Cancer Research Annual Meeting 2010  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 1315-1322, March 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murphy, B. J.
Right arrow Articles by Webster, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murphy, B. J.
Right arrow Articles by Webster, K. A.
[Cancer Research 59, 1315-1322, March 15, 1999]
© 1999 American Association for Cancer Research


Molecular Biology and Genetics

Activation of Metallothionein Gene Expression by Hypoxia Involves Metal Response Elements and Metal Transcription Factor-11

Brian J. Murphy2, Glen K. Andrews, Doug Bittel, Daryl J. Discher, Jesica McCue, Christopher J. Green, Marianna Yanovsky, Amato Giaccia, Robert M. Sutherland, Keith R. Laderoute and Keith A. Webster

Pharmaceutical Discovery Division, SRI International, Menlo Park, California 94025 [B. J. M., C. J. G., M. Y., K. R. L., K. A. W.]; Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160 [G. K. A., D. B.]; Department of Molecular and Cellular Pharmacology, University of Miami, Florida 33136 [D. J. D., J. M., K. A. W.]; Department of Radiation Biology, Stanford University, California 94305 [A. G.]; and Varian Biosynergy, Inc., Palo Alto, California 94304 [R. M. S.]

ABSTRACT

Metallothioneins (MTs) are a family of stress-induced proteins with diverse physiological functions, including protection against metal toxicity and oxidants. They may also contribute to the regulation of cellular proliferation, apoptosis, and malignant progression. We reported previously that the human (h)MT-IIA isoform is induced in carcinoma cells (A431, SiHa, and HT29) exposed to low oxygen, conditions commonly found in solid tumors. The present study demonstrates that the genes for hMT-IIA and mouse (m)MT-I are transcriptionally activated by hypoxia through metal response elements (MREs) in their proximal promoter regions. These elements bind metal transcription factor-1 (MTF-1). Deletion and mutational analyses of the hMT-IIA promoter indicated that the hMRE-a element is essential for basal promoter activity and for induction by hypoxia, but that other elements contribute to the full transcriptional response. Functional studies of the mMT-I promoter demonstrated that at least two other MREs (mMRE-d and mMRE-c) are responsive to hypoxia. Multiple copies of either hMRE-a or mMRE-d conferred hypoxia responsiveness to a minimal MT promoter. Mouse MT-I gene transcripts in fibroblasts with targeted deletions of both MTF-1 alleles (MTF-1-/-; dko7 cells) were not induced by zinc and showed low responsiveness to hypoxia. A transiently transfected MT promoter was unresponsive to hypoxia or zinc in dko7 cells, but inductions were restored by cotransfecting a mouse MTF-1 expression vector. Electrophoretic mobility shift assays detected a specific protein-DNA complex containing MTF-1 in nuclear extracts from hypoxic cells. Together, these results demonstrate that hypoxia activates MT gene expression through MREs and that this activation involves MTF-1.

INTRODUCTION

MTs3 are ubiquitous, low molecular weight proteins characterized by high cysteine content and high affinities for metals such as zinc and cadmium (reviewed in Ref. 1 ). Both the constitutive and stress-inducible expression of MT appear to be dependent on activation of MTF-1, a member of the Cys2His2 family of zinc finger transcription factors (2 , 3) . MTs have well-established roles in metal homeostasis and in the detoxification of heavy metals. Moreover, they also confer protection against reactive oxygen intermediates, electrophilic antineoplastic agents, various mutagens, ionizing radiation, and nitric oxide (4 , 5) . Other studies indicate roles for MTs in the regulation of cellular proliferation and apoptosis (6, 7, 8, 9) , perhaps through an interaction of MT with nuclear factor-{kappa}B-DNA complexes (10) . These properties of MTs reflect their potential importance for malignant progression; high expression of MTs correlates with poor prognosis and progressive disease in a number of human tumors (11 , 12) . In this context, MTF-1 may be important for tumorigenesis not only through MT expression but also through its regulation of other genes. For example, MTF-1 activity is necessary for the expression of {gamma}-glutamylcysteine synthetase (13) , the rate-limiting enzyme for the synthesis of GSH (14) . GSH is a major contributor to cellular defenses against environmental alkylating agents and oxidants, including reactive oxygen species generated by ionizing radiation (14) . Thus, MTF-1 may be critical for modulating gene expression associated with malignant phenotypes such as resistance to therapy.

The mammalian MT family consists of two ubiquitous isoforms (MT-I and MT-II) and two tissue-specific isoforms (MT-III and MT-IV). Although only one isoform of mammalian MT-II has been identified (MT-IIA), at least seven unique functional isoforms have been described for the hMT-I gene (15) . The expression and regulation of some of the hMT genes (e.g., MT-IA, MT-IB, MT-1G, and MT-IIA) have been described (15 , 16) . MT-IIA is the predominant human MT isoform and is expressed in most cultured human cells (15) . In contrast, MT-I is the predominant MT isoform in the mouse. The mammalian MT-I and MT-II genes are transcriptionally regulated by metal ions, such as zinc and cadmium, and by a wide variety of other stimuli. These latter agonists include bacterial endotoxin (lipopolysaccharides), phorbol esters, xenobiotics, and oxidative stress (3) . The hMT-IIA gene is also induced by hypoxia, growth factors, cytokines, UV radiation, glucocorticoids, X-irradiation, and some specific DNA-damaging agents (4 , 15 , 17) . Although the regulatory mechanisms of these nonmetallic inducers are not well understood, some appear to involve redox stresses (3) .

Both MT-I and MT-II promoters contain multiple copies of specific cis-acting elements that cooperate to direct metal inducibility (MREs; 1 ). The MRE-associated transcription factor (MTF-1) that binds to MREs and activates MT transcription has been cloned from mouse and human cells (18 , 19) . The mechanism by which metals activate transcription through MTF-1 has not been well established, although it appears to involve interactions at the zinc finger domain of MTF-1 (20) . We have observed that oxidative stress activates the mMT-1 gene through MTF-1 binding to the MREs in the proximal promoter (21 , 22) . In addition to the MREs, proximal mMT-1 promoters contain Sp1 binding sites, USF binding sites, AREs, glucocorticoid-responsive elements, and consensus TATA box sequences (23 , 24) . The hMT-IIA promoter is also complex and contains a glucocorticoid-responsive element, Sp1 and AP1 binding sites, three putative AP2 sites, four metal response elements (MRE-a through MRE-d), and a TATA box (15) .

We reported previously that low pO2 levels, similar to those measured in tumors <1 mm in diameter (25) , significantly induced hMT-IIA transcript and protein expression in a variety of carcinoma cell lines (17) . In this study, we present the following major observations: (a) the most downstream MRE in the proximal promoter region of the hMT-IIA gene regulates MT-IIA transcriptional inductions by hypoxia, whereas at least two distal MREs are involved in the mMT-I activation; (b) MTF-1 is required for this process; and (c) it is therefore likely that MTF-1 is a redox-responsive transcription factor that regulates coordinate gene expression in hypoxic and reoxygenated tumor microenvironments.

MATERIALS AND METHODS

Cell Culture and Hypoxia.
The culture of C2C12 myoblasts, NIH3T3R (Ha-ras transformed NIH3T3 cells), dko7 fibroblasts, and MEF cells and our methods for exposing cells to hypoxia are described elsewhere (2 , 26, 27, 28, 29) . Briefly, culture dishes were incubated in aluminum chambers at 37°C and made hypoxic by repeated cycles of partial evacuation and gassing with 5% CO2/N2. The final O2 tension at the end of the pump/gas period was <=0.1% of atmospheric O2. After incubation at 37°C for periods up to 14 h, the chambers were opened under N2 in a humidified anaerobic chamber (Anaerobe Systems, Santa Clara, CA) and harvested. Aerobic controls were incubated in 5% CO2/air at 37°C.

Northern Blots.
Our procedure for Northern analysis is described elsewhere (17) . Blots were probed with a EcoRI/HindIII (1.85-kb) fragment of the mMT-I genomic DNA (American Type Culture Collection, Rockville, MD) labeled by the random primer method. Signals were quantified by video densitometry using a Lynx 4000 image analyzer and normalized to ß-actin mRNA levels detected by using a 32P-labeled, 200-bp oligomer of human ß-actin (Clontech, Palo Alto, CA).

MT Plasmid Constructs.
The vector pHS1, containing -764 to 76 bp relative to the transcription start site of the hMT-IIA gene, was a generous gift of T. Mulcahy (University of Wisconsin-Madison, Madison, WI). Constructs containing successive deletions of the proximal promoter (from -167 bp) were generated by the PCR using the primers described below and pHS1 as the template. Primers were designed from the published hMT-IIA sequence (30) , and the amplified fragments were cloned into the XhoI/HindIII site of the pGL2 Basic luciferase reporter plasmid (Promega Corp., Madison, WI). All resulting constructs were confirmed by double-stranded sequencing using the PCR primers. The following mMT-I promoter constructs have been described elsewhere (22) : pmMT-I(-153)-Luc containing the -153 to 62-bp fragment; pmMT-I ({Delta}153)-Luc containing the -153-bp deletion mutant (-100 to -89 deleted); pmMT-I(-42)-Luc containing the -42 to 62-bp minimal promoter, and pmMT-I (MRE-d'5)-Luc containing five tandem copies of mMRE-d repeats cloned upstream of the minimal promoter from pmMT-I(-42)-Luc. The primers used were as follows [mutant (mut) bases are shown in lowercase]: universal 3'-primer (to 23 of hMT-IIA), TTTAAGCTTGGGACTTGGAGGAGGCGTGGTGGAGTGCAG; 5'-primers to -167-bp [phMT-IIA(-167)-Luc], TTTTCTCGAGGTGCAGAGCCGGGTG; 5'-primers to -90 bp [phMT-IIA(-90)-Luc], TTCTCGAGGCGGGGCGTGTGCAGGCACGGCC-GGGGCGGGGC; 5'-primers to -70 bp [phMT-IIA(-70)-Luc], TTTTCTCGAGGCCGGGGCGGGGCTTTTGCACTCGT; 5'-primers to -57 bp [phMT-IIA(-57)-Luc], TTTCTCGAGTTTTGCACTCGTCCCGGCTC; and 5'-primers to -70 bp [hMRE-a mut; phMT-IIA(-70 mut)-Luc], TTTTCTCG-AGGCCGGGGCGGGGCTTTgatgCTCGT.

Selected mMRE double-stranded oligonucleotides (monomers) were synthesized and cloned into the XhoI/BglII sites of pmMT-I(-42)-Luc, immediately upstream of the minimal mMT-1 promoter (-42 to 62; 22 ). The mMT-I MRE-s, including a consensus MRE (MRE-s) that lacks an Sp1-like overlapping sequence, were as follows: mMRE-d, 5'-GATCCAGGGAGCTCTGCACTCCGCCCGAAAAGTA-3' and 3'-GTCCCTCGAGACGTGAGGCG-GGCTTTTCATCTAG-5'; mMRE-d mut, 5'-GATCCAGGGAGCTaattA-CTCCGCCCGAAAAGTA-3' and 3'-GTCCCTCGATTAATGAGGCGGGC-TTTTCATCTAG-5'; mMRE-c, 5'-GATCCCCGAAAAGTGCGCTCGGC-TCTGCCAAGTA-3' and 3'-GGGCTTTTCACGCGAGCCGAGACGGTT-CATCTAG-5'; and mMRE-s, 5'-GATCCAGGGAGCTCTGCACACGG-CCCGAAAAGTA-3' and 3'-GTCCCTCGAGACGTGTGCCGGGCTTTT-CATCTAG-5'.

A construct containing five tandem copies of the hMRE-a was assembled using a monomer containing the 15-bp hMRE-a sequence and 5-bp natural flanking sequences on both the 5' and 3' sides: GGGGCTTTTGCACTCGTCCCGGCTC. The fragment was also inserted between the XhoI/BglII sites of pMT-I(-42)-Luc.

Cell Transfections and Treatments.
Subconfluent C2C12 myoblasts or NIH3T3R cells were used for analysis of both the hMT-IIA and mMT-I promoters and were transfected with either 10 µg of total DNA by the calcium phosphate technique as described previously (17) or with 2 µg of DNA using a standard DEAE dextran method (31) . The DEAE dextran method was also used for cotransfections of the mMTF-1-/- fibroblast cells (dko7) involving 2.0 µg of pMT-I(-153)-Luc and variable amounts of an mMTF-1 expression vector (up to 1.0 µg). Where appropriate, a Bluescript phagemid was used to maintain an equal administration of total DNA. Transfections were normalized either by cotransfection with a plasmid containing the ß-galactosidase gene, driven by the mouse hydroxymethylglutaryl-CoA reductase promoter, which has a minimal hypoxia response (32) , or with a Renilla luciferase control (Dual-Luciferase Reporter Assay System; Promega). At 24 h after transfection, the medium was replenished, and the cells were subjected to hypoxia or metal treatments. Luciferase activity in cell extracts was assayed with a Promega Biotec assay kit and either a LKB BioOrbit 1250 luminometer or a Turner Designs TD-20/20 luminometer (Promega).

MTF-1 Null Analyses.
The mouse dko7 cell line, which lacks MTF-1, was a gift of Walter Schaffner (University of Zurich, Zurich, Switzerland; Ref. 2 ). These fibroblast-like cells were derived from embryonic stem cells and immortalized with SV40 large T antigen (33) . Wild-type MEF cells, which were also immortalized with SV40 large T antigen, were obtained from Dr. John Lazo, University of Pittsburgh (Pittsburgh, PA; Ref. 28 ). Both lines were maintained in high-glucose DMEM supplemented with 10% FBS (2) . The expression plasmid CMV-mMTF-1 was created by inserting the mMTF-1 cDNA, isolated by reverse transcription-PCR, into the NotI site of a cytomegalovirus expression vector (20) .

Nuclear Extracts and Electrophoretic Mobility Shift Assay.
Nuclear extracts were prepared from confluent C2C12 myocytes grown in a normal aerobic environment or under hypoxia. Cells were serum starved (0.5% serum) for 4–5 days before treatments to eliminate the effects of mitogens and serum metals. For hypoxic cell extracts, cell lysis was performed with the cells still under hypoxia to avoid reoxygenation effects (34) . Cells were lysed in a buffer containing 10 mM HEPES (pH 7.9), 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT, 0.4 mM phenylmethylsulfonyl fluoride, 1 mM sodium vanadate, 5 mM ß-glycerophosphate, 5 mM benzamidine, 5 mM NaF, and 10 mM sodium PPi. Nuclei were removed by centrifuging at 3000 x g for 20 min, and proteins were extracted (35) . Sequences of the sense-strand oligonucleotide probes used were: hMRE-a, 5'-AGCTTCGGGGCTTTTGCACTCGTCCCGGCTCTA-3'; hMRE-a mut, 5'-AGCTTCGGGGCTTTgatgCTCGTCCCGGCTCTA-3'; MRE-s, 5'-GATCCAGGAGCTCTGCACAGGCCCAAAAGTA-3'; HIF-1, 5'-AGCTTGCCCTACGTGCTGTCTCA-3'; and Sp1, 5'-ATTCGATCGGG-GCGGGGCGAGC-3'.

Gel-purified, double-stranded oligonucleotides were end-labeled using T4 polynucleotide kinase (Promega) and [{gamma}-32P]ATP (NEN/DuPont). Equal amounts of radioactive probe (1.5–2.5 x 104 cpm) were added to binding reactions that contained 8 µg of protein in 20 µl of a buffer containing 4 mM Tris (pH 7.8), 12 mM HEPES (pH 7.9), 60 mM KCl, 30 mM NaCl, 0.1 mM EDTA, and 1 µg of poly(deoxyinosinic-deoxycytidylic acid; Pharmacia). Reactions were incubated for 15 min at 22°C before separation on nondenaturing 6% polyacrylamide gels at 4°C. For competition assays, binding reactions included 100 ng of indicated unlabeled oligonucleotide. For supershift assays, polyclonal antibodies (0.5 µl) against a recombinant GST-mMTF-1 fusion protein, or against Sp1 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were added to the binding buffer 1 h before addition of the labeled oligonucleotide. The polyclonal antiserum against GST-mMTF-1 expressed in Escherichia coli was raised in rabbits (Covance Research Products, Inc., Denver, CO) and was enriched for IgG by protein A affinity purification.

RESULTS

Induction of MT-I mRNA
We demonstrated previously that the expression of the predominant human MT isoform, hMT-IIA, is up-regulated in a number of carcinoma cell lines by hypoxia (17) . Fig. 1Citation shows that the steady-state levels of mMT-I mRNA are increased in rodent C2C12 muscle cells by exposure to hypoxia. We confirmed this finding in a number of other rodent cell lines including NIH 3T3, ras-transformed NIH3T3 (NIH3T3R), and mouse hepatoma cells (Hepa).4 Hypoxia treatments resulted in 12.8 ± 7.0-fold inductions of state levels of mMT-I mRNA after 12 h; ZnCl2 exposures (100 µM; 4–6 h) resulted in >17-fold induction. These values are similar to those reported for MT-IIA mRNA in A431 human squamous carcinoma cells (17) . The blot shown in Fig. 1Citation was reprobed with ß-actin as a control gene that is not affected by hypoxia.



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Northern analysis of mMT-I induction kinetics. C2C12 cells were exposed to hypoxia (<=0.1% O2) for 0–12 h, and mMT-I RNA was detected by Northern analysis using a 32P-labeled MT-I EcoRI/HindIII fragment of the mouse MT-I genomic DNA. This representative blot was reprobed for ß-actin mRNAs as described in "Materials and Methods."

 
Mapping of MT Hypoxia-responsive Regions
hMT-IIA.
To define the element(s) responsible for the induction of the hMT-II gene by hypoxia, deletions of the proximal promoter region were made and assayed under aerobic, hypoxic, or metal-treated conditions as described in "Materials and Methods." The basal activities of the reporter constructs dropped as successive deletions were introduced downstream of -167 bp (Fig. 2)Citation . Specifically, phMT-IIA(-90)-Luc and phMT-IIA(-70)-Luc showed approximately 2- and 9-fold lower basal activities, respectively, as compared with phMT-IIA(-167)-Luc. Deletion to -57 bp caused an additional 7-fold reduction in basal transcriptional activity as compared with phMT-IIA(-70)-Luc. The deletion from -167 to -90 bp eliminates two MREs (hMRE-d and hMRE-c), an AP2 sequence and an AP1 element; deletion from -90 to -70 bp removes hMRE-b, whereas the deletion from -70 to -57 bp removes a GC (Sp1 family) binding site. The results confirm previous studies showing the importance of a number of promoter elements, including other MREs, in maintaining high basal promoter activity (for an example, see Ref. 15 ). Although, the basal transcriptional activities fell in these successive deletion constructs, the relative responses to hypoxia and zinc were maintained, including the smallest deleted promoter [phMT-IIA(-57)-Luc]. This -57-bp promoter fragment contains only the hMRE-a element upstream of the TATA box sequence (15) . To delineate a putative contribution of hMRE-a, a mutation was introduced into the 5'-core region of the hMRE-a element in phMT-IIA(-70)-Luc. This mutation eliminated both basal and inducible expression. These findings suggest a critical role for the hMT-IIA MRE-a in hypoxia and metal inducibility and in the maintenance of basal transcriptional rates.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Mapping of the hMT-IIA proximal promoter element involved in the transcriptional response to hypoxia. A, a schematic representation of the deletion analysis of the proximal promoter of the hMT-IIA gene. Mean Luc activities relative to hMT-IIA(-167)-Luc are shown for each construct. C2C12 cells were transfected with the indicated promoter-reporter constructs as described in "Materials and Methods." Promoter constructs containing successive deletion fragments from -167 to -57 (to 23) were generated by PCR and cloned into pGL2 (Promega); the hMRE-a mutant was constructed using pMT(-70)-Luc. B, after a recovery period of 24–48 h, cells were exposed to hypoxia or zinc for 12 and 6 h, respectively. Cells were harvested, and cell lysates were assayed for Luc activities. Reporter inductions were calculated as the ratio of normalized Luc activity in treated cells to that in control cells (see "Materials and Methods"). Data represent the means of at least three independent transfection assays for each construct; bars, SD.

 
mMT-I.
The proximal promoter of mMT-I contains four MREs, an Sp1 element, an overlapping USF/ARE, and a TATA box (Fig. 3A)Citation . A construct containing this promoter region truncated to -153/67 bp (relative to the transcription start site) inserted immediately upstream of a luciferase reporter gene (pGL2-Basic), pmMT-I(-153)-Luc, was induced 7.1 ± 2.1-fold by hypoxia and 12.1 ± 5.3-fold by zinc (Fig. 3B)Citation . To analyze the contributions of mMREs to the hypoxia inducibility of mMT-I, selected MRE monomers were inserted into pmMT-I(-42)-Luc. These included mMRE-d, a mutated (mut) mMRE-d, mMRE-c, and a consensus mMRE (mMRE-s), as described above. Because single-copy mMREs were poorly expressed in C2C12 cells (data not shown; see also Refs. 36 and 37 ), we used the cell line NIH3T3R in which endogenous MTs are strongly induced by both hypoxia and zinc.4 Fig. 3CCitation shows that both mMRE-d and mMRE-c conferred both hypoxia and zinc induction. A 3-bp mutation in the core region of the mMRE-d completely eliminated inducibility by both stresses. A consensus mMRE (mMRE-s), which lacks the GC-rich 5'-flanking sequence, was also responsive to hypoxia (Fig. 3C)Citation , implying that all of these mMREs may be capable of inducing transcription in response to hypoxia. Previous studies indicated that the composite USF/ARE (-100 to -89) mediated, in part, the response to H2O2 (22) . In contrast, deletion of the USF/ARE did not affect the hypoxia-responsiveness of the mMT-I promoter (Fig. 3B)Citation . However, this deletion did result in significant reductions in basal activities of the promoter by 10- to 20-fold (Fig. 3A)Citation , which is consistent with other studies (22) .



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Mapping of the mMT-I (and hMT-IIA) proximal promoter elements involved in hypoxia-associated responses. A, a schematic representation of the proximal promoter of the mMT-I gene and the Luc-based constructs used in this analysis of its hypoxia-responsive promoter region. Mean Luc activities relative to pMT-I(-153)-Luc are shown for each construct. B, the pMT-I(-153)-Luc, pmMT-I (153{Delta})-Luc, phMT-IIA(MRE-(a'5)-Luc, or pmMT-I(MRE-d'5)-Luc were transfected into C2C12 cells and treated as described in "Materials and Methods." C, the pMT-I(-153)-Luc and selected mMRE monomer sequences [ligated into pMT-I(-42)-Luc] were transfected into NIH3T3R cells as described in "Materials and Methods." The MRE monomer constructs included mMT-I MRE-d and its mutant form (mMRE-d mut), MRE-c, and a consensus mMRE that lacks an associated Sp1 homology sequence (mMRE-s). Transfectant cells were treated exactly as described in Fig. 2Citation , with the Luc activity in treated cells reported relative to that in the controls. Data represent the means of at least three independent transfection assays for each construct; bars, SD.

 
To further confirm the roles of the MREs as hypoxia-responsive elements, we inserted synthetic DNA fragments containing five copies of either hMRE-a or mMRE-d in tandem immediately upstream of pmMT-I(-42)-Luc (see "Materials and Methods"). Multiple copies were used to boost expression because other studies, including this report (see Fig. 2Citation ), have demonstrated enhanced activity of multiple compared with single elements in the response to metals (36 , 37) . Multiple copies of either hMRE-a or mMRE-d [phMT-IIA(MRE-a'5)-Luc or pmMT-I(MRE-d'5)-Luc], respectively) conferred significant hypoxia inducibility to the minimal mouse promoter, pMT-I(-42)-Luc, transfected into C2C12 cells. Hypoxia and zinc inductions were similar in mMRE-d'5 transfectants (~6-fold), whereas zinc activations were slightly higher in the hMRE-a'5 transfected cells (~7- and 4-fold, respectively; see Fig. 3BCitation ).

MT Regulation in Fibroblasts from MTF-1-/- dko7 Cells
The transient expression results implicate MREs in the activation of MT expression by hypoxia. To determine whether the MRE-binding transcription factor, MTF-1, is involved in this response, we analyzed the expression of mMT-I mRNA levels and of a transfected mMT-I promoter-reporter in MTF-1-/- cells (dko7) and wild-type MEFs. Fig. 4ACitation shows a representative study of the steady-state levels of mMT-1 mRNA transcripts from untreated, hypoxia-treated, and zinc-treated cells. The induction by zinc was abolished in the MTF-1-/- cells, and the induction by hypoxia was reduced by ~60% compared with that in normal MEFs. Absolute fold inductions were impossible to compute because the steady-state levels of mMT-I mRNA were undetectable. The residual hypoxia response must be due to other transcription factors or posttranscriptional mechanisms.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Induction of mMT-I mRNA and reporter constructs in aerobic and hypoxic MTF-1 knockout and wild-type MEFs. A, normal MEFs and MTF-1-- (dko7) fibroblasts were exposed to either hypoxia (<=0.1% O2) or ZnCl2 (100 µM) and lysed, and mMT-I mRNA levels were determined by Northern analysis. The membranes were reprobed with ß-actin. B, dko7 cells were transfected with either the hMT-IIA(-167)-Luc or pMT-I(-153)-Luc reporter constructs. To determine the effects of ectopic expression of the metal transcription factor MTF-1, varying amounts of the CMV-mMTF-1 vector (0–1 µg) were cotransfected with pmMT-I(-153)-Luc (1 µg) into the MTF-1-/- cells. After a 24-h recovery period, cells were exposed to hypoxia or zinc. Cells were lysed and assayed for Luc activity as described in Fig. 2Citation . Data represent the means of at least three independent assays; bars, SD.

 
Transient expression studies of the pmMT-I(-153)-Luc reporter constructs in MTF-1-/- cells are summarized in Fig. 4BCitation . The expression of luciferase was not significantly responsive to hypoxia or zinc. When pmMT-I(-153)-Luc was cotransfected with CMV-mMTF-1, the response to hypoxia or zinc treatment was restored. Specifically, a titration of pmMTF-1 (0–2.0 µg) indicated that Luc activities were increased ~3-fold by hypoxia and 9-fold by zinc at a concentration of 0.5 µg of CMV-mMTF-1. A reporter construct, containing a herpes simplex virus-thymidine kinase promoter and a Renilla luciferase, was cotransfected as an internal control and was not responsive to either hypoxia or zinc. These data confirm that MTF-1 plays a role in the response of MT genes to hypoxia.

Binding Studies
Electrophoretic mobility shift assays were used to confirm the presence of MTF-1 in C2C12 cells and to determine whether hypoxia affected MTF-1 binding activity. Nuclear extracts from zinc- and hypoxia-treated cells were analyzed using the hMRE-a from the hMT-IIA promoter (Fig. 5A)Citation and the consensus mMRE-s (Fig. 5, B and C)Citation . A specific hMRE-a-binding complex was detected in nuclear proteins from cells exposed to hypoxia for 8 or 24 h. Formation of complex M was suppressed by competition with unlabeled hMREa. Importantly, the formation of this complex was not competed by an oligonucleotide with a mutated hMRE sequence (hMRE-a mut; see "Materials and Methods") or by an oligonucleotide containing a consensus HIF-1 binding site.Fig. 5BCitation shows that the specific complex was induced within 2 h of exposure to hypoxia. In Fig. 5CCitation , the effect of MTF-1-specific antibody was tested. Anti-MTF-1 antisera treatment of hypoxic extracts (8 and 24 h) eliminated the low mobility complex but did not affect the higher mobility band (Fig. 5CCitation , NS). Similarly, anti-MTF-1 antibody suppressed the zinc-induced band and generated a supershift. Anti-Sp1-specific antibody did not affect the specific MRE-complexes (Fig. 5CCitation , Lane 5), whereas it strongly supershifted the low mobility complex that bound to an Sp1 consensus binding site (Fig. 5D)Citation . Therefore, Sp1 is probably not a component of the MRE-specific complex. It should be noted that the mobility of the MRE-specific protein-DNA complexes was identical in zinc-treated and hypoxic cells. However, the hypoxia-mediated increase in MTF-1 binding activity was considerably less than that detected in zinc-treated cells, and this may explain the inability to detect a supershift with the hypoxia-treated extracts (Fig. 5C)Citation . Fig. 5ECitation shows that HIF-1-specific binding was also induced in these cells within 2 h of exposure to hypoxia. In contrast to the MRE-specific complex, HIF-1 binding was activated by cobalt treatment but not by zinc. These results indicate that HIF-1 and MTF-1 are distinct factors that are both activated by hypoxia in C2C12 cells and with similar kinetics.



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Effects of hypoxia and metals on nuclear protein-DNA complexes. Comparison of the effects of hypoxic and zinc exposure on proteins binding to oligonucleotides containing core sequences corresponding to hMRE-a (A), mMRE-s (B and C), Sp1 (D), and HRE (HIF-1 binding site; E). Exposure of cells to metals or hypoxia, harvesting, nuclear extraction, probe sequences, and electrophoretic mobility shift analysis are described in "Materials and Methods." Zinc chloride (60 µM) and cobalt chloride (100 µM) were added to the cultures for the indicated time intervals. Competitor oligonucleotides (100-fold excess in A, Lanes 5–7; B, Lane 5; D, Lane 3; and E, Lane 7) or antisera (4 µg) were added to the extracts, and the mixtures were incubated for 1 h at 4°C before the addition of 32P-labeled oligonucleotides. Arrows, positions of MRE-specific (M) and nonspecific (NS) complexes, and SS refers to supershifted complexes. The binding of MTF-1, Sp 1, and HIF-1, respectively, to these elements has been described previously (18 , 35 , 61 62 63) .

 
DISCUSSION

These studies, which extend our previous findings, demonstrate that the major isoforms of the human and mouse MT family (hMT-IIA and mMT-I, respectively) are transcriptionally activated by hypoxia. Transient transfection studies using a series of constructs containing fragments of the hMT-IIA and mMT-I proximal promoters showed that hypoxia treatments caused transcriptional activations that are mediated by MREs within these promoters. DNA binding experiments, studies using MTF-1 knockout cells, and Northern analysis demonstrate the importance of MTF-1 for the transcriptional activation of MTs by hypoxia. In addition, these studies suggest that other transcription factors and/or posttranscriptional events are necessary for the full hypoxic response of MTs.

Deletion and mutational analyses of the hMT-IIA promoter demonstrated the requirement for an intact hMRE-a from the hMT-IIA promoter for both basal expression and induction by either hypoxia or zinc. MREs are highly conserved 13- to 15-bp sequences that contain a heptanucleotide core sequence TGC(A/G)CNC and a partially overlapping, less conserved GC-rich flanking region (15 , 16) . Mutation of the four 5' core nucleotides of the hMT-IIA MRE-a resulted in elimination of both basal and inducible (hypoxia and zinc) activities. This result is in agreement with a previous study demonstrating a critical role for the hMRE-a in basal and zinc-inducible expression of the human MT-IG isoform (16) . Our studies also confirm earlier studies (15) that more downstream elements (e.g., other MREs, Sp1, and AP1) within the proximal hMT-IIA promoter are essential for maintenance of high basal promoter activities. It is inferred that these promoter elements form a highly efficient and active enhanceosome(s) (38) with the MRE-a, allowing for maximum inductions of absolute transcription rates in response to inducers such as hypoxia and zinc.

In the functional analysis of the effects of hypoxia on the mMT-I promoter, we focused on mMRE-d and mMRE-c because previous studies have shown that the MRE-d of the mMT-I proximal promoter is involved in its regulation by zinc and oxidative stress (22) , and that both mMRE-d and mMRE-c are strongly footprinted by these treatments (21) . This present study extends these reports and now documents the involvement of the mMRE-d and mMRE-c in the hypoxia-associated regulation of mMT-I, suggesting a redox-sensitive characteristic of these MREs. Furthermore, transfection of a consensus mMRE, mMRE-s, clearly showed that other mMREs can contribute to the regulation of this promoter by hypoxia, indicating redundancy among these elements. These elements appear to constitute multifunctional response elements, which probably cooperate in regulating the mMT-I promoter (21 , 36 , 37 , 39) . This is further supported by the higher basal and stress-induced transcriptional activity levels of reporter constructs containing multiple copies of mMREs compared with a single copy of the element (~3–4-fold higher basal levels were observed in the multiple MREs containing plasmids compared with the single copy). It is also noteworthy that mMRE-s and mMRE-c, both of which lack any Sp1-like binding sites, remain responsive to hypoxia, suggesting that the Sp1 transcription factor is not directly involved in the activation of these elements by hypoxia. Similar to the human MT-IIA promoter, an active enhanceosome, involving elements including Sp1, may be critical for the maintenance of optimal basal and inducible activities. Indeed, sequences within the -100 to -89 bp of the mMT-I promoter are essential for high transcriptional activities (Fig. 3Citation ; see also Ref. 22 ).

Like hypoxia, the induction of mMT-I expression by oxidative stress and zinc is also mediated through MREs and is accompanied by rapid increased DNA-binding activity of MTF-1 (21 , 22) . Our MRE-binding studies showed that MTF-1 binding increased slightly within 2 h of the onset of hypoxia and remained active for at least 24 h. However, the changes in the binding intensities of MTF-1 were less than those induced by zinc and oxidative stress. Interestingly, the hypoxia-induced binding of MTF-1 is similar to that of cadmium, a powerful inducer of MT gene expression, which causes a relatively low increase in the amount of MTF-1 binding activity in cultured cells (40) , despite its essential role in the cadmium activation of mMT-I gene expression (2) . These results suggest that hypoxia and cadmium may activate MT gene expression by increasing the transactivation potential of MTF-1. This could be accomplished by interactions with coactivators (e.g., other transcription factors), removal of an inhibitor, and/or posttranslational modifications. An inhibitor of MTF-1 transactivation potential has been suggested (18 , 41) , and reversible phosphorylation of MTF-1 may modulate the activities of MTF-1. Previous studies have shown that protein kinases are activated by hypoxic stress and may be involved in signaling pathways that modulate gene expression (27 , 42 , 43) . We presently have no direct evidence that hypoxia mediates the phosphorylation of MTF-1, although activated Ras potentiates the induction of MTs by low oxygen.5 The ability of ectopic expression of mMTF-1 to restore hypoxia-associated induction of a transfected MT promoter in mMTF-1 deleted cells (Fig. 4B)Citation supports its role in the pathway(s) of activation of MTs by hypoxia. However, the induction of endogenous MT-I transcript levels by hypoxia was only partially blocked in the MTF-1-/- cells (Fig. 4A)Citation , indicating the involvement of other transcription factors and/or posttranscriptional regulation. This is also supported by our findings that MTF-1 ectopic expression in the MTF-1 knockout cells was unable to restore comparable inducibility of the mMT-I gene by hypoxia compared with zinc. One posttranscriptional mechanism implicated in the induction of specific mRNA accumulation in hypoxic cells is message stability (43, 44, 45, 46) . Our estimates of C2C12 MT-I mRNA half-lives indicated that these were in excess of 7 h for both aerobic controls and hypoxic cells with no discernible difference (data not shown). Therefore, changes in the mRNA accumulation probably do not contribute to the hypoxia-associated increases in MT-I mRNA.

Several hypoxia-responsive transcription factors from mammalian cells have been identified, including HIF-1 (47, 48, 49, 50) , nuclear factor-{kappa}B (51) , p53 (52 , 53) , c-Jun, and c-Fos (42 , 43 , 54) . In addition, the ARE has been shown to be responsive to hypoxia (55) . The heterodimeric complex of HIF-1, which binds to the hypoxia-sensitive HRE, is a ubiquitous hypoxia-sensitive transcription factor that regulates a variety of hypoxic stress genes (56) . Our data, including functional and binding studies, demonstrated that neither HIF-1 nor HREs are involved in the regulation of MTs by hypoxia. Furthermore, the AP1 site in the hMT-IIA promoter and the ARE in the mMT-I promoter do not appear to be directly activated by hypoxia but probably cooperate with other elements to maintain high basal and inducible promoter activities. Therefore, the MREs represent a stress response activated by both hypoxia and oxidative stress signals (21 , 22) and controlled, at least, by modulations of MTF-1.

Hypoxia is known to have roles in a number of physiological and pathophysiological processes, including erythroid development, angiogenesis, wound healing, cardiovascular-related diseases, and neoplasia. For example, many animal tumors contain a significant fraction of hypoxic cells that can cycle between hypoxic and reoxygenation states, and it is believed that these regions affect therapeutic responsiveness and malignant progression partially through increased synthesis of a set of hypoxic stress proteins (57 , 58) . As mentioned above, MT is both a hypoxic and an oxidative stress protein that contributes to the resistance of mammalian cells to reactive oxygen intermediates (generated by a variety of conditions including electrophilic and other antineoplastic drugs, radiation, and ischemia/reperfusion) and that may regulate both cellular proliferation and apoptotic pathways (5 , 9 , 59) . We further suggest that MTF-1 is a determinant of clinically important malignant phenotypes not only through redox control of MT expression but also through regulation of other target genes such as {gamma}-glutamylcysteine synthetase (13 , 60) . For example, enhanced GSH synthesis owing to MTF-1 activation in tumor microenvironments could complement or synergize with a mechanism of drug resistance involving overexpressed cellular sulfhydryl proteins such as MT.

ACKNOWLEDGMENTS

We acknowledge the assistance of R. J. Chin, A. M. Knapp, E. Watson, and S. Eklund.

FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by NIH Grants CA57692 (to B. J. M.), ES05704 (to G. K. A.), CA67166, Project 5 (to K. R. L.), and HL44578 (to K. A. W.) and by a grant from the Cigarette and Tobacco Surtax of the State of California through the Tobacco-Related Disease Research Program of the University of California, 1RT-402 (to K. A. W.). D. B. is supported by NIH postdoctoral fellowship NRSA: F32 ES05753. Back

2 To whom requests for reprints should be addressed, at Pharmaceutical Discovery, SRI International, Room LA257, 333 Ravenswood Avenue, Menlo Park, CA 94025. E-mail: bmurphy{at}unix.sri.com Back

3 The abbreviations used are: MT, metallothionein; MTF, metal transcription factor; hMT, human MT; mMT, mouse MT; MRE, metal response element; GSH, glutathione; ARE, antioxidant response element; USF, upstream stimulatory element; MEF, mouse embryo fibroblast; Luc, luciferase; HIF, hypoxia-inducible factor; HRE, hypoxia response element; CMV, cytomegalovirus. Back

4 B. J. Murphy and M. Yanovsky, unpublished results. Back

5 B. J. Murphy and M. Yanovsky, unpublished results. Back

Received 9/11/98. Accepted 1/14/99.

REFERENCES

  1. Andrews G. K. Regulation of metallothionein gene expression. Prog. Food Nutr. Sci., 14: 193-258, 1990.[Medline]
  2. Heuchel R., Radtke F., Georgiev O., Stark G., Aguet M., Schaffner W. The transcription factor MTF-1 is essential for basal and heavy metal-induced metallothionein gene expression. EMBO J., 13: 2870-2875, 1994.[Medline]
  3. Dalton T., Paria B. C., Fernando L. P., Huet-Hudson Y. M., Dey S. K., Andrews G. K. Activation of the chicken metallothionein promoter by metals and oxidative stress in cultured cells and transgenic mice. Comp. Biochem. Physiol., 116B: 75-86, 1997.
  4. Lazo J. S., Pitt B. R. Metallothioneins and cell death by anticancer drugs. Annu. Rev. Pharmacol. Toxicol., 35: 635-653, 1995.[Medline]
  5. Schwartz M. A., Lazo J. S., Yalowich W. P., Allen W. P., Whitmore M., Bergonia H. A., Tzeng E., Billiar T. R., Robbins P. D., Lancaster J. R. Metallothionein protects against the cytotoxic and DNA-damaging effects of nitric oxide. Proc. Natl. Acad. Sci. USA, 92: 4452-4456, 1995.[Abstract/Free Full Text]
  6. Studer R., Vogt C. P., Cavigelli M., Hunziker P. E., Kagi H. R. Metallothionein accretion in human hepatic cells is linked to cellular proliferation. Biochem. J., 328: 63-67, 1997.
  7. Nagel W. W., Vallee B. L. Cell cycle regulation of metallothionein in human colonic cancer cells. Proc. Natl. Acad. Sci. USA, 92: 579-583, 1995.[Abstract/Free Full Text]
  8. Abdel-Mageed A., Agrawal K. C. Antisense down-regulation of metallothionein induces growth arrest and apoptosis in human breast carcinoma cells. Cancer Gene Ther., 4: 199-207, 1997.[Medline]
  9. Kondo Y., Rusnak J. M., Hoyt D. G., Settineri C. E., Pitt B. R., Lazo J. S. Enhanced apoptosis in metallothionein null cells. Mol. Pharmacol., 52: 195-201, 1997.[Abstract/Free Full Text]
  10. Abdel-Mageed A. B., Agrawal K. C. Activation of nuclear factor {kappa} B: potential role in metallothionein-mediated mitogenic response. Cancer Res., 58: 2335-2338, 1998.[Abstract/Free Full Text]
  11. Jasani B., Schmid K. W. Significance of metallothionein overexpression in human tumors. Histopathology, 31: 211-214, 1997.[Medline]
  12. Moussa M., Kloth D., Peers G., Cherian M. G., Frei J. V., Chin J. L. Metallothionein expression in prostatic carcinoma: correlation with Gleason grade, pathologic stage, DNA content and serum level of prostate-specific antigen. Clin. Invest. Med., 20: 371-380, 1997.[Medline]
  13. Gunes C., Heuchel R., Georgiev O., Muller K. H., Lichtlen P., Bluthmann H., Marino S., Aguzzi A., Schaffner W. Embryonic lethality and liver degeneration in mice lacking the metal- responsive transcriptional activator MTF-1. EMBO J., 17: 2846-2854, 1998.[Medline]
  14. Meister A. Glutathione deficency produced by inhibition of its synthesis and its reversal: applications in research and therapy. Cancer Res., 54: 3082-3087, 1991.[Abstract/Free Full Text]
  15. Skroch P., Buchman C., Karin M. Regulation of human and yeast metallothionein gene transcription by heavy metal ions. Prog. Clin. Biol. Res., 380: 113-128, 1993.[Medline]
  16. Samson S. L-A., Paramchuk W. J., Shworak N. W., Gedamu L. Functional analysis of the human metallothionein-1G gene. J. Biol. Chem., 270: 25194-25199, 1995.[Abstract/Free Full Text]
  17. Murphy B. J., Laderoute K. R., Chin R. J., Sutherland R. M. Metallothionein IIA is up-regulated by hypoxia in human A431 squamous carcinoma cells. Cancer Res., 54: 5808-5810, 1994.[Abstract/Free Full Text]
  18. Radtke F., Heuchel R., Georgiev O., Hergersberg M., Gariglio M., Dembic Z., Schaffner W. Cloned transcription factor MTF-1 activates the mouse metallothionein I promoter. EMBO J., 12: 1355-1362, 1993.[Medline]
  19. Brugnera E., Georgiev O., Radtke F., Heuchel R., Baker E., Sutherland G. R., Schaffner W. Cloning, chromosomal mapping and characterization of the human metal-regulatory transcription factor MTF-1. Nucleic Acids Res., 22: 3167-3173, 1994.[Abstract/Free Full Text]
  20. Dalton T. P., Bittel D., Andrews G. K. Reversible activation of mouse metal response element-binding transcription factor 1 DNA binding involves zinc interaction with the zinc finger domain. Mol. Cell. Biol., 17: 2781-2789, 1997.[Abstract]
  21. Dalton T., Qingwen L., Bittel D., Liang L., Andrews G. K. Oxidative stress activates metal-responsive transcription factor-1 binding activity. J. Biol. Chem., 271: 26233-26241, 1996.[Abstract/Free Full Text]
  22. Dalton T., Palmiter R. D., Andrews G. K. Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements. Nucleic Acids Res., 22: 5016-5023, 1994.[Abstract/Free Full Text]
  23. Dalton T., Fu K., Palmiter R. D., Andrews G. K. Transgenic mice that overexpress metallothionein-I resist dietary zinc deficiency. J. Nutr., 126: 825-833, 1996.
  24. Kelly E. J., Sandgren E. P., Brinster R. L., Palmiter R. D. A pair of adjacent glucocorticoid response elements regulate expression of two mouse metallothionein genes. Proc. Natl. Acad. Sci. USA, 94: 10045-10050, 1997.[Abstract/Free Full Text]
  25. Vaupel P. W., Hockel M. Oxygenation status of human tumors: a reappraisal using computerized pO2 histography Vaupel P. W. Kelleher D. K. Gunderoth M. eds. . Funktionanalyze Biologischer Systeme. Tumor Oxygenation, : 219-232, Gustav Fischer Verlag Stuttgart, Jena, New York 1995.
  26. Webster K. A., Muscat G. E. O., Kedes L. Adenovirus E1A products suppress myogenic differentiation and inhibit transcription from muscle-specific promoters. Nature (Lond.), 332: 553-561, 1988.[Medline]
  27. Mazure N. M., Chen E. Y., Laderoute K. R., Giaccia A. J. Induction of vascular endothelial growth factor by hypoxia is modulated by a phosphatidylinositol 3-kinase/Akt signaling pathway in Ha-ras-transformed cells through a hypoxia inducible factor-1 transcriptional element. Blood, 90: 3322-3331, 1997.[Abstract/Free Full Text]
  28. Kondo Y., Woo E. S., Michalska A. E., Choo A., Lazo J. S. Metallothionein null cells have increased sensitivity to anticancer drugs. Cancer Res., 55: 2021-2023, 1995.[Abstract/Free Full Text]
  29. Laderoute K. R., Grant T. D., Murphy B. J., Sutherland R. M. Enhanced epidermal growth factor receptor synthesis in human squamous carcinoma cells exposed to low levels of oxygen. Int. J. Cancer, 52: 428-432, 1992.[Medline]
  30. Karin M., Richard R. I. Human metallothionein genes: primary structure of the metallothionein-II gene and a related processed gene. Nature (Lond.), 299: 797-802, 1982.[Medline]
  31. Gulick T. Transfection using DEAE-dextran. Curr. Protocols Mol. Biol., 1: 9.2.1-9.2.10, 1997.
  32. Ikeda E., Achen M. G., Breirer G., Risau W. Hypoxia-induced transcriptional activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. J. Biol. Chem., 270: 19761-19766, 1995.[Abstract/Free Full Text]
  33. Radtke F., Georgiev O., Muller H-P., Brugnera E., Schaffner W. Functional domains of the heavy metal-responsive transcription regulator MTF-1. Nucleic Acids Res., 23: 2277-2286, 1995.[Abstract/Free Full Text]
  34. Laderoute K. R., Webster K. A. Hypoxia/reoxygenation stimulates jun kinase activity through redox signaling in cardiac myocytes. Circ. Res., 80: 336-344, 1997.[Abstract/Free Full Text]
  35. Wu X., Bishopric N. H., Discher D. J., Murphy B. J., Webster K. W. Physical and functional sensitivity of zinc finger transcription factors to redox change. Mol. Cell. Biol., 16: 1035-1046, 1996.[Abstract]
  36. Culotta V. C., Hamer D. H. Fine mapping of a mouse metallothionein gene metal response element. Mol. Cell. Biol., 9: 1376-1380, 1989.[Abstract/Free Full Text]
  37. Stuart G. W., Searle P. F., Palmiter R. D. Identification of multiple metal regulatory elements in mouse metallothionein-I promoter by assaying synthetic sequences. Nature (Lond.), 317: 828-831, 1985.[Medline]
  38. Carey M. The enhanceosome and transcriptional synergy. Cell, 92: 5-8, 1998.[Medline]
  39. Aniskovitch L. P., Jacob S. T. Purification and characterization of a rat liver protein that recognizes CCAAT-homologous sequences of the metallothionein promoter and trans-activates this promoter. Arch. Biochem. Biophys., 341: 337-346, 1997.[Medline]
  40. Bittel D., Dalton T., Samson S. L-A., Gedamu L., Andrews G. K. The DNA-binding activity of MRE-binding transcription factor-1 is activated in vivo and in in vitro by Zn, but not by other transition metals. J. Biol. Chem., 273: 7127-7133, 1998.[Abstract/Free Full Text]
  41. Palmiter R. D. Regulation of metallothionein genes by heavy metals appears to be mediated by a zinc-sensitive inhibitor that interacts with a constitutively active transcription factor, MTF-1. Proc. Natl. Acad. Sci. USA, 91: 1219-1223, 1994.[Abstract/Free Full Text]
  42. Muller J. M., Krauss B., Kaltschmidt C., Baeuerle P. A., Rupec R. A. Hypoxia induces c-fos transcription via a mitogen-activated protein kinase-dependent pathway. J. Biol. Chem., 272: 23435-23439, 1997.[Abstract/Free Full Text]
  43. Ausserer W. A., Bourrat-Floeck B., Green C. J., Sutherland R. M. Regulation of c-jun expression during hypoxia and low glucose stress. Mol. Cell. Biol., 14: 5032-5042, 1994.[Abstract/Free Full Text]
  44. Claffey K. P., Shih S. C., Mullen A., Dziennis S., Cusick J. L., Abrams K. R., Lee S. W., Detmar M. Identification of a human VPF/VEGF 3' untranslated region mediating hypoxia-induced mRNA stability. Mol. Biol. Cell, 9: 469-481, 1998.[Abstract/Free Full Text]
  45. Webster K. A., Discher D. J., Bishopric N. H. Induction and nuclear accumulation of Fos and Jun proto-oncogenes in hypoxic cardiac myocytes. J. Biol. Chem., 268: 16852-16858, 1993.[Abstract/Free Full Text]
  46. Levy A. P., Levy N. S., Goldberg M. A. Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J. Biol. Chem., 271: 2746-2753, 1996.[Abstract/Free Full Text]
  47. Semenza G. L., Nejfelt M. K., Chi S. M., Antonarakis S. E. Hypoxia-inducible nuclear factors bind to an enhancer element located 3' to the human erythropoietin gene. Proc. Natl. Acad. Sci. USA, 88: 5680-5684, 1991.[Abstract/Free Full Text]
  48. Semenza G. L., Roth P. H., Fang H-M., Wang G. L. Transcriptional regulation of genes encoding glycolytic enzymes by hypoxia-inducible factor 1. J. Biol. Chem., 269: 23757-23763, 1994.[Abstract/Free Full Text]
  49. Pugh C. W., Tan C. C., Jones R. W., Ratcliffe P. J. Functional analysis of an oxygen-regulated transcriptional enhancer lying 3' to the mouse erythropoietin gene. Proc. Natl. Acad. Sci. USA, 88: 10553-10557, 1991.[Abstract/Free Full Text]
  50. Firth J. D., Ebert B. L., Pugh C. W., Ratcliffe P. J. Oxygen-regulated control elements in the phosphoglycerate kinase 1 and lactate dehydrogenase A genes: similarities with the erythropoietin 3' enhancer. Proc. Natl. Acad. Sci. USA, 91: 6496-6500, 1994.[Abstract/Free Full Text]
  51. Koong A. C., Chen E. Y., Giaccia A. J. Hypoxia causes the activation of NF-{kappa}B through the phosphorylation of I{kappa}B on tyrosine residues. Cancer Res., 54: 1-6, 1994.[Abstract/Free Full Text]
  52. Graeber T., Koong A. C., Giaccia A. J. Hypoxia induces the accumulation of p53 protein but the activation of a G1 phase checkpoint by low oxygen conditions is independent of p53 status. Mol. Cell. Biol., 14: 6264-6277, 1994.[Abstract/Free Full Text]
  53. Graeber T. G., Osmanian C., Jacks T., Housman D. E., Koch C. J., Lowe S. W., Giaccia A. J. Hypoxia-mediated selection of cells with diminished apoptotic potential in solid tumours. Nature (Lond.), 379: 88-91, 1996.[Medline]
  54. Yao K-S., Xanthoudakis S., Curran T., O’Dwyer P. J. Activation of AP-1 and of a nuclear redox factor, Ref-1, in the response of HT29 colon cancer cells to hypoxia. Mol. Cell. Biol., 14: 5997-6003, 1994.[Abstract/Free Full Text]
  55. Waleh N. S., Calaoagan J., Murphy B. J., Knapp A. M., Sutherland R. M., Laderoute K. L. The redox-sensitive human antioxidant responsive element induces gene expression under low oxygen conditions. Carcinogenesis (Lond.), 19: 1333-1337, 1998.[Abstract/Free Full Text]
  56. Iyer N. V., Kotch L. E., Agani F., Leung S. W., Laughner E., Wenger R. H., Gassmann J. D., Gearhart J. D., Lawler A. M., Yu A. Y. Cellular and developmental control of oxygen homeostasis by hypoxia-inducible factor 1{alpha}. Genes Dev., 12: 149-162, 1998.[Abstract/Free Full Text]
  57. Sutherland R. M., Ausserer W. A., Murphy B. J., Laderoute K. R. Tumor hypoxia and heterogeneity: challenges and opportunities for the future. Semin. Radiat. Oncol., 6: 59-70, 1996.[Medline]
  58. Giaccia A. J. Hypoxic stress proteins: survival of the fittest. Semin. Radiat. Oncol., 6: 46-58, 1996.[Medline]
  59. Schwartz M. A., Lazo J. S., Yalowich J. C., Reylonds I., Kagan V. E., Tyurin V., Kim T-M., Watkins S. C., Pitt B. R. Cytoplasmic metallothionein overexpression protects NIH3T3 cells from tert-butylhydroperxide toxicity. J. Biol. Chem., 269: 15238-15243, 1994.[Abstract/Free Full Text]
  60. O’Dwyer P. J., Yao K. S., Godwin A. K., Clayton M. Effects of hypoxia on detoxicating enzyme activity and expression in HT29 colon adenocarcinoma cells. Cancer Res., 54: 3082-3087, 1994.
  61. Semenza G. L., Wang G. L. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell. Biol., 12: 5447-5454, 1992.[Abstract/Free Full Text]
  62. Liu Y., Cox S. R., Motita T., Kourembanas S. Hypoxia regulates vascular endothelial growth factor gene expression in endothelial cells: identification of a 5' enhancer. Circ. Res., 77: 638-640, 1995.[Abstract/Free Full Text]
  63. Firth J. D., Ebert B. L., Ratcliffe P. J. Hypoxia regulation of lactate dehydrogenase A. Interaction between hypoxia-inducible factor 1 and cAMP response elements. J. Biol. Chem., 270: 21021-21027, 1995.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
U. Lindert, M. Cramer, M. Meuli, O. Georgiev, and W. Schaffner
Metal-Responsive Transcription Factor 1 (MTF-1) Activity Is Regulated by a Nonconventional Nuclear Localization Signal and a Metal-Responsive Transactivation Domain
Mol. Cell. Biol., December 1, 2009; 29(23): 6283 - 6293.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
X. Chen, H. Hua, K. Balamurugan, X. Kong, L. Zhang, G. N. George, O. Georgiev, W. Schaffner, and D. P. Giedroc
Copper sensing function of Drosophila metal-responsive transcription factor-1 is mediated by a tetranuclear Cu(I) cluster
Nucleic Acids Res., May 1, 2008; 36(9): 3128 - 3138.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. LaRochelle, S. Labbe, J.-F. Harrisson, C. Simard, V. Tremblay, G. St-Gelais, M. V. Govindan, and C. Seguin
Nuclear Factor-1 and Metal Transcription Factor-1 Synergistically Activate the Mouse Metallothionein-1 Gene in Response to Metal Ions
J. Biol. Chem., March 28, 2008; 283(13): 8190 - 8201.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
B. J. Murphy, T. Kimura, B. G. Sato, Y. Shi, and G. K. Andrews
Metallothionein Induction by Hypoxia Involves Cooperative Interactions between Metal-Responsive Transcription Factor-1 and Hypoxia-Inducible Transcription Factor-1{alpha}
Mol. Cancer Res., March 1, 2008; 6(3): 483 - 490.
[Abstract] [Full Text] [PDF]


Home page
Integr. Comp. Biol.Home page
D. Hoogewijs, N. B. Terwilliger, K. A. Webster, J. A. Powell-Coffman, S. Tokishita, H. Yamagata, T. Hankeln, T. Burmester, K. T. Rytkonen, M. Nikinmaa, et al.
From critters to cancers: bridging comparative and clinical research on oxygen sensing, HIF signaling, and adaptations towards hypoxia
Integr. Comp. Biol., October 1, 2007; 47(4): 552 - 577.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. D. Blais, C. L. Addison, R. Edge, T. Falls, H. Zhao, K. Wary, C. Koumenis, H. P. Harding, D. Ron, M. Holcik, et al.
Perk-Dependent Translational Regulation Promotes Tumor Cell Adaptation and Angiogenesis in Response to Hypoxic Stress
Mol. Cell. Biol., December 15, 2006; 26(24): 9517 - 9532.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. Li, T. Kimura, J. H. Laity, and G. K. Andrews
The Zinc-Sensing Mechanism of Mouse MTF-1 Involves Linker Peptides between the Zinc Fingers
Mol. Cell. Biol., August 1, 2006; 26(15): 5580 - 5587.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
P. A. Olsvik, T. Kristensen, R. Waagbo, K.-E. Tollefsen, B. O. Rosseland, and H. Toften
Effects of hypo- and hyperoxia on transcription levels of five stress genes and the glutathione system in liver of Atlantic cod Gadus morhua
J. Exp. Biol., August 1, 2006; 209(15): 2893 - 2901.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
S. C. Wesselkamper, S. A. McDowell, M. Medvedovic, T. P. Dalton, H. S. Deshmukh, M. A. Sartor, L. M. Case, L. N. Henning, M. T. Borchers, C. R. Tomlinson, et al.
The Role of Metallothionein in the Pathogenesis of Acute Lung Injury
Am. J. Respir. Cell Mol. Biol., January 1, 2006; 34(1): 73 - 82.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
U. Wimmer, Y. Wang, O. Georgiev, and W. Schaffner
Two major branches of anti-cadmium defense in the mouse: MTF-1/metallothioneins and glutathione
Nucleic Acids Res., October 12, 2005; 33(18): 5715 - 5727.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
A. Vengellur and J. J. LaPres
The Role of Hypoxia Inducible Factor 1{alpha} in Cobalt Chloride Induced Cell Death in Mouse Embryonic Fibroblasts
Toxicol. Sci., December 1, 2004; 82(2): 638 - 646.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
Z. A. HAROON, K. AMIN, P. LICHTLEN, B. SATO, N. T. HUYNH, Z. WANG, W. SCHAFFNER, and B. J. MURPHY
Loss of metal transcription factor-1 suppresses tumor growth through enhanced matrix deposition
FASEB J, August 1, 2004; 18(11): 1176 - 1184.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
D. Sanoudou, P. B. Kang, J. N. Haslett, M. Han, L. M. Kunkel, and A. H. Beggs
Transcriptional profile of postmortem skeletal muscle
Physiol Genomics, January 15, 2004; 16(2): 222 - 228.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. D. Kobayashi, J. M. Voyich, K. R. Braughton, A. R. Whitney, W. M. Nauseef, H. L. Malech, and F. R. DeLeo
Gene Expression Profiling Provides Insight into the Pathophysiology of Chronic Granulomatous Disease
J. Immunol., January 1, 2004; 172(1): 636 - 643.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Zhang, O. Georgiev, M. Hagmann, C. Gunes, M. Cramer, P. Faller, M. Vasak, and W. Schaffner
Activity of Metal-Responsive Transcription Factor 1 by Toxic Heavy Metals and H2O2 In Vitro Is Modulated by Metallothionein
Mol. Cell. Biol., December 1, 2003; 23(23): 8471 - 8485.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y. Azuma, S.-C. Chou, R. A. Lininger, B. J. Murphy, M. A. Varia, and J. A. Raleigh
Hypoxia and Differentiation in Squamous Cell Carcinomas of the Uterine Cervix: Pimonidazole and Involucrin
Clin. Cancer Res., October 15, 2003; 9(13): 4944 - 4952.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
K. A. Webster
Evolution of the coordinate regulation of glycolytic enzyme genes by hypoxia
J. Exp. Biol., September 1, 2003; 206(17): 2911 - 2922.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
T. E. English and K. B. Storey
Freezing and anoxia stresses induce expression of metallothionein in the foot muscle and hepatopancreas of the marine gastropod Littorina littorea
J. Exp. Biol., July 15, 2003; 206(14): 2517 - 2524.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Bernaudin, Y. Tang, M. Reilly, E. Petit, and F. R. Sharp
Brain Genomic Response following Hypoxia and Re-oxygenation in the Neonatal Rat. IDENTIFICATION OF GENES THAT MIGHT CONTRIBUTE TO HYPOXIA-INDUCED ISCHEMIC TOLERANCE
J. Biol. Chem., October 11, 2002; 277(42): 39728 - 39738.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. J. Daniels, D. Bittel, I. V. Smirnova, D. R. Winge, and G. K. Andrews
Mammalian metal response element-binding transcription factor-1 functions as a zinc sensor in yeast, but not as a sensor of cadmium or oxidative stress
Nucleic Acids Res., July 15, 2002; 30(14): 3130 - 3140.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Saydam, T. K. Adams, F. Steiner, W. Schaffner, and J. H. Freedman
Regulation of Metallothionein Transcription by the Metal-responsive Transcription Factor MTF-1. IDENTIFICATION OF SIGNAL TRANSDUCTION CASCADES THAT CONTROL METAL-INDUCIBLE TRANSCRIPTION
J. Biol. Chem., May 31, 2002; 277(23): 20438 - 20445.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Adilakshmi and R. O. Laine
Ribosomal Protein S25 mRNA Partners with MTF-1 and La to Provide a p53-mediated Mechanism for Survival or Death
J. Biol. Chem., February 1, 2002; 277(6): 4147 - 4151.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
R. Sharma, M. Sharma, P. K. Datta, and V. J. Savin
Induction of Metallothionein-I Protects Glomeruli from Superoxide-Mediated Increase in Albumin Permeability
Experimental Biology and Medicine, January 1, 2002; 227(1): 26 - 31.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. LaRochelle, V. Gagne, J. Charron, J.-W. Soh, and C. Seguin
Phosphorylation Is Involved in the Activation of Metal-regulatory Transcription Factor 1 in Response to Metal Ions
J. Biol. Chem., November 2, 2001; 276(45): 41879 - 41888.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. P. Giedroc, X. Chen, M. A. Pennella, and A. C. LiWang
Conformational Heterogeneity in the C-terminal Zinc Fingers of Human MTF-1. AN NMR AND ZINC-BINDING STUDY
J. Biol. Chem., November 2, 2001; 276(45): 42322 - 42332.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. Zhang, D. Egli, O. Georgiev, and W. Schaffner
The Drosophila Homolog of Mammalian Zinc Finger Factor MTF-1 Activates Transcription in Response to Heavy Metals
Mol. Cell. Biol., July 15, 2001; 21(14): 4505 - 4514.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
P. Lichtlen, Y. Wang, T. Belser, O. Georgiev, U. Certa, R. Sack, and W. Schaffner
Target gene search for the metal-responsive transcription factor MTF-1
Nucleic Acids Res., April 1, 2001; 29(7): 1514 - 1523.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. J. Green, P. Lichtlen, N. T. Huynh, M. Yanovsky, K. R. Laderoute, W. Schaffner, and B. J. Murphy
Placenta Growth Factor Gene Expression Is Induced by Hypoxia in Fibroblasts: A Central Role for Metal Transcription Factor-1
Cancer Res., March 1, 2001; 61(6): 2696 - 2703.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
M. v. L. Campagne, H. Thibodeaux, N. van Bruggen, B. Cairns, and D. G. Lowe
Increased Binding Activity at an Antioxidant-Responsive Element in the Metallothionein-1 Promoter and Rapid Induction of Metallothionein-1 and -2 in Response to Cerebral Ischemia and Reperfusion
J. Neurosci., July 15, 2000; 20(14): 5200 - 5207.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. V. Smirnova, D. C. Bittel, R. Ravindra, H. Jiang, and G. K. Andrews
Zinc and Cadmium Can Promote Rapid Nuclear Translocation of Metal Response Element-binding Transcription Factor-1
J. Biol. Chem., March 24, 2000; 275(13): 9377 - 9384.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Raleigh, S.-C. Chou, D. P. Calkins-Adams, C. A. Ballenger, D. B. Novotny, and M. A. Varia
A Clinical Study of Hypoxia and Metallothionein Protein Expression in Squamous Cell Carcinomas
Clin. Cancer Res., March 1, 2000; 6(3): 855 - 862.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
N. Saydam, O. Georgiev, M. Y. Nakano, U. F. Greber, and W. Schaffner
Nucleo-cytoplasmic Trafficking of Metal-regulatory Transcription Factor 1 Is Regulated by Diverse Stress Signals
J. Biol. Chem., June 29, 2001; 276(27): 25487 - 25495.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murphy, B. J.
Right arrow Articles by Webster, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murphy, B. J.
Right arrow Articles by Webster, K. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online