| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Departments of Chemical Pathology [Y. M. D. L., L. Y. S. C., J. Z., N. M. H.], Anatomical and Cellular Pathology [K-W. L., J. C. K. L., D. P. H.], and Clinical Oncology and the Sir YK Pao Cancer Center [S-F. L. A. T. C. C., P. J. J.], The Chinese University of Hong Kong, Shatin, New Territories, Hong Kong Special Administrative Region
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
66 Gy over a 6.6–8.6-week period) was available in 15 of these patients. The mean time interval between blood sampling at presentation and after radiotherapy was 3.5 months. At the time of the second blood sampling, clinical and fiber-optic nasopharyngoscopic examinations and nasopharyngeal biopsies were carried out. The control group consisted of 43 subjects attending a screening clinic for relatives of patients with NPC. These subjects had all undergone examination of the nasopharynx and neck and had been followed-up for a minimum of 1 year with no evidence of NPC development. The study was approved by the Ethics Committee of The Chinese University of Hong Kong.
DNA Extraction from Plasma Samples.
Peripheral blood (5 ml) was collected from each subject into an EDTA tube for the isolation of plasma. Blood samples were centrifuged at 1600 x g, and plasma was carefully removed from the EDTA-containing tubes and transferred into plain polypropylene tubes. The samples were stored at -20°C until further processing. DNA from plasma samples was extracted using a QIAamp Blood Kit (Qiagen, Hilden, Germany) using the blood and body fluid protocol as recommended by the manufacturer (2)
. Plasma samples (130–800 µl/column) were used for DNA extraction. The exact amount was documented for the calculation of the target DNA concentration. A final elution volume of 50 µl was used.
DNA Extraction from Nasopharyngeal Biopsy Samples.
Pre- and postradiotherapy nasopharyngeal biopsy specimens from two NPC patients (TM6 and TM42) were studied. Fifteen paraffin-embedded sections, each of which was 5-µm thick, were made from each biopsy specimen. DNA was extracted with a QIAamp Tissue Kit (Qiagen) using a protocol recommended by the manufacturer. A final elution volume of 50 µl was used.
Real-Time Quantitative PCR.
Real-time quantitative PCR is based on the continuous optical monitoring of the progress of a fluorogenic PCR reaction (5
, 6) . In this system, in addition to the two amplification primers used in conventional PCR, a dual-labeled fluorogenic hybridization probe is also included (8)
. One fluorescent dye serves as a reporter (FAM), and its emission spectra is quenched by a second fluorescent dye (TAMRA). During the extension phase of PCR, the 5' to 3' exonuclease activity of Taq DNA polymerase (9)
cleaves the reporter from the probe, thus releasing it from the quencher and resulting in an increase in fluorescence emission at 518 nm.
Two real-time quantitative PCR systems were developed for EBV DNA detection: (a) one toward the BamHI-W region; and (b) the other toward the EBNA-1 region (10) . The BamHI-W system consisted of the amplification primers W-44F (5'-CCCAACACTCCACCACACC-3') and W-119R (5'-TCTT AGGAGCTGTCCGAGGG-3') and the dual-labeled fluorescent probe W-67T [5'-(FAM)CACACACTACACACACCCACCCGTCTC(TAMRA)-3']. The EBNA-1 system consisted of the amplification primers EBNA-1162F (5'-TCATCATCATCCGGGTCTCC-3') and EBNA-1229R (5'-CCTACAGGGTGGAAAAATGGC-3') and the dual-labeled fluorescent probe EBNA-1186T [5'-(FAM)CGCAGGCCCCCTCCAGGTAGAA(TAMRA)-3']. The fluorescent probes contained a 3'-blocking phosphate group to prevent probe extension during PCR. Primer/probe combinations were designed using Primer Express software (Perkin-Elmer Corp., Foster City, CA). Sequence data for the EBV genome were obtained from the GenBank Sequence Database (accession number V01555). Real-time quantitative PCR for the ß-globin gene consisted of primers and probe, as described previously (6) , and was used as a control for the amplifiability of plasma DNA. For DNA extracted from paraffin-embedded nasopharyngeal biopsy samples, the ß-globin gene quantitative PCR results were used to normalize the EBV DNA quantity.
Fluorogenic PCR reactions were set up in a reaction volume of 50 µl using components (except for the fluorescent probes and amplification primers) supplied in a TaqMan PCR Core Reagent Kit (Perkin-Elmer Corp.). Fluorescent probes were custom-synthesized by Perkin-Elmer Applied Biosystems. PCR primers were synthesized by Life Technologies, Inc. (Gaithersburg, MD). Each reaction contained 5 µl of 10x buffer A; 300 nM of each of the amplification primers; 25 nM (for the EBV probes) or 100 nM (for the ß-globin probe) of the corresponding fluorescent probe; 4 mM MgCl2; 200 µM each of dATP, dCTP, and dGTP; 400 µM dUTP; 1.25 units of AmpliTaq Gold; and 0.5 unit of AmpErase uracil N-glycosylase. Extracted plasma DNA or nasopharyngeal tissue DNA (5 µl) was used for amplification. DNA amplifications were carried out in a 96-well reaction plate format in a Perkin-Elmer Applied Biosystems 7700 Sequence Detector. Each sample was analyzed in duplicate. Multiple negative water blanks were included in every analysis.
A calibration curve was run in parallel and in duplicate with each analysis, using DNA extracted from the EBV-positive cell line Namalwa (American Type Culture Collection CRL-1432; Ref. 11 ) as a standard. Namalwa is a diploid cell line (12) that contains two integrated viral genomes/cell (13) . A conversion factor of 6.6 pg of DNA/diploid cell was used for copy number calculation (14) . Concentrations of circulating cell-free EBV DNA were expressed as copies of EBV genome/ml plasma. For nasopharyngeal biopsies, results were expressed as a ratio of the copy number of the EBV genome:the copy number of the ß-globin gene.
An identical thermal profile was used for the EBV BamHI-W and EBNA-1 PCR systems. Thermal cycling was initiated with a 2-min incubation at 50°C for the uracil N-glycosylase to act, followed by an initial denaturation step of 10 min at 95°C, and then 40 cycles of 95°C for 15 s and 56°C for 1 min were carried out. Conditions for the human ß-globin PCR system were as described previously (6) .
Amplification data collected by the 7700 Sequence Detector and stored in a Macintosh computer (Apple Computer, Cupertino, CA) were then analyzed using the Sequence Detection System software developed by Perkin-Elmer Applied Biosystems. The mean quantity of each duplicate was used for further concentration calculation. The plasma concentration of EBV DNA or the ß-globin gene (expressed in copies/ml) was calculated using the following equation:
 |
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
shows the results obtained using the BamHI-W region PCR system. The amplification curve shifted to the right as the input target quantity was reduced. This was expected because reactions with fewer target molecules required more amplification cycles to produce a certain quantity of reporter molecules than reactions with more target molecules. The system was sensitive enough to detect 5 copies of EBV DNA. Similar results and the detection limit were obtained using the EBNA-1 PCR system (data not shown).
|
shows a plot of the threshold cycle (CT) of the EBV BamHI-W region PCR against the input target quantity, with the latter plotted on a common logarithmic scale. The CT was set at 10 SDs above the mean baseline fluorescence calculated from cycles 1–15 and was proportional to the starting target copy number (logarithmic scale) used for amplification (5)
. The linearity of the graph demonstrates the large dynamic range and the accuracy of real-time quantitative PCR. Similar results were obtained using the EBNA-1 system (data not shown). The reproducibility of DNA extraction from plasma and EBV quantitative PCR systems was tested by performing 10 replicate extractions from pooled plasma samples from NPC individuals. These replicate extractions were then subjected to real-time quantitative PCR using the EBV PCR systems. The coefficients of variation of CT values of these replicate analyses were 0.83% for the EBV BamHI-W region PCR and 0.55% for the EBNA-1 PCR.
Quantitative Analysis of Cell-free EBV DNA in NPC and Control Subjects.
Plasma DNA samples from 57 NPC patients on presentation and 43 control subjects were analyzed using the two EBV real-time quantitative PCR systems. The BamHI-W region PCR measured median plasma EBV DNA concentrations of 21,058 copies/ml (interquartile range, 4,279–93,589 copies/ml) in NPC subjects and 0 copies/ml (interquartile range, 0–0 copies/ml) in control subjects (Fig. 2)
. Similar results were obtained using the EBNA-1 PCR that showed a strong correlation with the BamHI-W region PCR data (Spearman rank order correlation, correlation coefficient = 0.918; P < 0.0005). The differences in EBV DNA levels between the NPC and control groups using both the BamHI-W region PCR (Mann-Whitney rank-sum test, P < 0.001) and the EBNA-1 PCR (Mann-Whitney rank-sum test, P < 0.001) were highly significant. All plasma DNA samples (NPC and controls) were amplifiable using ß-globin PCR, thus confirming the quality of the plasma-extracted DNA.
|
Change in Plasma EBV DNA Levels after Radiotherapy.
Fifteen NPC patients with no clinical evidence of distant metastases on presentation were further studied at 1 month after the completion of radiotherapy. All 15 patients had detectable plasma cell-free EBV DNA at presentation (Fig. 3)
. After the completion of radiotherapy, 47% (7 of 15) of the patients had no detectable plasma EBV DNA by both EBV PCR assays. The remaining eight subjects (53%) continued to have detectable plasma EBV DNA (Fig. 3)
. The change in the proportion of individuals with detectable cell-free EBV DNA after radiotherapy is statistically significant (Fisher’s exact test, P = 0.006). As a control for the quality of plasma DNA, all pre- and postradiotherapy samples were shown to be amplifiable using the ß-globin PCR.
|
The pre- and postradiotherapy nasopharyngeal biopsies from the two subjects (TM6 and TM42; Fig. 3
) without clinical evidence of tumor persistence who had detectable plasma EBV DNA after radiotherapy were analyzed by real-time quantitative PCR. For subject TM6, the copy number ratios of EBV DNA:ß-globin gene pre- and postradiotherapy were 14.3 and 0.18, as determined by the BamHI-W fragment quantitative PCR system. For subject TM42, the corresponding figures were 33.6 and 0.16, respectively. These results represent a reduction of the EBV DNA level in the nasopharyngeal tissue samples of 79.4-fold (subject TM6) and 210-fold (subject TM42) after radiotherapy. The results obtained using the EBNA-1 quantitative PCR system were highly concordant and demonstrated a reduction in EBV DNA level in the nasopharyngeal tissue samples of 118.6-fold (subject TM6) and 275-fold (subject TM42) after radiotherapy.
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
. These data suggest that quantitative plasma EBV DNA analysis may be useful as a screening method for NPC in high-risk areas. Real-time quantitative PCR is highly suitable for this application due to its rapidity and accuracy. The clinical significance of the presence of plasma EBV DNA in the three control subjects without clinical evidence of NPC is unclear at present. We are carrying out long-term follow-up of these individuals to monitor any clinical signs of NPC and any change in their plasma EBV DNA levels.
We have taken special precautions to maximize the sensitivity of our system, including the use of prospectively collected samples that were promptly processed after venesection. We chose to use plasma instead of serum because previous work has indicated that DNA is liberated during the clotting process, which results in an increase in human DNA background when serum DNA is used (6) . Our use of the real-time PCR method using multiple primer/probe combinations also contributed to the sensitivity and robustness of detection. We believe that these technical improvements have combined to result in a much greater sensitivity in detecting plasma EBV DNA in NPC subjects than the previously reported figure of 31% (4) .
Our quantitative approach allowed us to correlate the levels of plasma cell-free EBV DNA with disease staging. Our data indicate that the plasma EBV DNA levels were approximately eight times higher in advanced NPC (stages III and IV) than in early-stage disease (stages I and II). One explanation for these results is that the liberation of EBV DNA into the blood may be related to the tumor load. This contention is supported by our findings on follow-up of patients after radiotherapy.
By analyzing plasma samples from NPC patients before and 1 month after radiotherapy, we demonstrated that 47% (7 of 15) of NPC patients did not have detectable EBV DNA in the plasma by 1 month postradiotherapy. These seven patients had complete regression of the tumor. In contrast, among the eight patients with detectable plasma EBV DNA after radiotherapy, six had incomplete regression of the tumor or had developed distant metastases. These results suggest that plasma EBV DNA measurement may be useful in identifying patients at increased risk of disease persistence after radiotherapy who may benefit from more aggressive treatment such as combined chemotherapy and radiotherapy (15) .
To obtain more information on the two patients (subjects TM6 and TM42) without clinical evidence of tumor persistence who still had detecTable plasma EBV DNA after radiotherapy, we analyzed the pre- and postradiotherapy nasopharyngeal biopsies from these individuals. The preradiotherapy nasopharyngeal biopsies from these subjects showed histological evidence of NPC and demonstrated high levels of EBV DNA by quantitative PCR analysis. Large reductions in tissue EBV DNA levels were observed in the postradiotherapy biopsies of both of these individuals. In subject TM42, this reduction in the tissue level of EBV DNA was paralleled by a reduction in plasma EBV DNA levels (Fig. 3)
. On the contrary, in subject TM6, the plasma EBV DNA level showed an additional increase after radiotherapy (Fig. 3)
, suggesting that the nasopharyngeal biopsy might have missed residual foci of disease or that occult lymph node or distant metastases might have occurred. We are currently following-up these and other individuals with NPC in an attempt to further understand the relationship between plasma EBV DNA levels and patient survival.
Our data raise the possibility that quantitative measurement of tumor-derived DNA in other cancers may also have clinical and biological value. The most direct extension of our findings would be for the analysis of other viral-associated cancers such as hepatocellular carcinoma and cervical cancer, in which associations with hepatitis B virus (16) and human papillomavirus have been found (17) . Real-time quantitative PCR can be readily adapted for quantifying hepatitis B virus and human papillomavirus DNA in plasma DNA.
The mechanism of liberation of cell-free EBV DNA into the plasma of NPC patients is currently unclear. Fournie et al. (18) suggested that plasma DNA may be a marker of cell death. In this regard, apoptosis in tumor tissues has been demonstrated to correlate with the presence of EBV DNA in the serum of NPC patients (4) . Our quantitative EBV assays may allow investigation of the mechanism of EBV DNA release by studying viral DNA levels under different clinical conditions, e.g. immediately after radiotherapy or biopsy. Apart from improving our understanding of the biology of NPC, these future studies may also increase our knowledge regarding the biology of plasma tumoral DNA in general.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by grants from the Hong Kong Research Grants Council. 
2 To whom requests for reprints should be addressed, at the Department of Chemical Pathology, The Chinese University of Hong Kong, Prince of Wales Hospital, Room 38023, 30-32 Ngan Shing Street, Shatin, New Territories, Hong Kong Special Administrative Region. E-mail: loym{at}cuhk.edu.hk
3 The abbreviations used are: NPC, nasopharyngeal carcinoma; FAM, 6-carboxy- fluorescein; TAMRA, 6-carboxy-tetramethylrhodamine.
Received 1/ 5/99. Accepted 2/ 8/99.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. W. Ong, M. Teo, V. Lee, D. Ong, A. Lee, C. S. Tan, A. Vathsala, and H. C. Toh Expression of EBV Latent Antigens, Mammalian Target of Rapamycin, and Tumor Suppression Genes in EBV-Positive Smooth Muscle Tumors: Clinical and Therapeutic Implications Clin. Cancer Res., September 1, 2009; 15(17): 5350 - 5358. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. C. Chan, E. Felip, and On behalf of the ESMO Guidelines Working Group Nasopharyngeal cancer: ESMO Clinical Recommendations for diagnosis, treatment and follow-up Ann. Onc., May 1, 2009; 20(suppl_4): iv123 - iv125. [Full Text] [PDF]
|
|
|
|
 |
|
 Y.M. D. Lo and R. W.K. Chiu Next-Generation Sequencing of Plasma/Serum DNA: An Emerging Research and Molecular Diagnostic Tool Clin. Chem., April 1, 2009; 55(4): 607 - 608. [Full Text] [PDF]
|
|
|
|
 |
|
 M. FREMONT, K. METZGER, H. RADY, J. HULSTAERT, and K. DE MEIRLEIR Detection of Herpesviruses and Parvovirus B19 in Gastric and Intestinal Mucosa of Chronic Fatigue Syndrome Patients In Vivo, March 1, 2009; 23(2): 209 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-S. Hsieh, R. Soo, B.-K. Peh, T. Loh, D. Dong, D. Soh, L.-S. Wong, S. Green, J. Chiao, C.-Y. Cui, et al. Pharmacodynamic Effects of Seliciclib, an Orally Administered Cell Cycle Modulator, in Undifferentiated Nasopharyngeal Cancer Clin. Cancer Res., February 15, 2009; 15(4): 1435 - 1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-P. Chang, S.-P. Hao, J.-H. Chang, C.-C. Wu, N.-M. Tsang, Y.-S. Lee, C.-L. Hsu, S.-H. Ueng, S.-C. Liu, Y.-L. Liu, et al. Macrophage Inflammatory Protein-3{alpha} Is a Novel Serum Marker for Nasopharyngeal Carcinoma Detection and Prediction of Treatment Outcomes Clin. Cancer Res., November 1, 2008; 14(21): 6979 - 6987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. A. Chan, P. B. S. Lai, T. S. K. Mok, H. L. Y. Chan, C. Ding, S. W. Yeung, and Y. M. D. Lo Quantitative Analysis of Circulating Methylated DNA as a Biomarker for Hepatocellular Carcinoma Clin. Chem., September 1, 2008; 54(9): 1528 - 1536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Garcia, V. Garcia, C. Pena, G. Dominguez, J. Silva, R. Diaz, P. Espinosa, M. J. Citores, M. Collado, and F. Bonilla Extracellular plasma RNA from colon cancer patients is confined in a vesicle-like structure and is mRNA-enriched RNA, July 1, 2008; 14(7): 1424 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. L. Gulley and W. Tang Laboratory Assays for Epstein-Barr Virus-Related Disease J. Mol. Diagn., July 1, 2008; 10(4): 279 - 292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.C. A. Chan, S.-F. Leung, S.-W. Yeung, A. T.C. Chan, and Y.M. D. Lo Persistent Aberrations in Circulating DNA Integrity after Radiotherapy Are Associated with Poor Prognosis in Nasopharyngeal Carcinoma Patients Clin. Cancer Res., July 1, 2008; 14(13): 4141 - 4145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. C. Chia, A. Leung, T. Krushel, N. M. Alajez, K. W. Lo, P. Busson, H. J. Klamut, C. Bastianutto, and F.-F. Liu Nuclear Factor-Y and Epstein Barr Virus in Nasopharyngeal Cancer Clin. Cancer Res., February 15, 2008; 14(4): 984 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Garcia, C. Pena, V. Garcia, G. Dominguez, C. Munoz, J. Silva, I. Millan, R. Diaz, Y. Lorenzo, R. Rodriguez, et al. Prognostic Value of LISCH7 mRNA in Plasma and Tumor of Colon Cancer Patients Clin. Cancer Res., November 1, 2007; 13(21): 6351 - 6358. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Wong, B. C. K. Wong, K. C. A. Chan, G. M. Joynt, F. Y. H. Y. Yap, C. W. K. Lam, N. Lee, S. S. Lee, C. S. Cockram, J. J. Y. Sung, et al. Cytokine Profile in Fatal Human Immunodeficiency Virus Tuberculosis Epstein-Barr Virus Associated Hemophagocytic Syndrome Arch Intern Med, September 24, 2007; 167(17): 1901 - 1903. [Full Text] [PDF]
|
|
|
|
 |
|
 O. Riesterer, L. Milas, and K. K. Ang Use of Molecular Biomarkers for Predicting the Response to Radiotherapy With or Without Chemotherapy J. Clin. Oncol., September 10, 2007; 25(26): 4075 - 4083. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hakim, C. Gibson, J. Pan, K. Srivastava, Z. Gu, M. J. Bankowski, and R. T. Hayden Comparison of Various Blood Compartments and Reporting Units for the Detection and Quantification of Epstein-Barr Virus in Peripheral Blood J. Clin. Microbiol., July 1, 2007; 45(7): 2151 - 2155. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J J-Y Lu, D-Y Chen, C-W Hsieh, J-L Lan, F-J Lin, and S-H Lin Association of Epstein-Barr virus infection with systemic lupus erythematosus in Taiwan Lupus, March 1, 2007; 16(3): 168 - 175. [Abstract] [PDF]
|
|
|
|
 |
|
 H.-H. Chua, H.-H. Lee, S.-S. Chang, C.-C. Lu, T.-H. Yeh, T.-Y. Hsu, T.-H. Cheng, J.-T. Cheng, M.-R. Chen, and C.-H. Tsai Role of the TSG101 Gene in Epstein-Barr Virus Late Gene Transcription J. Virol., March 1, 2007; 81(5): 2459 - 2471. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. C.S. Cho, T. T.C. Yip, R. K.C. Ngan, T.-T. Yip, V. N. Podust, C. Yip, H. H.Y. Yiu, V. Yip, W.-W. Cheng, V. W.S. Ma, et al. ProteinChip Array Profiling for Identification of Disease- and Chemotherapy-Associated Biomarkers of Nasopharyngeal Carcinoma Clin. Chem., February 1, 2007; 53(2): 241 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-f. Leung, B. Zee, B. B. Ma, E. P. Hui, F. Mo, M. Lai, K.C. A. Chan, L. Y.S. Chan, W.-h. Kwan, Y.M. D. Lo, et al. Plasma Epstein-Barr Viral Deoxyribonucleic Acid Quantitation Complements Tumor-Node-Metastasis Staging Prognostication in Nasopharyngeal Carcinoma J. Clin. Oncol., December 1, 2006; 24(34): 5414 - 5418. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. T. Chang and H.-O. Adami The enigmatic epidemiology of nasopharyngeal carcinoma. Cancer Epidemiol. Biomarkers Prev., October 1, 2006; 15(10): 1765 - 1777. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. C.K. Wong, K.C. A. Chan, A. T.C. Chan, S.-F. Leung, L. Y.S. Chan, K. C.K. Chow, and Y.M. D. Lo Reduced Plasma RNA Integrity in Nasopharyngeal Carcinoma Patients Clin. Cancer Res., April 15, 2006; 12(8): 2512 - 2516. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Garcia, J. M. Garcia, C. Pena, J. Silva, G. Dominguez, A. Hurtado, I. Alonso, R. Rodriguez, M. Provencio, and F. Bonilla Thymidylate synthase messenger RNA expression in plasma from patients with colon cancer: prognostic potential. Clin. Cancer Res., April 1, 2006; 12(7): 2095 - 2100. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Li, L. Harris, H. Mamon, M. H. Kulke, W.-H. Liu, P. Zhu, and G. Mike Makrigiorgos Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma J. Mol. Diagn., February 1, 2006; 8(1): 22 - 30. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. K. Gandhi, E. Lambley, J. Burrows, U. Dua, S. Elliott, P. J. Shaw, H. M. Prince, M. Wolf, K. Clarke, C. Underhill, et al. Plasma Epstein-Barr Virus (EBV) DNA Is a Biomarker for EBV-Positive Hodgkin's Lymphoma Clin. Cancer Res., January 15, 2006; 12(2): 460 - 464. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Espy, J. R. Uhl, L. M. Sloan, S. P. Buckwalter, M. F. Jones, E. A. Vetter, J. D. C. Yao, N. L. Wengenack, J. E. Rosenblatt, F. R. Cockerill III, et al. Real-Time PCR in Clinical Microbiology: Applications for Routine Laboratory Testing Clin. Microbiol. Rev., January 1, 2006; 19(1): 165 - 256. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.C. A. Chan, A. T.C. Chan, S.-F. Leung, J. C.S. Pang, A. Y.M. Wang, J. H.M. Tong, K.-F. To, L. Y.S. Chan, L. L.S. Tam, N. Y.F. Chung, et al. Investigation into the Origin and Tumoral Mass Correlation of Plasma Epstein-Barr Virus DNA in Nasopharyngeal Carcinoma Clin. Chem., November 1, 2005; 51(11): 2192 - 2195. [Full Text] [PDF]
|
|
|
|
|
|
Q.-T. Le, C. D. Jones, T.-K. Yau, H. A. Shirazi, P. H. Wong, E. N. Thomas, B. K. Patterson, A. W.M. Lee, and J. L. Zehnder A Comparison Study of Different PCR Assays in Measuring Circulating Plasma Epstein-Barr Virus DNA Levels in Patients with Nasopharyngeal Carcinoma Clin. Cancer Res., August 15, 2005; 11(16): 5700 - 5707. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yang, K. Yang, A. Khafagi, Y. Tang, T. E. Carey, A. W. Opipari, R. Lieberman, P. A. Oeth, W. Lancaster, H. P. Klinger, et al. Sensitive detection of human papillomavirus in cervical, head/neck, and schistosomiasis-associated bladder malignancies PNAS, May 24, 2005; 102(21): 7683 - 7688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. R. Gingeras, R. Higuchi, L. J. Kricka, Y.M. D. Lo, and C. T. Wittwer Fifty Years of Molecular (DNA/RNA) Diagnostics Clin. Chem., March 1, 2005; 51(3): 661 - 671. [Full Text] [PDF]
|
|
|
|
|
|
L. C.W. Lit, K.C. A. Chan, S.-F. Leung, K. I.K. Lei, L. Y.S. Chan, K. C.K. Chow, A. T.C. Chan, and Y.M. D. Lo Distribution of Cell-Free and Cell-Associated Epstein-Barr Virus (EBV) DNA in the Blood of Patients with Nasopharyngeal Carcinoma and EBV-Associated Lymphoma Clin. Chem., October 1, 2004; 50(10): 1842 - 1845. [Full Text] [PDF]
|
|
|
|
|
|
S. Holdenrieder, P. Stieber, J. von Pawel, H. Raith, D. Nagel, K. Feldmann, and D. Seidel Circulating Nucleosomes Predict the Response to Chemotherapy in Patients with Advanced Non-Small Cell Lung Cancer Clin. Cancer Res., September 15, 2004; 10(18): 5981 - 5987. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. T.C. Chan, B. B.Y. Ma, Y.M. D. Lo, S.F. Leung, W.H. Kwan, E. P. Hui, T. S.K. Mok, M. Kam, L. S. Chan, S. K.W. Chiu, et al. Phase II Study of Neoadjuvant Carboplatin and Paclitaxel Followed by Radiotherapy and Concurrent Cisplatin in Patients With Locoregionally Advanced Nasopharyngeal Carcinoma: Therapeutic Monitoring With Plasma Epstein-Barr Virus DNA J. Clin. Oncol., August 1, 2004; 22(15): 3053 - 3060. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Sriuranpong, A. Mutirangura, J. W. Gillespie, V. Patel, P. Amornphimoltham, A. A. Molinolo, V. Kerekhanjanarong, S. Supanakorn, P. Supiyaphun, S. Rangdaeng, et al. Global Gene Expression Profile of Nasopharyngeal Carcinoma by Laser Capture Microdissection and Complementary DNA Microarrays Clin. Cancer Res., August 1, 2004; 10(15): 4944 - 4958. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ding, R. W. K. Chiu, T. K. Lau, T. N. Leung, L. C. Chan, A. Y. Y. Chan, P. Charoenkwan, I. S. L. Ng, H.-y. Law, E. S. K. Ma, et al. MS analysis of single-nucleotide differences in circulating nucleic acids: Application to noninvasive prenatal diagnosis PNAS, July 20, 2004; 101(29): 10762 - 10767. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-C. Lin, W.-Y. Wang, K. Y. Chen, Y.-H. Wei, W.-M. Liang, J.-S. Jan, and R.-S. Jiang Quantification of Plasma Epstein-Barr Virus DNA in Patients with Advanced Nasopharyngeal Carcinoma N. Engl. J. Med., June 10, 2004; 350(24): 2461 - 2470. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Krishna, S. James, J. Kattoor, and P. Balaram Serum EBV DNA as a Biomarker in Primary Nasopharyngeal Carcinoma of Indian Origin Jpn. J. Clin. Oncol., June 1, 2004; 34(6): 307 - 311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Chang, S.-S. Chang, H.-H. Lee, S.-L. Doong, K. Takada, and C.-H. Tsai Inhibition of the Epstein-Barr virus lytic cycle by Zta-targeted RNA interference J. Gen. Virol., June 1, 2004; 85(6): 1371 - 1379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. L. Glaser, J. L. Hsu, and M. L. Gulley Epstein-Barr Virus and Breast Cancer: State of the Evidence for Viral Carcinogenesis Cancer Epidemiol. Biomarkers Prev., May 1, 2004; 13(5): 688 - 697. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-S. Wong, D. L.-W. Kwong, J. S.-T. Sham, W. I. Wei, Y.-L. Kwong, and A. P.-W. Yuen Quantitative Plasma Hypermethylated DNA Markers of Undifferentiated Nasopharyngeal Carcinoma Clin. Cancer Res., April 1, 2004; 10(7): 2401 - 2406. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Yu, Y. M. D. Lo, G. M. Tse, K. C. A. Chan, A. B. W. Chan, K. C. K. Chow, T. K. F. Ma, A. C. Vlantis, S. F. Leung, C. A. van Hasselt, et al. Quantitative Analysis of Cell-Free Epstein-Barr Virus DNA in Plasma of Patients with Nonnasopharyngeal Head and Neck Carcinomas Clin. Cancer Res., March 1, 2004; 10(5): 1726 - 1732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. von Knobloch, H. Brandt, A. J. Schrader, A. Heidenreich, and R. Hofmann Molecular Serological Detection of DNA Alterations in Transitional Cell Carcinoma Is Highly Sensitive and Stage Independent Clin. Cancer Res., February 1, 2004; 10(3): 988 - 993. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-f. Leung, J. S. Tam, A. T.C. Chan, B. Zee, L. Y.S. Chan, D. P. Huang, A. Van Hasselt, P. J. Johnson, and Y.M. D. Lo Improved Accuracy of Detection of Nasopharyngeal Carcinoma by Combined Application of Circulating Epstein-Barr Virus DNA and Anti-Epstein-Barr Viral Capsid Antigen IgA Antibody Clin. Chem., February 1, 2004; 50(2): 339 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Polstra, R. van den Burg, J. Goudsmit, and M. Cornelissen Human Herpesvirus 8 Load in Matched Serum and Plasma Samples of Patients with AIDS-Associated Kaposi's Sarcoma J. Clin. Microbiol., December 1, 2003; 41(12): 5488 - 5491. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Asada, S. Miyagawa, Y. Sumikawa, Y. Yamaguchi, S. Itami, S. Suguri, M. Harada, Y. Tokura, S. Ishihara, S. Ohshima, et al. CD4+ T-Lymphocyte-Induced Epstein-Barr Virus Reactivation in a Patient With Severe Hypersensitivity to Mosquito Bites and Epstein-Barr Virus-Infected NK Cell Lymphocytosis Arch Dermatol, December 1, 2003; 139(12): 1601 - 1607. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. M. Wadowsky, S. Laus, M. Green, S. A. Webber, and D. Rowe Measurement of Epstein-Barr Virus DNA Loads in Whole Blood and Plasma by TaqMan PCR and in Peripheral Blood Lymphocytes by Competitive PCR J. Clin. Microbiol., November 1, 2003; 41(11): 5245 - 5249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. W. H. To, K. C. A. Chan, S.-F. Leung, L. Y. S. Chan, K.-F. To, A. T. C. Chan, P. J. Johnson, and Y. M. D. Lo Rapid Clearance of Plasma Epstein-Barr Virus DNA After Surgical Treatment of Nasopharyngeal Carcinoma Clin. Cancer Res., August 1, 2003; 9(9): 3254 - 3259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-f. Leung, Y. M. D. Lo, A. T. C. Chan, K.-f. To, E. To, L. Y. S. Chan, B. Zee, D. P. Huang, and P. J. Johnson Disparity of Sensitivities in Detection of Radiation-Naive and Postirradiation Recurrent Nasopharyngeal Carcinoma of the Undifferentiated Type by Quantitative Analysis of Circulating Epstein-Barr Virus DNA1 ,2 Clin. Cancer Res., August 1, 2003; 9(9): 3431 - 3434. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.C. A. Chan, J. Zhang, A. T.C. Chan, K. I.K. Lei, S.-F. Leung, L. Y.S. Chan, K. C.K. Chow, and Y.M. D. Lo Molecular Characterization of Circulating EBV DNA in the Plasma of Nasopharyngeal Carcinoma and Lymphoma Patients Cancer Res., May 1, 2003; 63(9): 2028 - 2032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H.M. Chan, K. M. Chow, A. T.C. Chan, C. B. Leung, L. Y.S. Chan, K. C.K. Chow, C. W. Lam, and Y.M. D. Lo Quantitative Analysis of Pleural Fluid Cell-free DNA as a Tool for the Classification of Pleural Effusions Clin. Chem., May 1, 2003; 49(5): 740 - 745. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lu, H.-H. Chua, S.-Y. Chen, J.-Y. Chen, and C.-H. Tsai Regulation of Matrix Metalloproteinase-1 by Epstein-Barr Virus Proteins Cancer Res., January 1, 2003; 63(1): 256 - 262. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Gius and C. N. Coleman Treatment of Nasopharyngeal Cancer: Raising the "Barr" J Natl Cancer Inst, November 6, 2002; 94(21): 1594 - 1595. [Full Text] [PDF]
|
|
|
|
|
|
A. T. C. Chan, Y. M. D. Lo, B. Zee, L. Y. S. Chan, B. B. Y. Ma, S.-F. Leung, F. Mo, M. Lai, S. Ho, D. P. Huang, et al. Plasma Epstein-Barr Virus DNA and Residual Disease After Radiotherapy for Undifferentiated Nasopharyngeal Carcinoma J Natl Cancer Inst, November 6, 2002; 94(21): 1614 - 1619. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. L. Dworkin, T. M. Gibler, and R. N. Van Gelder Real-Time Quantitative Polymerase Chain Reaction Diagnosis of Infectious Posterior Uveitis Arch Ophthalmol, November 1, 2002; 120(11): 1534 - 1539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Johnson and Y.M. D. Lo Plasma Nucleic Acids in the Diagnosis and Management of Malignant Disease Clin. Chem., August 1, 2002; 48(8): 1186 - 1193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-Y. Wang, Y.-C. Chien, J.-S. Jan, C.-M. Chueh, and J.-C. Lin Consistent Sequence Variation of Epstein-Barr Virus Nuclear Antigen 1 in Primary Tumor and Peripheral Blood Cells of Patients with Nasopharyngeal Carcinoma Clin. Cancer Res., August 1, 2002; 8(8): 2586 - 2590. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. M. Tong, R. K. Y. Tsang, K.-W. Lo, J. K. S. Woo, J. Kwong, M. W. Y. Chan, A. R. Chang, C. A. van Hasselt, D. P. Huang, and K.-F. To Quantitative Epstein-Barr Virus DNA Analysis and Detection of Gene Promoter Hypermethylation in Nasopharyngeal (NP) Brushing Samples from Patients with NP Carcinoma Clin. Cancer Res., August 1, 2002; 8(8): 2612 - 2619. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. T. C. Chan, P. M. L. Teo, and P. J. Johnson Nasopharyngeal carcinoma Ann. Onc., July 1, 2002; 13(7): 1007 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J M Silva, R Rodriguez, J M Garcia, C Munoz, J Silva, G Dominguez, M Provencio, P Espana, and F Bonilla Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells Gut, April 1, 2002; 50(4): 530 - 534. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients Clin. Cancer Res., April 1, 2002; 8(4): 980 - 985. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. K. C. Ngan, T. T. C. Yip, W.-W. Cheng, J. K. C. Chan, W. C. S. Cho, V. W. S. Ma, K.-K. Wan, S.-K. Au, C.-K. Law, and W.-H. Lau Circulating Epstein-Barr Virus DNA in Serum of Patients with Lymphoepithelioma-like Carcinoma of the Lung: A Potential Surrogate Marker for Monitoring Disease Clin. Cancer Res., April 1, 2002; 8(4): 986 - 994. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Mackay, K. E. Arden, and A. Nitsche Real-time PCR in virology Nucleic Acids Res., March 15, 2002; 30(6): 1292 - 1305. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Dong, S. I. Pai, S.-H. Rha, A. Hildesheim, R. J. Kurman, P. E. Schwartz, R. Mortel, L. McGowan, M. D. Greenberg, W. A. Barnes, et al. Detection and Quantitation of Human Papillomavirus DNA in the Plasma of Patients with Cervical Carcinoma Cancer Epidemiol. Biomarkers Prev., January 1, 2002; 11(1): 3 - 6. [Abstract] [Full Text]
|
|
|
|
|
|
K. I. K. Lei, L. Y. S. Chan, W.-Y. Chan, P. J. Johnson, and Y. M. D. Lo Diagnostic and Prognostic Implications of Circulating Cell-free Epstein-Barr Virus DNA in Natural Killer/T-Cell Lymphoma Clin. Cancer Res., January 1, 2002; 8(1): 29 - 34. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Forastiere, W. Koch, A. Trotti, and D. Sidransky Head and Neck Cancer N. Engl. J. Med., December 27, 2001; 345(26): 1890 - 1900. [Full Text] [PDF]
|
|
|
|
|
|
J. M. Silva, G. Dominguez, J. Silva, J. M. Garcia, A. Sanchez, O. Rodriguez, M. Provencio, P. Espana, and F. Bonilla Detection of Epithelial Messenger RNA in the Plasma of Breast Cancer Patients Is Associated with Poor Prognosis Tumor Characteristics Clin. Cancer Res., September 1, 2001; 7(9): 2821 - 2825. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. I. Wei Nasopharyngeal Cancer: Current Status of Management: A New York Head and Neck Society Lecture Arch Otolaryngol Head Neck Surg, July 1, 2001; 127(7): 766 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. D. Lo, W. Y. Chan, E. K. W. Ng, L. Y. S. Chan, P. B. S. Lai, J. S. Tam, and S. C. S. Chung Circulating Epstein-Barr Virus DNA in the Serum of Patients with Gastric Carcinoma Clin. Cancer Res., July 1, 2001; 7(7): 1856 - 1859. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-C. Lin, K. Y. Chen, W.-Y. Wang, J.-S. Jan, W.-M. Liang, C.-S. Tsai, and Y.-H. Wei Detection of Epstein-Barr Virus DNA in the Peripheral-Blood Cells of Patients With Nasopharyngeal Carcinoma: Relationship to Distant Metastasis and Survival J. Clin. Oncol., May 15, 2001; 19(10): 2607 - 2615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. C. Stevens, I. Pronk, and J. M. Middeldorp Toward Standardization of Epstein-Barr Virus DNA Load Monitoring: Unfractionated Whole Blood as Preferred Clinical Specimen J. Clin. Microbiol., April 1, 2001; 39(4): 1211 - 1216. [Abstract] [Full Text]
|
|
|
|
|
|
W. J. Jabs, H. Hennig, M. Kittel, K. Pethig, F. Smets, P. Bucsky, H. Kirchner, and H. J. Wagner Normalized Quantification by Real-Time PCR of Epstein-Barr Virus Load in Patients at Risk for Posttransplant Lymphoproliferative Disorders J. Clin. Microbiol., February 1, 2001; 39(2): 564 - 569. [Abstract] [Full Text]
|
|
|
|
|
|
M. L. Gulley Molecular Diagnosis of Epstein-Barr Virus-Related Diseases J. Mol. Diagn., February 1, 2001; 3(1): 1 - 10. [Abstract] [Full Text]
|
|
|
|
 |
|
 J. Yang, Q. Tao, I. W. Flinn, P. G. Murray, L. E. Post, H. Ma, S. Piantadosi, M. A. Caligiuri, and R. F. Ambinder Characterization of Epstein-Barr virus-infected B cells in patients with posttransplantation lymphoproliferative disease: disappearance after rituximab therapy does not predict clinical response Blood, December 15, 2000; 96(13): 4055 - 4063. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. D. Lo, A. T. C. Chan, L. Y. S. Chan, S.-F. Leung, C.-W. Lam, D. P. Huang, and P. J. Johnson Molecular Prognostication of Nasopharyngeal Carcinoma by Quantitative Analysis of Circulating Epstein-Barr Virus DNA Cancer Res., December 1, 2000; 60(24): 6878 - 6881. [Abstract] [Full Text]
|
|
|
|
|
|
R. B. Capone, S. I. Pai, W. M. Koch, M. L. Gillison, H. N. Danish, W. H. Westra, R. Daniel, K. V. Shah, and D. Sidransky Detection and Quantitation of Human Papillomavirus (HPV) DNA in the Sera of Patients with HPV-associated Head and Neck Squamous Cell Carcinoma Clin. Cancer Res., November 1, 2000; 6(11): 4171 - 4175. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Feng, E. C. Ren, D. Liu, S. H. Chan, and H. Hu Expression of Epstein-Barr virus lytic gene BRLF1 in nasopharyngeal carcinoma: potential use in diagnosis J. Gen. Virol., October 1, 2000; 81(10): 2417 - 2423. [Abstract] [Full Text]
|
|
|
|
|
|
Y.M. D. Lo Molecular Testing of Urine: Catching DNA on the Way Out Clin. Chem., August 1, 2000; 46(8): 1039 - 1040. [Full Text] [PDF]
|
|
|
|
|
|
I. Botezatu, O.'g. Serdyuk, G. Potapova, V. Shelepov, R. Alechina, Y. Molyaka, V. Anan'ev, I. Bazin, A. Garin, M. Narimanov, et al. Genetic Analysis of DNA Excreted in Urine: A New Approach for Detecting Specific Genomic DNA Sequences from Cells Dying in an Organism Clin. Chem., August 1, 2000; 46(8): 1078 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Clementi Quantitative Molecular Analysis of Virus Expression and Replication J. Clin. Microbiol., June 1, 2000; 38(6): 2030 - 2036. [Full Text]
|
|
|
|
|
|
Y. M. D. Lo, S.-F. Leung, L. Y. S. Chan, A. T. C. Chan, K.-W. Lo, P. J. Johnson, and D. P. Huang Kinetics of Plasma Epstein-Barr Virus DNA during Radiation Therapy for Nasopharyngeal Carcinoma Cancer Res., May 1, 2000; 60(9): 2351 - 2355. [Abstract] [Full Text]
|
|
|
|
|
|
K. Shotelersuk, C. Khorprasert, S. Sakdikul, W. Pornthanakasem, N. Voravud, and A. Mutirangura Epstein-Barr Virus DNA in Serum/Plasma as a Tumor Marker for Nasopharyngeal Cancer Clin. Cancer Res., March 1, 2000; 6(3): 1046 - 1051. [Abstract] [Full Text]
|
|
|
|
|
|
Y. M. Dennis Lo, L. Y. S. Chan, A. T. C. Chan, S.-F. Leung, K.-W. Lo, J. Zhang, J. C. K. Lee, N. M. Hjelm, P. J. Johnson, and D. P. Huang Quantitative and Temporal Correlation between Circulating Cell-Free Epstein-Barr Virus DNA and Tumor Recurrence in Nasopharyngeal Carcinoma Cancer Res., November 1, 1999; 59(21): 5452 - 5455. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. M. D. Lo, I. H. N. Wong, J. Zhang, M. S. C. Tein, M. H. L. Ng, and N. M. Hjelm Quantitative Analysis of Aberrant p16 Methylation Using Real-Time Quantitative Methylation-specific Polymerase Chain Reaction Cancer Res., August 1, 1999; 59(16): 3899 - 3903. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-W. Lo, Y.M. D. Lo, S.-F. Leung, Y.-S. Tsang, L. Y.S. Chan, P. J. Johnson, N. M. Hjelm, J. C.K. Lee, and D. P. Huang Analysis of Cell-free Epstein-Barr Virus-associated RNA in the Plasma of Patients with Nasopharyngeal Carcinoma Clin. Chem., August 1, 1999; 45(8): 1292 - 1294. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
Rn, which is the fluorescence intensity over the background 
and 
, respectively. The Y axis denotes the concentration of cell-free EBV DNA (copies of EBV DNA/ml of plasma) detected by the BamHI-W region PCR system.
and 
, respectively. For visual clarity, the seven cases with no detectable EBV DNA after radiotherapy are grouped together on the left of the graph. These cases are followed by the eight cases with detectable levels of EBV DNA after radiotherapy.