
[Cancer Research 59, 1428-1432, April 1, 1999]
© 1999 American Association for Cancer Research
[Cancer Research 59, 1428-1432, April 1, 1999]
© 1999 American Association for Cancer Research
Differential Transactivation by Alternative EWS-FLI1 Fusion Proteins Correlates with Clinical Heterogeneity in Ewings Sarcoma1
Patrick P. Lin,
Rachel I. Brody,
Aimée C. Hamelin,
James E. Bradner,
John H. Healey and
Marc Ladanyi2
Departments of Surgery [P. P. L., J. H. H.], Pathology [R. I. B., A. C. H., J. E. B., M. L.], and Human Genetics [M. L.], Memorial Sloan-Kettering Cancer Center, New York, New York 10021
 |
ABSTRACT
|
|---|
The t(11;22)(q24;q12) translocation is present in up to 95% of cases of Ewings sarcoma and results in the formation of an EWS-FLI1 fusion gene which encodes a chimeric transcription factor. The proximate role of EWS-FLI1 in the pathogenesis of Ewings sarcoma is thought to involve the activation of as yet largely unknown target genes. Many alternative forms of EWS-FLI1 exist because of variations in the locations of the EWS and FLI1 genomic breakpoints. The most common form, designated "type 1," consists of the first seven exons of EWS joined to exons 69 of FLI1 and accounts for approximately 60% of cases. The "type 2" EWS-FLI1 fusion also includes FLI1 exon 5 and is present in another 25%. We and others have observed previously that the type 1 fusion is associated with a significantly better prognosis than the other fusion types. Because EWS-FLI1 is an aberrant transcription factor, we investigated whether these differences in clinical behavior may be correlated to functional differences by comparing transactivation by the type 1 EWS-FLI1 with other types in both heterologous cells (HeLa, NIH3T3) and homologous cells (Ewings sarcoma cell lines). In a panel of seven Ewings sarcoma cell lines, we found transactivation of a transiently transfected FLI1-responsive reporter construct to be significantly lower in cell lines with the type 1 fusion than in cell lines with the type 2 fusion (P = 0.003). Cotransfection of the same reporter construct with each of a series of seven EWS-FLI1 expression constructs (corresponding to the two major fusion types and five less common types) also showed that type 1 EWS-FLI1 was a significantly weaker transactivator than the type 2 product in both HeLa and NIH3T3 cells (P = 0.003, and P = 0.033, respectively). Electromobility shift assays showed equivalent binding of the type 1 and type 2 EWS-FLI1 to the consensus FLI1-responsive binding site, indicating that differences in transactivation were not due simply to differences in DNA binding affinity. The finding that the type 1 EWS-FLI1 fusion, associated with less aggressive clinical behavior, encodes a less active chimeric transcription factor may provide the basis for a molecular explanation of clinical heterogeneity in Ewings sarcoma.
 |
Introduction
|
|---|
Ewings sarcoma is a primitive neuroectodermal tumor arising in bone or soft tissue, which strikes over 300 children and young adults in the United States annually. The t(11;22)(q24;q12) translocation is present in up to 95% of cases of Ewings sarcoma and results in the formation of the EWS-FLI1 fusion gene that encodes an oncogenic chimeric transcription factor (reviewed in Ref. 1
). EWS is a functional RNA-binding protein that, along with TLS and a novel TATA-binding protein-associated factor, TAFII68 (also known as RBP56), forms a new family of related proteins. Both TLS and EWS, but not EWS-FLI1, can function as TATA-binding protein-associated factors (2)
. Thus, EWS may mediate direct positive interactions of nascent transcripts with the basal transcription apparatus. However, the EWS portion of EWS-FLI1 may be redirected to other protein targets because of possible conformational changes induced by the gene fusion, as suggested by the recent demonstration of specific binding in vitro and in vivo of the EWS portion of EWS-FLI1but not of native EWSto hsRPB7, a subunit of RNA polymerase II (2
, 3)
. FLI1 encodes a member of the ETS family of transcription factors and seems to be involved in early hematopoietic, vascular, and neuroectodermal development in model organisms (4)
. The highly restricted tissue expression of FLI1 contrasts with that of native EWS, which is high and ubiquitous. Because of the genomic structure of the fusion, the EWS promoter drives the expression of EWS-FLI1.
In standard transactivation assays, the EWS-FLI1 chimeric transcription factor functions as a 5- to 10-fold stronger transactivator than native FLI1 at promoters containing binding sites for FLI1 (5)
. The sequences recognized by its DNA binding domain are indistinguishable from those recognized by native FLI1 (5)
. The oncogenicity of EWS-FLI1 may depend on a number of features, including constitutive, tissue-inappropriate, differentiation stage-inappropriate expression driven by the EWS promoter, the stronger transactivating potential of the EWS NH2-terminal domain, and its possible interaction with a different subset of coactivators. It is thus likely that the proximate effect of EWS-FLI1 is the deregulated activation of both FLI1 target genes as well as some genes whose expression is not normally regulated by FLI1.
Many alternative forms of EWS-FLI1 exist because of variations in the locations of the EWS and FLI1 genomic breakpoints (6)
. At least 12 types of in-frame EWS-FLI1 chimeric transcripts have been observed clinically. They contain different combinations of exons from EWS and FLI1, reflecting different combinations of EWS and FLI1 genomic breakpoints (6)
(Fig. 1)
. The two main types, fusion of EWS exon 7 to FLI1 exon 6 (type 1) and fusion of EWS exon 7 to FLI1 exon 5 (type 2), account for about 60 and 25%, respectively, of EWS-FLI1 fusions (6, 7, 8)
. Biologically significant alternative splicing of the EWS-FLI1 transcript is rarely detected (8)
; therefore, each tumor usually expresses only a single type of fusion transcript. The minimal components of each EWS-FLI1 fusion protein are the NH2-terminal domain of EWS (encoded by exons 17), which functions in vitro as a strong transactivation domain, and the intact DNA-binding domain of FLI1 (encoded by exon 9). The portion of the chimeric transcript between these two domains is variable in size and composition, and this heterogeneity is clinically significant.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 1. Structure of the EWS and FLI1 genes. The EWS-FLI1 fusion consists of the 5' end of the EWS gene and 3' end of the FLI1 gene with considerable combinatorial diversity of junctions (6)
. Arrowheads, the naturally occurring fusion sites in the chimeric transcript. The structure of EWS includes a transactivating domain, which is retained in EWS-FLI1, and an RNA binding domain, which is lost. The FLI1 gene encodes a NH2-terminal transactivating region (11)
(including a pointed domain encoded largely by exon 4), which is partially retained in some EWS-FLI1 fusions, and a COOH-terminal transactivating domain (CTA) (11)
. Exon 9 of the FLI1 gene encodes the highly conserved ETS-type DNA binding domain (DNA BD). The EWS and FLI1 transcripts are shown approximately to scale. Seven different naturally occurring forms of EWS-FLI1 were cloned into the mammalian expression vector pcDNA3.1. The first six pEF series comprise a set of internal deletions with progressive removal of exons 48 of FLI1.
|
|
Specifically, we and others have recently shown (7
, 8)
that the survival of patients whose Ewings sarcomas bear the type 1 EWS-FLI1 fusion is markedly better than those with tumors containing other fusion types, regardless of tumor site, stage, or size. The clinical impact may be substantial, and it is possible that patients with non-type 1 fusions may be candidates for more aggressive therapy such as bone marrow ablation and total body irradiation. Before such measures are actually implemented, it will be important to better understand the molecular mechanism by which such differences in survival may occur. However, functional studies of EWS-FLI1 have thus far exclusively examined transactivation by the type 1 fusion product. To determine whether the observed differences in clinical behavior are correlated with functional differences, we compared transactivation by different EWS-FLI1 fusion proteins by complementary approaches in homologous and heterologous cells. We found that the different EWS-FLI1 fusion proteins differ in their transactivation potential in a manner that seems to correlate with the clinical behavior of the associated tumors.
 |
Materials and Methods
|
|---|
Cloning of Alternative EWS-FLI1 cDNAs and Construction of Reporter Plasmids.
Seven different naturally occurring forms of EWS-FLI1 (Fig. 1)
were cloned into the mammalian expression vector pcDNA3.1 (Invitrogen), as follows. A pBluescript clone of the type 1 EWS-FLI1 fusion cDNA (gift of C. Denny, University of California at Los Angeles, Los Angeles, CA) was digested with NotI and HindIII, and the insert consisting of the full-length cDNA was then ligated into the NotI and HindIII sites of the pcDNA3.1(-) vector to produce the pEF7-6 clone. The clones pEF7-5 (type 2 fusion) and pEF10-6 were made by performing RT-PCR3
to obtain the junction site from clinical tumor samples, using primers flanking the junctional site and encompassing naturally occurring BamHI and EcoRI sites in EWS and FLI1, respectively. The EWS22.3Bam EWS exon 7 forward primer (CTGGATCCTACAGCCAAGCTCCAAG) and the FLI1C FLI1 exon 6 reverse primer (GTTGAGGCCAGAATTCATGTTA). The RT-PCR product was digested with BamHI and EcoRI, and this fragment was used to substitute for the corresponding junction fragment of pEF7-6. The pEF7-4, pEF7-7, pEF7-8, and pEF7-9 clones were generated artificially, because these fusion types are rare, and no suitable tumor samples were readily available (details of cloning strategy available upon request). The reporter plasmid pS2 was constructed by ligating a custom oligonucleotide that included one copy of a FLI1 consensus binding sequence ACCGGAAGT (5
, 9)
into the SacI and KpnI sites of pGL3-Promoter (Promega). All of the clones were verified by direct sequencing. The sequence ACCGGAAGT is known to be bound by both FLI1 and EWS-FLI1 in EMSAs and by FLI1 (EWS-FLI1 not previously tested) in transactivation assays (5
, 9)
. Two other sites, ACCGGAACT (pS1) (10)
and ACCGGAAACGGA (pS3) (4)
, both bound by FLI1 in EMSAs but not previously tested with EWS-FLI1 or in transactivation assays, were also tested in preliminary cotransfection experiments with pEF7-6 or pEF7-5 and were found to be less active in reporter constructs than the sequence ACCGGAAGT in pS2 (results not shown).
Transfection and Cell Culture.
HeLa and NIH3T3 cells were seeded (separately) in 12-well plates at a density of 0.5 x 105 cells and allowed to grow for 18 h before transfection. Cells were washed once with serum-free medium, and a mixture containing 5 µl of Lipofectamine (Life Technologies, Inc.) and 1.5 µg of DNA in 0.5 ml of Opti-MEM (Life Technologies, Inc.) was overlaid on the cells. The DNA mixture included 1.0 µg of a EWS-FLI1-containing pEF series plasmid or pcDNA3.1 (as control empty expression plasmid), 0.25 µg of reporter plasmid pS2 or pGL3-Promoter (as reporter control), and 0.25 µg of the Dual Luciferase system (Promega) transfection control plasmid pTKRL. The cells remained serum-free for 5 h, and then serum was added. Cells were harvested at 48 h. For Ewings sarcoma cell lines, the procedure was modified because these cells were more sensitive to the transfection procedure. The cell lines with a type 1 EWS-FLI1 fusion included SK-PN-DW, TC32, A673, and SK-ES-17. The cell lines carrying a type 2 fusion included SK-ES-1, RD-ES, and 6647. The fusion types were reverified by RT-PCR, using the EWS22.3Bam and FLI1C primers. Cells were seeded in 12-well plates at a density of 1.5 x 105 cells and allowed to grow for 24 h. They were washed once with serum-free media and overlaid with a mixture containing 4 µl of Lipofectamine and 1.0 µg of DNA in 0.5 ml of Opti-MEM. The DNA mix included 0.5 µg of reporter plasmid (pS2 or pGL3-Promoter) and 0.5 µg of pTKRL. Serum was added at 2 h, and cells were harvested at 48 h. For the NIH3T3, HeLa, and Ewings sarcoma cell lines, transfection cultures were done in triplicate for each condition, and experiments were repeated four times.
Luciferase Reporter Assay.
The Dual-Luciferase assay with firefly luciferase as reporter (based on pGL3-Promoter plasmid) followed by renilla luciferase as transfection control (pTKRL plasmid) was performed according to the manufacturers instructions (Promega). Cells were lysed in 200 µl of passive lysis buffer, and 10 µl of the sample was used for luciferase assays. Light readings were made in a luminometer (Turner). The fold transactivation was the ratio of luciferase activity in experimental cultures compared with control cultures. For HeLa and NIH3T3 cells, control cultures were cotransfected with empty pcDNA3.1 expression plasmid, pS2, and the pTKRL transfection control plasmid. For Ewings sarcoma cell lines, the control cultures were transfected with unmodified pGL3-Promoter plasmid and pTKRL. The results of the transfection experiments were combined and entered into the SPSS 7.5 statistical software package. Students t test was used to compare means of luciferase assays and fold-transactivation.
EMSA.
The TNT coupled reticulocyte lysate system (Promega) was used to produce EWS-FLI1 protein. Briefly, starting with 1 µg of plasmid DNA, in vitro transcription with the T7 RNA polymerase was followed by in vitro translation with a rabbit reticulocyte lysate. The EWS-FLI1 protein was preincubated in the following buffer for 10 min at room temperature: 4% glycerol, 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCl (pH 7.5), 50 µg/ml poly dI-dC. Labeled olignocleotide was added to the mix and incubated for 20 min at room temperature. The oligonucleotide GTATGGGTACCGGAAGTGAGCTCGTTAAG was end-labeled with [
32P]ATP and T4 kinase. The protein-DNA mix was applied to a 4% nondenaturing acrylamide TBE (Tris-boric acid-EDTA) gel. Autoradiographs were exposed for 2448 h at -70°C. Controls included the addition of a 10-fold excess of unlabeled identical or unrelated oligonucleotide during the preincubation step.
 |
Results
|
|---|
Comparison of Transactivation by Alternative forms of EWS-FLI1.
Seven different expression constructs containing full-length cDNAs of alternative forms of EWS-FLI1 (Fig. 1)
were cotransfected with a FLI1-responsive luciferase reporter plasmid into two heterologous cell lines, HeLa (human cervical carcinoma) and NIH3T3 (mouse fibroblast). The expression constructs, all of which were based on the same vector (pcDNA3.1), included pEF7-6 (type 1 fusion), pEF7-5 (type 2 fusion), pEF10-6, pEF7-4, pEF7-7, pEF7-8, and pEF7-9 (Fig. 1)
. All of these correspond to naturally occurring in-frame EWS-FLI1 fusion transcripts clinically observed in Ewings sarcomas (6, 7, 8)
. The luciferase reporter plasmid pS2 contained the FLI1 binding sequence ACCGGAAGT, known to be bound by both FLI1 and EWS-FLI1 in EMSAs and by FLI1 in transactivation assays (5
, 9)
. Our present results confirm its responsiveness to EWS-FLI1 in transactivation assays. Specifically, in HeLa cells, the type 1 EWS-FLI1 was a significantly weaker transactivator than EWS-FLI1 type 2 (P = 0.003) and the other less common EWS-FLI1 types tested (Fig. 2)
. Transactivation by the type 2 product was approximately 50% higher than with type 1 EWS-FLI1. Progressive absence of the portion encoded by FLI1 exons 4 through 8 seemed to have a bimodal effect on transactivation, with the lack of exons 4 and 5 resulting in decreased activity, reaching an apparent nadir with the type 1 (construct 7-6) fusion, and with transactivation increasing with further losses corresponding to FLI1 exons 7 and 8. An essentially identical pattern of transactivation was obtained in NIH3T3 cells, with the type 1 (construct 7-6) fusion showing the lowest activity, significantly lower than type 2 (P = 0.033; data not shown).

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 2. Transactivation of the pS2 reporter in HeLa cells. The pEF series of constructs corresponding to different variants of EWS-FLI1 cloned into pcDNA3.1 were cotransfected with pS2 into HeLa cells. fold transactivation, the increase in firefly luciferase activity above that of control cultures transfected with the empty pcDNA3.1 expression vector. The amount of transactivation was significantly less for type 1 compared with all of the other types (P = 0.003 for type 1 compared with type 2). Bars, SE for four independent triplicate experiments. Lower panel, confirmatory restriction digests of 0.5 µg of each pEF series plasmid with NotI and HindIII that excise the full-length EWS-FLI1 cDNA insert. An essentially identical pattern of transactivation was obtained using NIH3T3 cells in the same experiment (see "Results").
|
|
Comparison of Transactivation of an Exogenous FLI1 Reporter in Ewings Sarcoma Cell Lines with Type 1 or Type 2 EWS-FLI1.
As a complementary approach, we also studied transactivation in Ewings sarcoma cell lines carrying either the type 1 or type 2 fusion. Because individual tumor cell lines may display idiosyncratic differences in the expression of other closely related ETS-family transcription factors or of as yet uncharacterized cofactors involved in EWS-FLI1-mediated transactivation, we analyzed statistically the results from multiple cell lines with either the type 1 or type 2 EWS-FLI1 fusion. The cell lines were transfected with the same reporter plasmid (pS2) used in the cotransfections in heterologous cells described above. Transactivation of the transiently transfected reporter was found to be approximately 50% greater in Ewings sarcoma cell lines carrying the type 2 fusion (P = 0.003; Fig. 3
). Thus, the findings in Ewings sarcoma cell lines were entirely consistent with the data from the cotransfections in HeLa and NIH3T3.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 3. Transactivation of the pS2 reporter in Ewings sarcoma cell lines containing either the type 1 or the type 2 EWS-FLI1 fusion. The fold transactivation was defined as the fold increase in luciferase activity in cultures that were transfected with EWS-FLI1-containing expression constructs compared with cultures transfected with the empty pGL3-Promoter vector. Bars, SE for four independent triplicate experiments. Lower panel, RT-PCR with primers spanning the chimeric transcript junction site was used to verify the fusion types. The expected sizes of the RT-PCR products with the primers used (see "Materials and Methods") are 125 bp for type 1 and 191 bp for type 2. The cell lines include: (1) A673; (2) TC32; (3) SK-ES-17; (4) RD-ES; (5) SK-ES-1; and (6) 6647. (SK-PN-DW is not shown).
|
|
EMSAs.
To test the possibility that the lower transactivation mediated by the type 1 fusion was due to lower DNA binding affinity, we performed electromobility shift assays. In vitro translated type 1 and 2 EWS-FLI1 were bound to an end-labeled oligonucleotide containing the same ACCGGAAGT FLI1 binding sequence used in reporter plasmid pS2 described above. The assay demonstrated equivalent binding of the oligonucleotide by the type 1 and the type 2 fusion EWS-FLI1 proteins (Fig. 4)
. Thus, the differences in transactivation between the two major forms of EWS-FLI1 observed in HeLa, NIH3T3, and Ewings sarcoma cell lines do not seem to be due to gross differences in the ability to recognize and bind the FLI1 binding site sequence used in the reporter constructs.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 4. Electromobility shift assay showing equivalent binding of the type 1 and type 2 EWS-FLI1 fusion proteins to the pS2 reporter sequence. EWS-FLI1 was produced by in vitro transcription using the T7 RNA polymerase and in vitro translation with a rabbit reticulocyte extract. It was bound to a labeled oligonucleotide containing the FLI1 consensus binding sequence ACCGGAAGT. Nondenaturing PAGE demonstrates a supershifted band (arrow). Note that the band for the type 2 fusion migrates slightly slower than the type 1 fusion because the type 2 protein is slightly larger. Binding of the protein to label is specific and can be competitively abolished by a 10-fold excess of unlabeled oligonucleotide. Unbound labeled oligonucleotide is seen at the bottom of the gel. A 10-fold excess of an unrelated cold oligonucleotide containing the serum response element did not affect the binding of label to DNA (not shown). The blot shown is representative of triplicate experiments with essentially identical results.
|
|
 |
Discussion
|
|---|
Our results suggest that there are demonstrable functional differences between alternative forms of EWS-FLI1. The clinically observed EWS-FLI1 types studied in our experiments constitute a series of six progressive "internal deletions" corresponding to individual exons in the portion contributed by FLI1, namely fusions 7-4 through 7-9 (Fig. 1)
. We found in cotransfection assays in both HeLa and NIH3T3 cells that loss of the portion correponding to FLI1 exons 4 and 5 reduced transactivation. This is in keeping with studies of native FLI1 that have shown that these exons encode most of the NH2-terminal transactivation domain of FLI1 (a pointed domain) (11)
. Our results indicate that the inclusion of this portion of the FLI1 transactivation domain is functionally significant even when juxtaposed to the stronger EWS transactivation domain.
We also found that further loss of the portion encoded by FLI1 exon 6 seemed to restore transactivation to a level equivalent to EWS-FLI1 type 2, which suggested the presence of an inhibitory domain encoded by this exon. This inhibitory effect does not seem to operate by reducing DNA binding affinity inasmuch as the binding of type 1 and type 2 EWS-FLI1 to the FLI1 binding site of the pS2 reporter was equivalent in EMSAs (Fig. 4)
. Thus, the inhibitory effect of the portion encoded by FLI1 exon 6 may be mediated by protein-protein interactions, either intramolecular or involving other transcriptional proteins. A similarly positioned region in several other ETS proteins has been implicated in intramolecular inhibition (12)
, but the corresponding portion of FLI1 (exons 58) shows no homology (11)
. More recently, it has been demonstrated that the closely related ERG transcription factor, which fuses with EWS in 5% of cases of Ewings sarcoma (6
, 13)
, forms homo- and heterodimers through the pointed domain and the ETS domain, and that a central domain, corresponding to exons 6 to 8, may inhibit both dimerization and transactivation (14)
. A similar analysis of FLI1 is not available, although its pointed domain, ETS domain, and the portion of the central domain encoded by exon 8 are all identical or highly homologous to ERG, and FLI1 is one of the ETS proteins capable of heterodimerizing with ERG (14)
. Hypothetically, the absence of FLI1 exon 6-encoded sequences in EWS-FLI1 could be sufficient to inactivate a similar putative inhibitory domain in FLI1. Other protein-protein interactions have been mapped to this region of FLI1. Specifically, a domain encoded by exons 6 and 7 interacts with serum response factor at serum response elements flanked by ETS-binding sites (15, 16, 17)
.
Our cotransfection studies in HeLa and NIH3T3 cells also included EWS-FLI1 type 10-6, thereby providing the first data on the contribution of the portion encoded by EWS exons 810 to EWS-FLI1 function. In both cell types, pEF10-6 was a significantly stronger transactivator than pEF7-6, suggesting that the inclusion of a domain encoded within EWS exons 8, 9, and 10 may enhance transactivation by the NH2-terminal domain of EWS (or may abrogate the apparent inhibitory effect of the central portion of FLI1 corresponding to exon 6). Previous studies of transactivation by the NH2-terminal domain of EWS in the context of EWS-FLI1 have only examined the region encoded by exons 17. Within the EWS-ATF1 translocation product of clear cell sarcoma, however, the inclusion of EWS exon 8 contributes significantly to transactivation (18)
. EWS exon 8 also contains a domain that mediates interaction with calmodulin, and phosphorylation at this site by protein kinase C inhibits RNA binding by native EWS (19)
. Thus, calmodulin binding or phosphorylation could also affect the function of EWS-FLI1 fusions containing EWS exon 8.
Alternately, the possible impact of pairing with different portions of FLI1 on the conformation of the EWS NH2-terminal domain could alter, qualitatively or quantitatively, the interactions of the latter with relevant proteins, such as the hsRPB7 subunit of RNA polymerase II (2
, 3)
or the ZFM1 transcriptional repressor (20)
.
It may seem paradoxical that the type 1 EWS-FLI1 fusion product is the least effective transactivator but is the form of EWS-FLI1 observed in the majority of Ewings sarcomas. Although the type 1 fusion protein may be less functionally active than other fusion types, it seems clinically sufficient for transformation. A recent detailed analysis of EWS and FLI1 genomic breakpoints in Ewings sarcoma cell lines failed to identify putative recombinogenic sequence elements in the rearranged introns, suggesting that the frequency of different EWS-FLI1 fusion types may be partly determined by the sizes of the introns in which the genomic breaks occur after selection for a functional chimeric protein (21)
. Within the FLI1 breakpoint cluster region, breaks producing the two most common forms of EWS-FLI1, type 1 and type 2, involve the largest and second largest introns of FLI1, respectively. Intriguingly, however, in relation to intron size, the density of breakpoints in FLI1 intron 4 (associated with the type 2 fusion) was 3-fold higher than in FLI1 intron 5 (associated with the type 1 fusion) (21)
, which suggests the possibility of a slight in vivo or in vitro selective advantage for tumors with the type 2 fusion.
In summary, the variably included regions of EWS-FLI1 seem to determine functional differences that correlate closely with significant clinical heterogeneity in Ewings sarcoma. Specifically, type 1 EWS-FLI1 is less effective in transactivation assays, and may, therefore, be less effective in activating critical target genes. These are just beginning to be identified (22
, 23)
; the forthcoming characterization of the enhancer elements of these actual in vivo targets of EWS-FLI1 should provide reagents to address experimentally one of the caveats of the present study, namely that the reporter element used was synthetic and had been primarily defined by its interaction with native FLI1 in vitro or in model in vivo assays. The functional comparison of the different alternative EWS-FLI1 types using clinically relevant targets will also be important to begin to link mechanistically the moderate (2-fold) differences in transactivation potential demonstrated in the present study to the clinical biology of Ewings sarcoma. Nonetheless, our results may provide the first data toward a molecular explanation of the clinical association of the type 1 fusion with better patient survival, compared with other fusion types.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Christopher Denny (University of California at Los Angeles, Los Angeles, CA) for the original type 1 clone of EWS-FLI1, Suresh Jhanwar (Memorial Sloan-Kettering Cancer Center, New York, NY) and Poul Sorensen (British Columbia Childrens Hospital, Vancouver, Canada) for providing some of the Ewings sarcoma cell lines, and Pier Paolo Pandolfi (Memorial Sloan-Kettering Cancer Center) for the use of luminometer.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by the Byrne Fund (to M. L.). In addition, fellowship support was provided by NIH T32-CA60376 (for R. I. B.), and J. E. B. was a visiting medical student from the University of Chicago-Pritzker School of Medicine sponsored by the NIH Cancer Education Program. 
2 To whom requests for reprints should be addressed, at at Department of Pathology, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. 
3 The abbreviations used are: RT-PCR, reverse transcription PCR; EMSA, electrophoretic mobility shift assay. 
Received 11/19/98.
Accepted 2/15/99.
 |
REFERENCES
|
|---|
-
Kovar H. Progress in the molecular biology of Ewing tumors. Sarcoma, 2: 3-17, 1998.
-
Bertolotti A., Melot T., Acker J., Vigneron M., Delattre O., Tora L. EWS, but not EWS-FLI-1, is associated with both TFIID and RNA polymerase II: interactions between two members of the TET family, EWS and hTAFII 68: and subunits of TFIID and RNA polymerase II complexes. Mol. Cell Biol., 18: 1489-1497, 1998.[Abstract/Free Full Text]
-
Petermann R., Mossier B., Aryee D., Khazak V., Golemis E., Kovar H. Oncogenic EWS-Fli1 interacts with hsRPB7, a subunit of human RNA polymerase II. Oncogene, 17: 603-610, 1998.[Medline]
-
Remy P., Senan F., Meyer D., Mager A. M., Hindelang C. Overexpression of the xenopus xl-fli gene during early embryogenesis leads to anomalies in head and heart development and erythroid differentiation. Int. J. Dev. Biol., 40: 577-589, 1996.[Medline]
-
Mao X., Miesfeldt S., Yang H., Leiden J. M., Thompson C. B. The FLI-1 and chimeric EWS-FLI-1 oncoproteins display similar DNA binding specificities. J. Biol. Chem., 269: 18216-18222, 1994.[Abstract/Free Full Text]
-
Zucman J., Melot T., Desmaze C., Ghysdael J., Plougastel B., Peter M., Zucker J. M., Triche T. J., Sheer D., Turc-Carel C., Ambros P., Combaret V., Lenoir G., Aurias A., Thomas G., Delattre O. Combinatorial generation of variable fusion proteins in the Ewing family of tumours. EMBO J., 12: 4481-4487, 1993.[Medline]
-
Zoubek A., Dockhorn-Dworniczak B., Delattre O., Christiansen H., Niggli F., Gatterer-Menz I., Smith T. L., Jurgens H., Gadner H., Kovar H. Does expression of different EWS chimeric transcripts define clinically distinct risk groups of Ewing tumor patients?. J. Clin. Oncol., 14: 1245-1251, 1996.[Abstract/Free Full Text]
-
de Alava E., Kawai A., Healey J. H., Fligman I., Meyers P., Huvos A. G., Gerald W. L., Jhanwar S. C., Argani P., Antonescu C. R., Pardo-Mindan F. J., Ginsberg J., Womer R., Lawlor E. R., Wunder J., Andrulis I., Sorensen P. H. B., Barr F. G., Ladanyi M. EWS-FLI1 fusion transcript structure is an independent determinant of prognosis in Ewings sarcoma. J. Clin. Oncol., 16: 1248-1255, 1998.[Abstract/Free Full Text]
-
Zhang L., Lemarchandel V., Romeo P. H., Ben-David Y., Greer P., Bernstein A. The FLI-1 proto-oncogene, involved in erythroleukemia and Ewings sarcoma, encodes a transcriptional activator with DNA-binding specificities distinct from other ETS family members. Oncogene, 8: 1621-1630, 1993.[Medline]
-
Klemsz M. J., Maki R. A., Papayannopoulou T., Moore J., Hromas R. Characterization of the ETS oncogene family member, FLI-1. J. Biol. Chem., 268: 5769-5773, 1993.[Abstract/Free Full Text]
-
Rao V. N., Ohno T., Prasad D. D., Bhattacharya G., Reddy E. S. Analysis of the DNA-binding and transcriptional activation functions of human FLI-1 protein. Oncogene, 8: 2167-2173, 1993.[Medline]
-
Sharrocks A. D., Brown A. L., Ling Y., Yates P. R. The ETS-domain transcription factor family. Int. J. Biochem. Cell Biol., 29: 1371-1387, 1997.[Medline]
-
Sorensen P. H. B., Lessnick S. L., Lopez-Terrada D., Liu X. F., Triche T. J., Denny C. T. A second Ewings sarcoma translocation, t(21;22), fuses the EWS gene to another ets-family transcription factor, ERG. Nat. Genet., 6: 146-151, 1994.[Medline]
-
Carrere S., Verger A., Flourens A., Stehelin D., Duterque-Coquillaud M. Erg proteins, transcription factors of the Ets family, form homo, heterodimers and ternary complexes via two distinct domains. Oncogene, 16: 3261-3268, 1998.[Medline]
-
Watson D. K., Robinson L., Hodge D. R., Kola I., Papas T. S., Seth A. FLI1 and EWS-FLI1 function as ternary complex factors and ELK1 and SAP1A function as ternary and quaternary complex factors on the EGR1 promoter serum response elements. Oncogene, 14: 213-221, 1997.[Medline]
-
Magnaghi-Jaulin L., Masutani H., Robin P., Lipinski M., Harel-Bellan A. SRE elements are binding sites for the fusion protein EWS-FLI-1. Nucleic Acids Res., 24: 1052-1058, 1996.[Abstract/Free Full Text]
-
Ling Y., West A. G., Roberts E. C., Lakey J. H., Sharrocks A. D. Interaction of transcription factors with serum response factor. Identification of the Elk-1 binding surface. J. Biol. Chem., 273: 10506-10514, 1998.[Abstract/Free Full Text]
-
Pan S., Ming K. Y., Dunn T. A., Li K. K., Lee K. A. The EWS/ATF1 fusion protein contains a dispersed activation domain that functions directly. Oncogene, 16: 1625-1631, 1998.[Medline]
-
Deloulme J. C., Prichard L., Delattre O., Storm D. R. The prooncoprotein EWS binds calmodulin and is phosphorylated by protein kinase C through an IQ domain. J. Biol. Chem., 272: 27369-27377, 1997.[Abstract/Free Full Text]
-
Zhang D., Paley A. J., Childs G. The transcriptional repressor ZFM1 interacts with and modulates the ability of EWS to activate transcription. J. Biol. Chem., 273: 18086-18091, 1998.[Abstract/Free Full Text]
-
Zucman-Rossi J., Legoix P., Victor J. M., Lopez B., Thomas G. Chromosome translocation based on illegitimate recombination in human tumors. Proc. Natl. Acad. Sci. USA, 95: 11786-11791, 1998.[Abstract/Free Full Text]
-
May W. A., Arvand A., Thompson A. D., Braun B. S., Wright M., Denny C. T. EWS/FLI1-induced manic fringe renders NIH 3T3 cells tumorigenic. Nat. Genet., 17: 495-497, 1997.[Medline]
-
Arvand A., Bastians H., Welford S. M., Thompson A. D., Ruderman J. V., Denny C. T. EWS/FLI1 up-regulates mE2-C, a cyclin-selective ubiquitin conjugating enzyme involved in cyclin B destruction. Oncogene, 17: 2039-2045, 1998.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
Y. Miyagawa, H. Okita, H. Nakaijima, Y. Horiuchi, B. Sato, T. Taguchi, M. Toyoda, Y. U. Katagiri, J. Fujimoto, J.-i. Hata, et al.
Inducible Expression of Chimeric EWS/ETS Proteins Confers Ewing's Family Tumor-Like Phenotypes to Human Mesenchymal Progenitor Cells
Mol. Cell. Biol.,
April 1, 2008;
28(7):
2125 - 2137.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
O. Slater and J. Shipley
Clinical relevance of molecular genetics to paediatric sarcomas
J. Clin. Pathol.,
November 1, 2007;
60(11):
1187 - 1194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Iwamoto
Diagnosis and Treatment of Ewing's Sarcoma
Jpn. J. Clin. Oncol.,
February 1, 2007;
37(2):
79 - 89.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Riggi, L. Cironi, P. Provero, M.-L. Suva, K. Kaloulis, C. Garcia-Echeverria, F. Hoffmann, A. Trumpp, and I. Stamenkovic
Development of Ewing's Sarcoma from Primary Bone Marrow-Derived Mesenchymal Progenitor Cells
Cancer Res.,
December 15, 2005;
65(24):
11459 - 11468.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Huang, P. B. Illei, Z. Zhao, M. Mazumdar, A. G. Huvos, J. H. Healey, L. H. Wexler, R. Gorlick, P. Meyers, and M. Ladanyi
Ewing Sarcomas With p53 Mutation or p16/p14ARF Homozygous Deletion: A Highly Lethal Subset Associated With Poor Chemoresponse
J. Clin. Oncol.,
January 20, 2005;
23(3):
548 - 558.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-C. Chang and V. B. Shidham
Molecular Genetics of Pediatric Soft Tissue Tumors: Clinical Application
J. Mol. Diagn.,
August 1, 2003;
5(3):
143 - 154.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S A Burchill
Ewing's sarcoma: diagnostic, prognostic, and therapeutic implications of molecular abnormalities
J. Clin. Pathol.,
February 1, 2003;
56(2):
96 - 102.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Ozaki, K.-L. Schaefer, D. Wai, R. Yokoyama, S. Ahrens, R. Diallo, T. Hasegawa, T. Shimoda, S. Hirohashi, A. Kawai, et al.
Population-based genetic alterations in Ewing's tumors from Japanese and European Caucasian patients
Ann. Onc.,
October 1, 2002;
13(10):
1656 - 1664.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Hosaka, Y. Nakashima, K. Kusuzaki, H. Murata, T. Nakayama, T. Nakamata, T. Aoyama, T. Okamoto, K. Nishijo, N. Araki, et al.
A Novel Type of EWS-CHOP Fusion Gene in Two Cases of Myxoid Liposarcoma
J. Mol. Diagn.,
August 1, 2002;
4(3):
164 - 171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. J. Cummings, N. M. Brown, and T. T. Stenzel
TaqMan Junction Probes and the Reverse Transcriptase Polymerase Chain Reaction: Detection of Alveolar Rhabdomyosarcoma, Synovial Sarcoma, and Desmoplastic Small Round Cell Tumor
Ann. Clin. Lab. Sci.,
July 1, 2002;
32(3):
219 - 224.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ladanyi, C. R. Antonescu, D. H. Leung, J. M. Woodruff, A. Kawai, J. H. Healey, M. F. Brennan, J. A. Bridge, J. R. Neff, F. G. Barr, et al.
Impact of SYT-SSX Fusion Type on the Clinical Behavior of Synovial Sarcoma: A Multi-Institutional Retrospective Study of 243 Patients
Cancer Res.,
January 1, 2002;
62(1):
135 - 140.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. R. Antonescu, S. J. Tschernyavsky, R. Decuseara, D. H. Leung, J. M. Woodruff, M. F. Brennan, J. A. Bridge, J. R. Neff, J. R. Goldblum, and M. Ladanyi
Prognostic Impact of P53 Status, TLS-CHOP Fusion Transcript Structure, and Histological Grade in Myxoid Liposarcoma: A Molecular and Clinicopathologic Study of 82 Cases
Clin. Cancer Res.,
December 1, 2001;
7(12):
3977 - 3987.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Heimann, H. El Housni, G. Ogur, M. A. J. Weterman, E. M. Petty, and G. Vassart
Fusion of a Novel Gene, RCC17, to the TFE3 gene in t(X;17)(p11.2;q25.3)-bearing Papillary Renal Cell Carcinomas
Cancer Res.,
May 1, 2001;
61(10):
4130 - 4135.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. de Alava and J. Pardo
Ewing Tumor: Tumor Biology and Clinical Applications
International Journal of Surgical Pathology,
January 1, 2001;
9(1):
7 - 17.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Kovar, F. J. Fallaux, I. Pribill, D. Jugovic, S. Bartl, P. F. Ambros, D. N. T. Aryee, J. C. A. G. Wiegant, and R. C. Hoeben
Adenovirus E1A Does Not Induce the Ewing Tumor-associated Gene Fusion EWS-FLI1
Cancer Res.,
March 1, 2000;
60(6):
1557 - 1560.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. de Alava, A. Panizo, C. R. Antonescu, A. G. Huvos, F. J. Pardo-Mindan, F. G. Barr, and M. Ladanyi
Association of EWS-FLI1 Type 1 Fusion with Lower Proliferative Rate in Ewing’s Sarcoma
Am. J. Pathol.,
March 1, 2000;
156(3):
849 - 855.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. de Alava and W. L. Gerald
Molecular Biology of the Ewing’s Sarcoma/Primitive Neuroectodermal Tumor Family
J. Clin. Oncol.,
January 5, 2000;
18(1):
204 - 204.
[Abstract]
[Full Text]
[PDF]
|
 |
|