-T3. Arrowhead, the Mr 68,000 Gal NAc-T3 protein. Lane 1, KB cells; Lane 2, T24 cells; Lane 3, MCF-7 cells; Lane 4, BSY-1 cells; Lane 5, HBC-4 L cells. Left, prestained molecular size markers. B, immunohistochemical analysis of Gal NAc-T3 expression in human breast tumors. Left panel, stained with anti-Gal NAc-T3 antibody; right panel, negative staining. Arrow, a normal duct. x400.

 
In Vivo Footprint Analysis of the Gal NAc-T3 Gene Promoter.
When we compared the results of DMS modification of the Gal NAc-T3 gene promoter in MCF-7, BSY-1, and HBC-4LB cells, in which the gene is expressed, with those in KB and T24 cells, in which Gal NAc-T3 is not expressed, we detected several differences (Fig. 7)Citation . In cells expressing Gal NAc-T3 transcripts, upper strand guanines in both the distal GC box and the NRF-1-like site were well protected from DMS modification (Fig. 7A)Citation , as were lower strand guanines in the NRF-1 and AP-2 sites (Fig. 7B)Citation . In contrast, a guanine residue in the lower, C-rich strand in a GC box was not protected, possibly because Sp1 or its related factors can bind only to the G-rich strand in a GC box (25 , 27) . Interestingly, both a hypersensitive site in the immediate vicinity of the AP-2 site, as well as a super-hypersensitive site in the untranslated region (around nucleotide +50), were observed in cells expressing the Gal NAc-T3 gene.



View larger version (91K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. In vivo footprint analysis of the Gal NAc-T3 gene promoter. A, top strand; B, bottom strand. Bases are numbered relative to the promoter sequence. The rectangles next to the gels indicate the positions of the GC boxes and NRF-1 and AP-2 sites. Open arrowhead, residues showing super-hypersensitive sites.

 
Characterization of Gal NAc-T3 Promoter Activity.
On the basis of the results of our in vivo footprint analysis, we made a series of deletion constructs (Fig. 8)Citation , which we transiently transfected into the human cancer cell lines, MCF-7 and KB. MCF-7 cells, which were derived from a mammary adenocarcinoma, express much more Gal NAc-T3 than do KB cells, which were derived from an epidermoid carcinoma. Gal NAc-T3 promoter activity was also significantly higher in MCF-7 cells than in KB cells. The pT3-Luc 3 deletion construct, which retained two GC boxes, the NRF-1 site, the AP-2 site, and the upstream sequence from nucleotide -202 to nucleotide -108, was as active as the larger constructs, pT3-Luc 1 and pT3-Luc 2. In contrast, pT3-Luc 4, in which the sequence between nucleotide -202 and nucleotide -141 is deleted, showed reduced luciferase activity. Similar reduction of luciferase activity was observed with pT3-Luc 5, in which both GC boxes were deleted. A more extended deletion construct (pT3-Luc 6), in which all sites except for the proximal AP-2 site were removed, promoted only 10% of the luciferase activity.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Structure and deletion analysis of the Gal NAc-T3 promoter. Relevant restriction enzyme cleavage sites are: P, PstI; X, XbaI; Bc, BcgI; St, StyI; Bs, Bss HII; E, Eco O1091I; Xm, XmaIII. Bold line, the first exon of the Gal NAc-T3 gene. Constructs in which parts of the 5'-region of the Gal NAc-T3 gene were deleted were transiently transfected into KB and MCF-7 cells. A {beta}-galactosidase reporter gene construct was cotransfected as an internal control, and luciferase activity was normalized to {beta}-galactosidase activity. Each column represents the average of at least three independent experiments, each performed in duplicate. All results are normalized to that of Control vector 2 (C2: SV40 promoter and enhancer) and are expressed as a percentage. B2: basic vector. Bars, SD.

 
The DNA sequence analysis revealed the presence of several inverted repeats in the upstream region (nucleotide -165 to nucleotide -103), suggesting that GC-rich stem structures and concomitant loops can be formed. Because this stem and loop structure was almost completely destroyed in the deletion construct, pT3-Luc 4, our findings suggest that this structure, together with the GC boxes, NRF-1 and AP-2 sites, may be responsible for adenocarcinoma-specific expression in a synergistic manner.

Nuclear Factor Binding to the NRF-1 Site in the Gal NAc-T3 Promoter.
To determine whether NRF-1 or related transcription factor(s) are expressed in adenocarcinoma cells, we performed EMSAs with a double-stranded oligonucleotide that included an NRF-1 binding element (Fig. 9)Citation . Retardation of the signal was significantly greater in MCF-7 cells than in KB cells (Fig. 9)Citation . Because we could not obtain an antibody against NRF-1, we could not determine whether the binding factor was NRF-1 or related factor(s).

Biological Significance of the Putative Stem and Loop Structure.
To obtain supporting evidence for the stem and loop structure, we incubated the cells with potassium permanganate (KMnO4), which reacts with unpaired bases, especially to thymine and, to a lesser extent, cytosine (28) . The modified bases were subsequently cleaved with piperidine and assayed by LM-PCR.

We found that in vitro treatment of naked genomic DNA, which possesses a double-stranded structure throughout the genome, with KMnO4 yielded evidence of cleavage only at the thymine at nucleotide -65 and the cytosine at nucleotide -66 (Fig. 10)Citation . In contrast, treatment of KB and MCF-7 cells with KMnO4 in vivo resulted in discontinuous ladders. For example, the thymines at nucleotides -72, -91, -109, -128, and -154 in the upper strand did not react with KMnO4, whereas cleavage signals corresponding to the thymines at nucleotides -115, -133, -135, -136, and -143 were detected. These reactive thymines, as well as several concomitant bases, such as the guanine at nucleotide -116, the adenine at nucleotide -144, and the cytosines at nucleotides -159 and -161 to -163 are located in the loop region or at the boundary between the loop and the stem, as illustrated by computer analysis (Fig. 10B)Citation . Moreover, the relative intensity of these cleavage signals was significantly higher in MCF-7 than in KB cells, suggesting that this putative stem and loop structure would be of functional importance in MCF-7 cells.



View larger version (41K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 10. Assay of unpaired bases in the Gal NAc-T3 promoter and model of a stem and loop structure. A, KB and MCF-7 cells were treated in vivo with KMnO4 for 0.5 or 1 min, and KB genomic DNA was treated in vitro with KMnO4 for 1 or 3 min. Also, KB genomic DNA was treated with DMS in vitro and used as a guanine ladder (G Ladder). The samples were cleaved with piperidine, and then LM-PCR was performed. B, computer model of the stem and loop structure in the Gal NAc-T3 promoter. Nucleotides in circles and squares denote residues reactive and hyperreactive to KMnO4, respectively, all of which are located in a loop region or at a boundary between a stem and loop. The positions of thymines inert to KMnO4 are shown by nucleotide numbers with parentheses. A cluster of reactive cytosines (nucleotides -161 to -163) would result from the binding of an Sp1 family factor to the G-rich strand (nucleotides -107 to -102) of the distal GC box.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We report here the cloning of the complete 5' upstream region of the Gal NAc-T3 gene. Using a cDNA clone that has 270 nucleotides of 5' untranslated region, we isolated three overlapping genomic clones encompassing 9 kb of the 5' part of the Gal NAc-T3 gene and 14 kb of its 5' flanking regions. When we sequenced the 5'-end of the gene and determined the transcription start site, we observed no evidence for typical TATA and CCAAT boxes in the region preceding the first exon, a finding that may account for the microheterogeneity of transcription initiation sites. In contrast, multiple binding sites for transcription factors, including members of the AP-2, NRF-1, and Sp1 families, were readily detected in the 5' upstream region.

Functional analysis of the promoter region upstream of the first exon in a transient expression system demonstrated considerable promoter activity in MCF-7 but not in KB cells, suggesting that a transcription factor specific to glandular epithelium may be present in MCF-7 cells. Surprisingly, we also found a significant decrease in the promoter activity of a plasmid construct (pT3-Luc 4) that retains two GC boxes, an NRF-1 site and an AP-2 site. This construct, however, cannot form the stem and loop structure necessary for promoter activity, a finding confirmed with the pT3-Luc 5 construct, which lacks both the stem and loop structure and the two GC boxes, and with the pT3-Luc 6 construct, which retains only the AP-2 site. These results suggest that there are four elements that associate to regulate Gal NAc-T3 transcription in adenocarcinomas: the stem and loop structure, the GC boxes, and the NRF-1 and AP-2 sites. The finding that promoter activity in MCF-7 cells is almost 10-fold higher than in KB cells, even when the region between nucleotide -88 and nucleotide -69 was deleted (pT3-Luc 6), suggests that the untranslated region between nucleotide -69 and nucleotide +157 may also play a role in tissue-specific activity.

Although footprint analysis of the Gal NAc-T3 gene promoter showed that there are at least three protected areas in each of three breast cancer cell lines, these areas were absent from KB and T24 cells. Both Sp1 and AP-2 are ubiquitous factors that bind to the promoters of various genes. In contrast, NRF-1 was originally identified as a factor that regulates a number of respiratory genes (29 , 30) . In addition, the gene encoding rat tyrosine aminotransferase and human initiation factor-2{alpha} were found to be functional targets of NRF-1 (31 , 32) . Although NRF-1 mRNA is expressed at very low levels in many tissues (33) , we observed considerable binding activity for the NRF-1 responsive element of the Gal NAc-T3 promoter in MCF-7 cells, suggesting that a novel NRF-1-related factor expressed in glandular epithelium may be primarily involved in the regulation of the Gal NAc-T3 gene.

The stem and loop structure we have identified in the in 5'-upstream region of the Gal NAc-T3 gene seems to be functional in vivo, as shown by our results with KMnO4-treated cells. Similar palindromic structure will be reported in the promoter of the gene encoding the p180 subunit of DNA polymerase {alpha}.4 Although the functional significance of the stem and loop structure in the Gal NAc-T3 promoter region is not precisely known, the presence of this structure close to transcription factor binding sites may enhance the number of "entry sites" for an initiation complex that includes RNA polymerase II.

Our finding of a DMS-hypersensitive site in the 5' untranslated region around nucleotide +50 of the Gal NAc-T3 gene in mammary carcinoma cell lines is especially noteworthy. Although the nucleotide -150 to +193 region of this gene is GC rich (~74%) and there is a G-rich stretch around nucleotide +50, we did not observe any differences in CpG methylation of this region between KB and MCF-7 cells (data not shown). KMnO4-hypersensitive sites have been detected in the 5' untranslated regions of several eukaryotic genes, including those encoding c-Myc, heat shock protein, and {beta}-1 tubulin (23 , 24 , 28) , when the transcriptional bubble is induced by the paused RNA polymerase complex. Our recent KMnO4 treatment and micrococcal nuclease digestion experiments suggest that this paused RNA polymerase complex forms between nucleotide +1 and nucleotide +50 (data not shown). Thus, in addition to the tissue-specific expression of Gal NAc-T3 that we have observed, pausing of the RNA polymerase complex may modulate expression of this gene.

The specificity of our Gal NAc-T3 antibody was shown by its ability to bind a Mr 68,000 protein in the cytoplasmic fraction of adenocarcinoma cell lines but not in nonadenocarcinoma cell lines. Although immunohistochemistry allows only an approximate estimation of tissue-specific expression and relative levels of protein, results obtained with the breast carcinoma samples showed that Gal NAc-T3 is expressed in tumor cells but not in normal mammary epithelium. In normal colorectal epithelium, however, Gal NAc-T3 is expressed to a significant degree (data not shown). Gal NAc-T3 expression can be correlated with the degree of differentiation in adenocarcinoma (6) , suggesting that Gal NAc-T3 is expressed in active glandular tissue but not in silent glandular tissue. Although Gal NAc-T3 may be expressed in normal mammary glands during pregnancy, our findings suggest that expression of this gene may be a new tumor marker for evaluating the progression of breast cancer.

The Gal NAc gene promoter provides an excellent model system for the study of tissue-specific expression. The four structural elements present in the 5'-upstream region, the stem and loop structure, the GC boxes, and the NRF-1 and AP-2 sites, together constitute one aspect of the Gal NAc-T3 gene expression, and the pausing of the RNA polymerase complex in the untranslated region of this gene functions as the second aspect of the regulation system. Thus, Gal NAc-T3 gene expression is regulated by multiple modulatory systems, which are highly restricted in adenocarcinoma cell lines derived from epithelial glands but not in carcinomas derived from nonsecretory epithelial tissue. The identification of a set of regulatory factors that act through these regions will enable us to more precisely understand the molecular mechanisms that govern Gal NAc-T3 gene regulation in glandular epithelium.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work was supported in part by a grant-in-aid for Cancer Research from the Ministry of Education, Science, Sports and Culture of Japan and by the Fukuoka Anticancer Research Fund. Back

2 To whom requests for reprints should be addressed, at Department of Molecular Biology, Faculty of Medicine, University of Occupational and Environmental Health, Japan, School of Medicine, Yahata nishi-ku, Kitakyushu 807-8555, Japan. Phone: 81-93-691-7423; Fax: 81-93-692-2766; E-mail: k-kohno{at}med.uoeh-u.ac.jp Back

3 The abbreviations used are: Gal NAc-T3, UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyl transferase-3; NRF-1, nuclear respiratory factor 1; RT-PCR, reverse transcription PCR; EMSA, electrophoretic mobility shift assay; LM-PCR, ligation-mediated PCR; DMS, dimethyl sulfate. Back

4 H. Miyazawa, personal communication. Back

Received 6/25/99. Accepted 10/18/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wandall H. H., Hassan H., Mirgorodskaya E., Kristensen A. K., Roepstorff P., Bennett E. P., Nielsen P. A., Hollingsworth M. A., Burchell J., Taylor-Papadimitriou J., Clausen H. Substrate specificities of three members of the human UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase family, GalNAc-T1, -T2, and -T3.. J. Biol. Chem., 272: 23503-23514, 1997.[Abstract/Free Full Text]
  2. Homa F. L., Hollander T., Lehman D. J., Thomsen D. R., Elhammer A. P. Isolation and expression of a cDNA clone encoding a bovine UDP-GalNAc: polypeptide N-acetylgalactosaminyltransferase. J. Biol. Chem., 268: 12609-12616, 1993.[Abstract/Free Full Text]
  3. Hagen F. K., Van Wuyckhuyse B., Tabak L. A. Purification, cloning, and expression of a bovine UDP-GalNAc: polypeptide N-acetyl-galactosaminyltransferase. J. Biol. Chem., 268: 18960-18965, 1993.[Abstract/Free Full Text]
  4. White T., Bennett E. P., Takio K., Sorensen T., Bonding N., Clausen H. Purification and cDNA cloning of a human UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyl-transferase. J. Biol. Chem., 270: 24156-24165, 1995.[Abstract/Free Full Text]
  5. Bennett E. P., Hassan H., Clausen H. cDNA cloning and expression of a novel human UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase, GalNAc-T3. J. Biol. Chem., 271: 17006-17012, 1996.[Abstract/Free Full Text]
  6. Bennett E. P., Hassan H., Mandel U., Mirgorodskaya E., Roepstorff P., Burchell J., Taylor-Papadimitriou J., Hollingsworth M. A., Merkx G., van Kessel A. G., Eiberg H., Steffensen R., Clausen H. Cloning of a human UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase that complements other GalNAc-transferases in complete O-glycosylation of the MUC1 tandem repeat. J. Biol. Chem., 273: 30472-30481, 1998.[Abstract/Free Full Text]
  7. Hagen K. G. T., Hagen F. K., Balys M. M., Beres T. M., Wuyckhuyse B. V., Tabak L. A. Cloning and expression of a novel, tissue specifically expressed member of the UDP-GalNAc: polypeptide N-acetylgalactosaminyltransferase family. J. Biol. Chem., 273: 27749-27754, 1998.[Abstract/Free Full Text]
  8. Bennett E. P., Hassan H., Mandel U., Hollingsworth M. A., Akisawa N., Ikematsu Y., Merkx G., van Kessel A. G., Olofsson S., Clausen H. Cloning and characterization of a close homologue of human UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-T3, designated GalNAc-T6. Evidence for genetic but not functional redundancy. J. Biol. Chem., 274: 25362-25370, 1999.[Abstract/Free Full Text]
  9. Sutherlin M. E., Nishimori I., Caffrey T., Bennett E. P., Hassan H., Mandel U., Mack D., Iwamura T., Clausen H., Hollingsworth M. A. Expression of three UDP-N-acetyl-{alpha}-D-galactosamine: polypeptide GalNAc N-acetylgalactosaminyltransferases in adenocarcinoma cell lines. Cancer Res., 57: 4744-4748, 1997.[Abstract/Free Full Text]
  10. Hennet T., Hagen F. K., Tabak L. A., Marth J. D. T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl-transferase gene by site-directed recombination. Proc. Natl. Acad. Sci. USA, 92: 12070-12074, 1995.[Abstract/Free Full Text]
  11. Kohno K., Kikuchi J., Sato S., Takano H., Saburi Y., Asoh K., Kuwano M. Vincristine-resistant human cancer KB cell line and increased expression of multidrug-resistant gene. Jpn. J. Cancer Res., 79: 1238-1246, 1988.[Medline]
  12. Mizoguchi H., Uchiumi T., Ono M., Kohno K., Kuwano M. Enhanced production of tissue-type plasminogen activator by estradiol in a novel type variant of human breast cancer MCF-7 cell line. Biochim. Biophys. Acta, 1052: 475-482, 1990.[Medline]
  13. Yokomizo A., Ono M., Nanri H., Makino Y., Ohga T., Wada M., Okamoto T., Yodoi J., Kuwano M., Kohno K. Cellular levels of thioredoxin associated with drug sensitivity to cisplatin, mitomycin C, doxorubicin and etoposide. Cancer Res., 55: 4293-4296, 1995.[Abstract/Free Full Text]
  14. Taniguchi K., Wada M., Kohno K., Nakamura T., Kawabe T., Kawakami M., Kagotani K., Okumura K., Akiyama S., Kuwano M. A human canalicular multispecific organic anion transporter (cMOAT) gene is overexpressed in cisplatin-resistant human cancer cell lines with decreased drug accumulation. Cancer Res., 56: 4124-4129, 1996.[Abstract/Free Full Text]
  15. Ohga T., Koike K., Ono M., Makino Y., Itagaki Y., Tanimoto M., Kuwano M., Kohno K. Role of the human Y box-binding protein YB-1 in cellular sensitivity to the DNA-damaging agents cisplatin, mitomycin C, and ultraviolet light. Cancer Res., 56: 4224-4228, 1996.[Abstract/Free Full Text]
  16. Ise T., Nagatani G., Imamura T., Kato K., Takano H., Nomoto M., Izumi H., Ohmori H., Okamoto T., Ohga T., Uchiumi T., Kuwano M., Kohno K. Transcription factor Y-box binding protein 1 binds preferentially to cisplatin-modified DNA and interacts with proliferating cell nuclear antigen. Cancer Res., 59: 342-346, 1999.[Abstract/Free Full Text]
  17. Kohno K., Sato S., Uchiumi T., Takano H., Kato S., Kuwano M. Tissue-specific enhancer of the human multidrug-resistance (MDR1) gene. J. Biol. Chem., 265: 19690-19696, 1990.[Abstract/Free Full Text]
  18. Makino Y., Ohga T., Toh S., Koike K., Okumura K., Wada M., Kuwano M., Kohno K. Structural and functional analysis of the human Y-box binding protein (YB-1) gene promoter. Nucleic Acids Res., 24: 1873-1878, 1996.[Abstract/Free Full Text]
  19. Toh S., Nakamura T., Ohga T., Koike K., Uchiumi T., Wada M., Kuwano M., Kohno K. Genomic organization of the human Y-box protein (YB-1) gene. Gene (Amst.), 206: 93-97, 1998.[Medline]
  20. Furukawa M., Uchiumi T., Nomoto M., Takano H., Morimoto R. I., Kuwano M., Kohno K. The role of an inverted CCAAT element in transcriptional activation of the human DNA topoisomerase II{alpha} gene by heat shock. J. Biol. Chem., 273: 10550-10555, 1998.[Abstract/Free Full Text]
  21. Mueller P. R., Wold B. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science (Washington DC), 246: 780-786, 1989.[Abstract/Free Full Text]
  22. Garrity P. A., Wold B. J. Effects of different DNA polymerases in ligation-mediated PCR: enhanced genomic sequencing and in vivo footprinting. Proc. Natl. Acad. Sci. USA, 89: 1021-1025, 1992.[Abstract/Free Full Text]
  23. Duncan R., Bazar L., Michelotti G., Tomonaga T., Krutzsch H., Avigan M., Levens D. A sequence-specific, single-strand binding protein activates the far upstream element of c-myc and defines a new DNA-binding motif. Genes Dev., 8: 465-480, 1994.[Abstract/Free Full Text]
  24. Krumm A., Meulia T., Brunvand M., Groudine M. The block to transcriptional elongation within the human c-myc gene is determined in the promoter-proximal region. Genes Dev., 6: 2201-2213, 1992.[Abstract/Free Full Text]
  25. Nomoto M., Gonzalez F. J., Mita T., Inoue N., Kawamura M. Analysis of cis-acting regions upstream of the rat Na+/K+-ATPase {alpha}1 subunit gene by in vivo footprinting. Biochim. Biophys. Acta, 1264: 35-39, 1995.[Medline]
  26. Konishi T., Nomoto M., Shimizu K., Abe T., Itoh H., Friedrich H., Guenther E., Higashi K. Dominant role of the second heat shock element in expression of the HSP70–1 gene in rat liver after whole body hyperthermia. J. Biochem., 118: 1021-1029, 1995.[Abstract/Free Full Text]
  27. Gidoni D., Dynan W. S., Tjian R. Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature (Lond.), 312: 409-413, 1984.[Medline]
  28. Giardina C., Perez-Riba M., Lis J. T. Promoter melting and TFIID complexes on Drosophila genes in vivo. Genes Dev., 6: 2190-2200, 1992.[Abstract/Free Full Text]
  29. Evans M. J., Scarpulla R. C. NRF-1: a trans-activator of nuclear-encoded respiratory genes in animal cells. Genes Dev., 4: 1023-1034, 1990.[Abstract/Free Full Text]
  30. Virbasius C. A., Virbasius J. V., Scarpulla R. C. NRF-1, an activator involved in nuclear-mitochondrial interactions, utilizes a new DNA-binding domain conserved in a family of developmental regulators. Genes Dev., 7: 2431-2445, 1993.[Abstract/Free Full Text]
  31. Gopalakrishnan L., Scarpulla R. C. Structure, expression, and chromosomal assignment of the human gene encoding nuclear respiratory factor 1. J. Biol. Chem., 270: 18019-18025, 1995.[Abstract/Free Full Text]
  32. Becker P. B., Ruppert S., Schutz G. Genomic footprinting reveals cell type-specific DNA binding of ubiquitous factors. Cell, 51: 435-443, 1987.[Medline]
  33. Efiok B. J. S., Chiorini J. A., Safer B. A key transcription factor for eukaryotic initiation factor-2{alpha} is strongly homologous to developmental transcription factors and may link metabolic genes to cellular growth and development. J. Biol. Chem., 269: 18921-18930, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Chem.Home page
N. Berois, E. Blanc, H. Ripoche, X. Mergui, F. Trajtenberg, S. Cantais, M. Barrois, P. Dessen, B. Kagedal, J. Benard, et al.
ppGalNAc-T13: A New Molecular Marker of Bone Marrow Involvement in Neuroblastoma
Clin. Chem., September 1, 2006; 52(9): 1701 - 1712.
[Abstract] [Full Text] [PDF]


Home page
J. Histochem. Cytochem.Home page
N. Berois, D. Mazal, L. Ubillos, F. Trajtenberg, A. Nicolas, X. Sastre-Garau, H. Magdelenat, and E. Osinaga
UDP-N-Acetyl-D-Galactosamine: Polypeptide N-Acetylgalactosaminyltransferase-6 as a New Immunohistochemical Breast Cancer Marker
J. Histochem. Cytochem., March 1, 2006; 54(3): 317 - 328.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Miyahara, J. Shoda, T. Kawamoto, M. Furukawa, T. Ueda, T. Todoroki, N. Tanaka, K. Matsuo, Y. Yamada, K. Kohno, et al.
Expression of UDP-N-Acetyl-{alpha}-D-Galactosamine-Polypeptide N-Acetylgalactosaminyltransferase Isozyme 3 in the Subserosal Layer Correlates with Postsurgical Survival of Pathological Tumor Stage 2 Carcinoma of the Gallbladder
Clin. Cancer Res., March 15, 2004; 10(6): 2090 - 2099.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
W. W. Young Jr., D. R. Holcomb, K. G. Ten Hagen, and L. A. Tabak
Expression of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase isoforms in murine tissues determined by real-time PCR: a new view of a large family
Glycobiology, July 1, 2003; 13(7): 549 - 557.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
K. G. Ten Hagen, T. A. Fritz, and L. A. Tabak
All in the family: the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases
Glycobiology, January 1, 2003; 13(1): 1R - 16R.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Izumi, T. Imamura, G. Nagatani, T. Ise, T. Murakami, H. Uramoto, T. Torigoe, H. Ishiguchi, Y. Yoshida, M. Nomoto, et al.
Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3'{->}5' exonuclease activity
Nucleic Acids Res., March 1, 2001; 29(5): 1200 - 1207.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Nomoto, M.
Right arrow Articles by Kohno, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Nomoto, M.
Right arrow Articles by Kohno, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online