| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
-D-galactosamine: Polypeptide N-Acetylgalactosaminyl Transferase-3 Gene Expression in Adenocarcinoma Cells1
Departments of Molecular Biology [M. N., H. Iz., T. Is., K. Ka., H. T., G. N., T. Im., K. Ko.] and Surgery I [K. S., R. O., H. It.], University of Occupational and Environmental Health, Japan, School of Medicine, Kitakyushu 807-8555; Department of Biochemistry, Kyushu University, School of Medicine, Maidashi, Higashi-ku, Fukuoka 812-8582 [M. K.]; and Hanno Research Center, Taiho Pharmaceutical Co., Ltd., Saitama 357-0041 [K. M., Y. Y.], Japan
| ABSTRACT |
|---|
|
|
|---|
-D-galactosamine: polypeptide N-acetylgalactosaminyl transferase-3 (Gal NAc-T3) gene, a member of the Gal NAc transferase gene family, is expressed in a tissue-specific manner. To elucidate the function of this gene, we have focused on the molecular mechanism underlying regulation of gene expression. We have cloned Gal NAc-T3 cDNA and used it to show that Gal NAc-T3 mRNA is expressed in tumor cell lines derived from secretory epithelial tissue adenocarcinomas but not in cell lines derived from bladder and epidermoid carcinomas. Using a polyclonal antibody to Gal NAc-T3, we observed protein expression in adenocarcinoma but not non-adenocarcinoma cell lines, and in breast carcinoma cells but not in normal breast tissue. We used Gal NAc-T3 cDNA to isolate three overlapping genomic clones containing the 5'-portion of the human Gal NAc-T3 gene, and we sequenced 1.6 kb around the first exon. A transient expression assay using the luciferase gene showed that promoter activity was much higher in MCF-7 cells than in KB cells. In vivo footprint experiments showed significant protection of a distal GC box, an NRF-1 site, and an AP-2 site in MCF-7 cells. A novel stem and loop structure extending from nucleotide -103 to nucleotide -165 and contiguous to these transcription factor binding sites seemed to be functional in regulating Gal NAc-T3 gene transcription, and a KMnO4 footprint experiment showed that this stem and loop structure could be formed in vivo. We also observed dimethyl sulfate hypersensitive sites in the untranslated region around nucleotide +50 in MCF-7 but not in KB cells. These findings indicate that Gal NAc-T3 gene expression is regulated by multiple systems, including transcription factor binding sites and a stem-and-loop structure, and that this regulation is restricted to cell lines derived from epithelial gland adenocarcinomas but not cells derived from nonsecretory epithelial tissue carcinomas. In addition, our immunohistochemical results suggest that our anti-Gal NAc-T3 antibody may be useful for diagnostic purposes in the early stages of breast cancer. | INTRODUCTION |
|---|
|
|
|---|
Although the three Gal NAc-transferases have been extensively investigated, it is not known whether they are isoenzymes with redundant or unique functions, and their principal substrates have not been identified. In fact, no obvious phenotypic abnormalities were detected in mice in which a close homologue of the Gal NAc-T1 gene had been knocked out (10) . To elucidate the function of the Gal NAc genes, we have focused our attention on the molecular mechanism underlying the epithelial gland-specific expression of the Gal NAc-T3 gene. We therefore cloned Gal NAc-T3 cDNA and showed that mRNA encoded by this gene is highly expressed in human tumor cell lines arising from epithelial glands, such as breast, colon, and prostate cancers, but not in tumor cell lines derived from nonsecretory epithelial tissues, such as epidermoid and bladder carcinomas. We further investigated the mechanism involved in tissue-specific expression of the Gal NAc-T3 gene by isolating genomic clones containing the promoter region of this gene and using these clones to assay the binding of transcription factors to regulatory elements in the promoter.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P]dCTP and [
-32P]ATP were from Amersham Pharmacia Biotech.
Cell Culture.
Human cancer cell lines were cultured in their appropriate medium (11, 12, 13, 14)
.
Northern Blot Analysis.
Northern blot analysis was carried out as described (15)
.
Preparation of Rabbit Antiserum to Human Gal NAc-T3 and Western Blotting.
Antiserum to Gal NAc-T3 was generated by multiple immunization of a New Zealand White rabbit with the synthetic peptide KGYYTAAELKPVLDRPPQDS (K plus Residues 100118; Fig. 1
), as described (15
, 16) .
|
Immunohistochemistry.
Mammary epithelium resected from a patient with mammary cancer was fixed in formalin and embedded in paraffin. Two-µm-thick sections were stained with anti-human Gal NAc-T3 antibody, and immunohistochemistry was performed using a streptavidin-biotin-peroxidase complex method. Briefly, endogenous peroxidase activity was blocked by preincubating the slides in 3% H2O2 in absolute methanol for 5 min. Each slide was preincubated in rabbit serum for 10 min and then incubated with the primary antibody for 60 min, washed thoroughly, incubated in antirabbit immunoglobulin for 30 min, washed, and incubated with streptavidin-biotinylated horseradish peroxidase complex for 20 min. Diaminobenzidine was used as a chromogen, and the sections were lightly counterstained with hematoxylin. Substitution of PBS for the primary antibody was used as the negative control.
Cloning and Sequencing of a Human Gal NAc-T3 cDNA.
Human Gal NAc-T3 cDNA was prepared from MCF-7 poly(A)+ RNA by RT-PCR using the primers 5'-GGATTTAATGCTAGAAGCTGTAAAC-3' and 5'- AGGTTCTAGCCAACCATAGAAACAC-3' (Fig. 1)
. The RT-PCR product was used to screen a human colon cDNA library constructed in the expression vector,
gt 11 (Clontech).
Isolation of Genomic Clones and DNA Sequencing.
Using a 310-bp EcoRI-HindIII fragment from Gal NAc-T3 cDNA, genomic Gal NAc-T3 clones were isolated from a human placental genomic library in EMBL3 (17, 18, 19)
. Three genomic clones were mapped with EcoRI and SalI and hybridized with a cDNA probe, and several fragments were subcloned into pUC 18 and sequenced. All plasmid DNAs were sequenced from both ends using an automated sequencer 373 (Applied Biosystems).
Primer Extension.
The synthetic primer, 5'-GCGGCTCAGTAGAGCTCCTCC-3', was labeled at its 5'-end and hybridized to poly(A)+ RNA in 80% formamide, 0.4 M NaCl, 40 mM 1,4-piperazinediethanesulfonic acid (pH 6.4), and 1 mM EDTA for 4 h at 50°C. After precipitation of the nucleic acids, the pellet was dissolved in reverse transcriptase buffer (Life Technologies, Inc.), and primer extension was performed using 20 units of mouse mammary tumor virus reverse transcriptase (Life Technologies, Inc.) and 1 mM of each of the four deoxynucleotides. After 1 h at 37°C, the reaction was terminated with 20 mM EDTA, and the RNA was hydrolyzed with 0.125 M NaOH for 1 h at 65°C. The reaction was neutralized, and the DNA was collected. Sequencing reactions using the same primer were analyzed on a 7 M urea-6% polyacrylamide gel to determine the size of the extended product (17
, 18)
.
Construction of Luciferase Reporter Plasmids.
Basic vector 2 (pGV-B2) and pCH110 (pSV-
-Gal) were purchased from Nippon Gene (Tokyo, Japan) and Amersham Pharmacia Biotech, respectively. Deletions of the 5' region of the Gal NAc-T3 gene, i.e., the fragments from the PstI (-812), XbaI (-348), BcgI (-202), StyI (-141), Bss HII (-88), and Eco O1091I (-69) sites to the XmaIII (+153) site, were obtained from a plasmid subclone, isolated, and filled in with the Klenow fragment of DNA polymerase I or blunt-ended with T4 DNA polymerase. After attachment of HindIII linkers, the fragments were ligated into the HindIII site of basic vector 2 and used to transform bacteria (17
, 18 , 20)
. The resulting constructs were designated pT3-Luc 1, pT3-Luc 2, pT3-Luc 3, pT3-Luc 4, pT3-Luc 5, and pT3-Luc 6, respectively.
Transfection and Luciferase Assays.
KB or MCF 7 cells (1 x 105) were transferred to 35-mm dishes, incubated at 37°C for 48 h, and transfected with 1.0 µg of luciferase plasmid DNA using Superfect (Qiagen) as described (17)
. Three h after transfection, the cells were washed, incubated at 37°C for 48 h in fresh medium, and harvested. The cells were lysed and centrifuged according to the manufacturers instructions (Toyoinki, Tokyo, Japan). Luciferase activity in the supernatants was assayed with a Picagene kit (Toyoinki; Ref. 20
); light intensity was measured for 15 s with a luminometer (Dynatech Laboratories ML1500; Virginia). All cells were cotransfected with pSV-
-Gal to control for transfection efficiency, and
-galactosidase activity was measured according to the manufacturers instructions (Promega).
EMSA.
Nuclear extract preparation and EMSA were as described (20)
. Briefly, 6 µg of each nuclear extract were incubated for 15 min at room temperature in a total volume of 20 µl containing 10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 1 mM EDTA, 8% glycerol, 1 mM DTT, 0.1 µg of poly(deoxyinosinic-deoxycytidylic acid), and 1x 104 cpm of 32P-labeled oligonucleotide probe (Fig. 9
, top), in the absence or presence of competitor. The reaction mixtures were applied to a nondenaturing 4% polyacrylamide gel and electrophoresed at 7 W for 1.5 h in a buffer containing 44.5 mM Tris borate, 1 mM EDTA. The gel was exposed to X-ray film with intensifying screens.
|
Potassium permanganate (KMnO4) modification of whole cells was performed as described (23)
. Naked genomic DNA was treated in vitro with 200 µl of 10 mM KMnO4 for 1 or 3 min (24)
, and the reaction was stopped by the addition of 25 µl of
-mercaptoethanol.
LM-PCR was performed as described (25
, 26)
. The nucleotide sequences of the Gal NAc-T3 upper strand primers were: 5'-CCGAGGCTCGGCTTCC-3' (nucleotides -1 to -16; primer 1); CTTGGAGTCTCCCAGGTGAGCTCC (nucleotides -18 to -41; primer 2); and GAGTCTCCCAGGTGAGCTCCAGCCTGCG (nucleotides -22 to -49; primer 3), whereas the Gal NAc-T3 lower strand primers were: 5'-CGACCACTCAGAGAGAAGCC-3' (nucleotides -213 to -194; primer 1'); CCGCGCGACAGCCAGGC (nucleotides -195 to -179; primer 2'); and CGCGACAGCCAGGCTTGGCCCGG (nucleotides -192 to -170; primer 3'). Primers 1 and 1' were used for first-strand synthesis, whereas primers 2 and 2' were used for PCR amplification. Primers 3 and 3' were labeled at their 5' ends with[
-32P]ATP and used for detection of the ladder. Samples were analyzed on a 6% polyacrylamide sequencing gel.
| RESULTS |
|---|
|
|
|---|
Using our cloned cDNA fragment as a probe, we assayed the expression of Gal NAc-T3 mRNA in various human cancer cell lines by Northern blotting. We found that our labeled probe hybridized to a 3.6-kb RNA band in all cell lines derived from mammary gland adenocarcinomas but not in cell lines derived from bladder and epidermoid carcinomas (Fig. 2)
. Similarly, cell lines from prostate and colon adenocarcinomas expressed Gal NAc-T3 message, whereas cell lines from melanomas and osteosarcomas did not (data not shown).
|
|
|
|
|
|
|
Nuclear Factor Binding to the NRF-1 Site in the Gal NAc-T3 Promoter.
To determine whether NRF-1 or related transcription factor(s) are expressed in adenocarcinoma cells, we performed EMSAs with a double-stranded oligonucleotide that included an NRF-1 binding element (Fig. 9)
. Retardation of the signal was significantly greater in MCF-7 cells than in KB cells (Fig. 9)
. Because we could not obtain an antibody against NRF-1, we could not determine whether the binding factor was NRF-1 or related factor(s).
Biological Significance of the Putative Stem and Loop Structure.
To obtain supporting evidence for the stem and loop structure, we incubated the cells with potassium permanganate (KMnO4), which reacts with unpaired bases, especially to thymine and, to a lesser extent, cytosine (28)
. The modified bases were subsequently cleaved with piperidine and assayed by LM-PCR.
We found that in vitro treatment of naked genomic DNA, which possesses a double-stranded structure throughout the genome, with KMnO4 yielded evidence of cleavage only at the thymine at nucleotide -65 and the cytosine at nucleotide -66 (Fig. 10)
. In contrast, treatment of KB and MCF-7 cells with KMnO4 in vivo resulted in discontinuous ladders. For example, the thymines at nucleotides -72, -91, -109, -128, and -154 in the upper strand did not react with KMnO4, whereas cleavage signals corresponding to the thymines at nucleotides -115, -133, -135, -136, and -143 were detected. These reactive thymines, as well as several concomitant bases, such as the guanine at nucleotide -116, the adenine at nucleotide -144, and the cytosines at nucleotides -159 and -161 to -163 are located in the loop region or at the boundary between the loop and the stem, as illustrated by computer analysis (Fig. 10B)
. Moreover, the relative intensity of these cleavage signals was significantly higher in MCF-7 than in KB cells, suggesting that this putative stem and loop structure would be of functional importance in MCF-7 cells.
|
| DISCUSSION |
|---|
|
|
|---|
Functional analysis of the promoter region upstream of the first exon in a transient expression system demonstrated considerable promoter activity in MCF-7 but not in KB cells, suggesting that a transcription factor specific to glandular epithelium may be present in MCF-7 cells. Surprisingly, we also found a significant decrease in the promoter activity of a plasmid construct (pT3-Luc 4) that retains two GC boxes, an NRF-1 site and an AP-2 site. This construct, however, cannot form the stem and loop structure necessary for promoter activity, a finding confirmed with the pT3-Luc 5 construct, which lacks both the stem and loop structure and the two GC boxes, and with the pT3-Luc 6 construct, which retains only the AP-2 site. These results suggest that there are four elements that associate to regulate Gal NAc-T3 transcription in adenocarcinomas: the stem and loop structure, the GC boxes, and the NRF-1 and AP-2 sites. The finding that promoter activity in MCF-7 cells is almost 10-fold higher than in KB cells, even when the region between nucleotide -88 and nucleotide -69 was deleted (pT3-Luc 6), suggests that the untranslated region between nucleotide -69 and nucleotide +157 may also play a role in tissue-specific activity.
Although footprint analysis of the Gal NAc-T3 gene promoter showed that there are at least three protected areas in each of three breast cancer cell lines, these areas were absent from KB and T24 cells. Both Sp1 and AP-2 are ubiquitous factors that bind to the promoters of various genes. In contrast, NRF-1 was originally identified as a factor that regulates a number of respiratory genes (29
, 30)
. In addition, the gene encoding rat tyrosine aminotransferase and human initiation factor-2
were found to be functional targets of NRF-1 (31
, 32)
. Although NRF-1 mRNA is expressed at very low levels in many tissues (33)
, we observed considerable binding activity for the NRF-1 responsive element of the Gal NAc-T3 promoter in MCF-7 cells, suggesting that a novel NRF-1-related factor expressed in glandular epithelium may be primarily involved in the regulation of the Gal NAc-T3 gene.
The stem and loop structure we have identified in the in 5'-upstream region of the Gal NAc-T3 gene seems to be functional in vivo, as shown by our results with KMnO4-treated cells. Similar palindromic structure will be reported in the promoter of the gene encoding the p180 subunit of DNA polymerase
.4
Although the functional significance of the stem and loop structure in the Gal NAc-T3 promoter region is not precisely known, the presence of this structure close to transcription factor binding sites may enhance the number of "entry sites" for an initiation complex that includes RNA polymerase II.
Our finding of a DMS-hypersensitive site in the 5' untranslated region around nucleotide +50 of the Gal NAc-T3 gene in mammary carcinoma cell lines is especially noteworthy. Although the nucleotide -150 to +193 region of this gene is GC rich (
74%) and there is a G-rich stretch around nucleotide +50, we did not observe any differences in CpG methylation of this region between KB and MCF-7 cells (data not shown). KMnO4-hypersensitive sites have been detected in the 5' untranslated regions of several eukaryotic genes, including those encoding c-Myc, heat shock protein, and
-1 tubulin (23
, 24
, 28)
, when the transcriptional bubble is induced by the paused RNA polymerase complex. Our recent KMnO4 treatment and micrococcal nuclease digestion experiments suggest that this paused RNA polymerase complex forms between nucleotide +1 and nucleotide +50 (data not shown). Thus, in addition to the tissue-specific expression of Gal NAc-T3 that we have observed, pausing of the RNA polymerase complex may modulate expression of this gene.
The specificity of our Gal NAc-T3 antibody was shown by its ability to bind a Mr 68,000 protein in the cytoplasmic fraction of adenocarcinoma cell lines but not in nonadenocarcinoma cell lines. Although immunohistochemistry allows only an approximate estimation of tissue-specific expression and relative levels of protein, results obtained with the breast carcinoma samples showed that Gal NAc-T3 is expressed in tumor cells but not in normal mammary epithelium. In normal colorectal epithelium, however, Gal NAc-T3 is expressed to a significant degree (data not shown). Gal NAc-T3 expression can be correlated with the degree of differentiation in adenocarcinoma (6) , suggesting that Gal NAc-T3 is expressed in active glandular tissue but not in silent glandular tissue. Although Gal NAc-T3 may be expressed in normal mammary glands during pregnancy, our findings suggest that expression of this gene may be a new tumor marker for evaluating the progression of breast cancer.
The Gal NAc gene promoter provides an excellent model system for the study of tissue-specific expression. The four structural elements present in the 5'-upstream region, the stem and loop structure, the GC boxes, and the NRF-1 and AP-2 sites, together constitute one aspect of the Gal NAc-T3 gene expression, and the pausing of the RNA polymerase complex in the untranslated region of this gene functions as the second aspect of the regulation system. Thus, Gal NAc-T3 gene expression is regulated by multiple modulatory systems, which are highly restricted in adenocarcinoma cell lines derived from epithelial glands but not in carcinomas derived from nonsecretory epithelial tissue. The identification of a set of regulatory factors that act through these regions will enable us to more precisely understand the molecular mechanisms that govern Gal NAc-T3 gene regulation in glandular epithelium.
| FOOTNOTES |
|---|
1 This work was supported in part by a grant-in-aid for Cancer Research from the Ministry of Education, Science, Sports and Culture of Japan and by the Fukuoka Anticancer Research Fund. ![]()
2 To whom requests for reprints should be addressed, at Department of Molecular Biology, Faculty of Medicine, University of Occupational and Environmental Health, Japan, School of Medicine, Yahata nishi-ku, Kitakyushu 807-8555, Japan. Phone: 81-93-691-7423; Fax: 81-93-692-2766; E-mail: k-kohno{at}med.uoeh-u.ac.jp ![]()
3 The abbreviations used are: Gal NAc-T3, UDP-N-acetyl-
-D-galactosamine: polypeptide N-acetylgalactosaminyl transferase-3; NRF-1, nuclear respiratory factor 1; RT-PCR, reverse transcription PCR; EMSA, electrophoretic mobility shift assay; LM-PCR, ligation-mediated PCR; DMS, dimethyl sulfate. ![]()
4 H. Miyazawa, personal communication. ![]()
Received 6/25/99. Accepted 10/18/99.
| REFERENCES |
|---|
|
|
|---|
-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase family, GalNAc-T1, -T2, and -T3.. J. Biol. Chem., 272: 23503-23514, 1997.
-D-galactosamine: polypeptide N-acetylgalactosaminyl-transferase. J. Biol. Chem., 270: 24156-24165, 1995.
-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase, GalNAc-T3. J. Biol. Chem., 271: 17006-17012, 1996.
-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase that complements other GalNAc-transferases in complete O-glycosylation of the MUC1 tandem repeat. J. Biol. Chem., 273: 30472-30481, 1998.
-D-galactosamine: polypeptide N-acetylgalactosaminyltransferase-T3, designated GalNAc-T6. Evidence for genetic but not functional redundancy. J. Biol. Chem., 274: 25362-25370, 1999.
-D-galactosamine: polypeptide GalNAc N-acetylgalactosaminyltransferases in adenocarcinoma cell lines. Cancer Res., 57: 4744-4748, 1997.
gene by heat shock. J. Biol. Chem., 273: 10550-10555, 1998.
1 subunit gene by in vivo footprinting. Biochim. Biophys. Acta, 1264: 35-39, 1995.[Medline]
is strongly homologous to developmental transcription factors and may link metabolic genes to cellular growth and development. J. Biol. Chem., 269: 18921-18930, 1994.This article has been cited by other articles:
![]() |
N. Berois, E. Blanc, H. Ripoche, X. Mergui, F. Trajtenberg, S. Cantais, M. Barrois, P. Dessen, B. Kagedal, J. Benard, et al. ppGalNAc-T13: A New Molecular Marker of Bone Marrow Involvement in Neuroblastoma Clin. Chem., September 1, 2006; 52(9): 1701 - 1712. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Berois, D. Mazal, L. Ubillos, F. Trajtenberg, A. Nicolas, X. Sastre-Garau, H. Magdelenat, and E. Osinaga UDP-N-Acetyl-D-Galactosamine: Polypeptide N-Acetylgalactosaminyltransferase-6 as a New Immunohistochemical Breast Cancer Marker J. Histochem. Cytochem., March 1, 2006; 54(3): 317 - 328. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Miyahara, J. Shoda, T. Kawamoto, M. Furukawa, T. Ueda, T. Todoroki, N. Tanaka, K. Matsuo, Y. Yamada, K. Kohno, et al. Expression of UDP-N-Acetyl-{alpha}-D-Galactosamine-Polypeptide N-Acetylgalactosaminyltransferase Isozyme 3 in the Subserosal Layer Correlates with Postsurgical Survival of Pathological Tumor Stage 2 Carcinoma of the Gallbladder Clin. Cancer Res., March 15, 2004; 10(6): 2090 - 2099. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. W. Young Jr., D. R. Holcomb, K. G. Ten Hagen, and L. A. Tabak Expression of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase isoforms in murine tissues determined by real-time PCR: a new view of a large family Glycobiology, July 1, 2003; 13(7): 549 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Ten Hagen, T. A. Fritz, and L. A. Tabak All in the family: the UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases Glycobiology, January 1, 2003; 13(1): 1R - 16R. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Izumi, T. Imamura, G. Nagatani, T. Ise, T. Murakami, H. Uramoto, T. Torigoe, H. Ishiguchi, Y. Yoshida, M. Nomoto, et al. Y box-binding protein-1 binds preferentially to single-stranded nucleic acids and exhibits 3'{->}5' exonuclease activity Nucleic Acids Res., March 1, 2001; 29(5): 1200 - 1207. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |