This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Garcia-Rostan, G. Articles by Rimm, D. L. Search for Related Content PubMed PubMed Citation Articles by Garcia-Rostan, G. Articles by Rimm, D. L.

Frequent Mutation and Nuclear Localization of ß-Catenin in Anaplastic Thyroid Carcinoma¹

Department of Pathology, Yale University School of Medicine, New Haven, Connecticut 06520 [G. G-R., G. T., T. G. D., M. L. C., D. L. R.], and Department of Pathology, Oviedo University School of Medicine, 33006, Asturias, Spain [A. H.]

	ABSTRACT

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
ß-catenin is an ubiquitously expressed cytoplasmic protein that has a crucial role in both E-cadherin-mediated cell-cell adhesion and as a downstream signaling molecule in the wingless pathway. Stabilization of ß-catenin followed by nuclear translocation and subsequent T-cell factor/lymphoid-enhancing factor-mediated transcriptional activation has been proposed as an important step in oncogenesis. Stabilization may occur through activating mutations in exon-3 at the phosphorylation sites for ubiquitination and degradation of ß-catenin. Immunohistochemical subcellular localization of ß-catenin and mutational analysis of exon-3 of the ß-catenin gene by single-strand conformational polymorphism followed by DNA sequencing was performed on 37 samples from 31 patients with anaplastic thyroid carcinoma. Immunofluorescent staining showed nuclear localization in 15 (42%) of the 36 samples examined. Nucleotide sequencing of mobility shifts detected by single-strand conformational polymorphism revealed somatic alterations in 19 (61%) of the 31 patients analyzed. We conclude that mutations in ß-catenin are common in anaplastic thyroid cancer and that they may activate transcription, as illustrated by frequent nuclear localization of the protein. These findings support the idea that ß-catenin acts as an oncogene and contributes to the highly aggressive behavior of this tumor.

	Introduction

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
ß-catenin is a M_r 92,000 protein, initially identified as a coprecipitating species with the E-cadherin cell-cell adhesive complex (1) . ß-catenin was subsequently shown to link E-cadherin to -catenin, which links the E-cadherin/catenin complex to the cortical cytoskeleton (for review see Ref. (2) ). Molecular cloning revealed that ß-catenin is a member of the armadillo family of proteins, whose prototype molecule, Arm, functions as a downstream component of the wnt³ signaling pathway in Drosophila (3) .

The role of ß-catenin in signal transduction is not completely understood, but it has been shown to be involved in the wnt developmental pathway. Normally, wnt binding to the human frizzled homologue activates dishevelled signaling protein that inhibits GSK3ß (4) . When the kinase is inactive, it no longer phosphorylates serines and threonines in the NH₂-terminal region of ß-catenin (at positions 37–45), and the unphosphorylated form of ß-catenin is not degraded by APC in the ubiquitin-mediated proteasome pathway (5 , 6) . Instead, it accumulates in the cytoplasm where it can interact with the T-cell factor 4 or lymphoid-enhancer factor family (7) of transcriptional activators and can result in the activation of some developmentally related genes, recently shown to include c-myc (8) . Mutations in APC that result in its inability to degrade ß-catenin or mutations in ß-catenin that prevent phosphorylation result in activation of this pathway because of increased cytoplasmic ß-catenin (9 , 10) . This is the proposed mechanism of oncogenesis for ß-catenin (11) .

ß-catenin mutations have been reported in both cell lines and human tumors. Initial studies identified mutations at putative GSK3ß phosphorylation sites in colon cancer (9) and melanoma cell lines (10) . Shortly thereafter, mutations were also found in human colon cancer. Predictably, tumors with APC mutations showed no mutations in ß-catenin, whereas ß-catenin mutations were found in nearly 50% of the colon cancers with wild-type APC (12) . ß-catenin mutations have also been detected, at a lower prevalence, in a variety of other cancers including medulloblastoma (13) , endometrioid ovarian carcinoma (14) , uterine endometrial carcinoma (15) , hepatocellular carcinoma (16) , and prostatic adenocarcinoma (17) . It has also been found that deletions (as opposed to point mutations) within the NH₂-terminal region could also trigger the oncogenic effect (18) .

In this work, we examine ß-catenin mutations in anaplastic thyroid carcinoma, a highly lethal neoplasm, which is regarded as the final step in the progression of thyroid tumors. We used both SSCP to detect mutations and immunofluorescence to assess nuclear localization of ß-catenin. We find that mutations in exon 3 at or near the sites of GSK3ß phosphorylation are more frequent in this tumor than in any cancer examined to date, and that there is good but incomplete correlation between exon 3 mutations and nuclear localization.

	Materials and Methods

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Tissue Samples.
The study population included 37 formalin-fixed paraffin-embedded specimens obtained from 31 patients diagnosed with anaplastic thyroid carcinoma at Hospital Covadonga-University of Oviedo (Asturias, Spain) and Yale New Haven Hospital-Yale University (New Haven, CT). For each case, the sex and age of the patient at diagnosis, tumor size, extrathyroid extension, vascular invasion, lymph nodes or distant metastasis, stage, and follow-up were recorded. All of the processing of materials and clinical information proceeded in accordance with Yale University Human Investigation Committee protocol #8219 (to D. Rimm).

Fluorescence Immunohistochemistry for ß-Catenin.
Representative blocks of tumor tissue were selected in each case to carry out the immunofluorescence analysis of ß-catenin. Histological sections were prepared for immunostaining using a pressure-cooker antigen retrieval method (19) . Each section was baked at 60°C overnight, then deparaffinized, and treated for antigen retrieval by immersion in 6.5 mM sodium citrate (pH = 6.0) for 5 min in a conventional pressure cooker (Kmart Inc.). Sections were then blocked with 3% BSA in TBS. An anti-ß-catenin monoclonal antibody (Transduction Laboratories, Lexington, KY) was diluted to 2–7 µg/ml and incubated in a humidity chamber overnight, followed by seven TBS washes, including 0.01% Triton X-100 in the sixth wash. For increased sensitivity and better subcellular localization of ß-catenin, Cy3-conjugated secondary antibodies were used instead of conventional enzymatic reaction-based chromogens. A Cy3-conjugated goat antimouse immunoglobulin antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) was diluted 1:500 in TBS with 3% BSA and incubated with the sections for 1 h before washing as above and coverslipping.

DNA Isolation.
Genomic DNA was extracted from the same block evaluated for ß-catenin expression. Although most of the blocks contained only tumor tissue, some also disclosed normal thyroid follicles entrapped within the tumor. In the latter cases, tumor material was microdissected away from normal tissue for performing the mutational analysis. Embedded sections were deparaffinized using two successive washes of xylene, hydrated through 80% ethanol/20% xylene solution, and vacuum-dried. Samples were then incubated overnight in 1 M sodium thiocyanate (NaSCN) for protein denaturation. Proteins were digested with proteinase K (10 mg/ml) in DNA isolation buffer (5M NaCl, 0.5M EDTA (pH 8.0), 0.5% Tween 20, and ddH₂O) at 37°C in a shaking water bath overnight. The mixture was then extracted with equal volumes of phenol and phenol:chloroform:Isoamyl-alcohol (25:24:1) in Phase Lock Gel tubes (5 prime 3 prime, Inc., Boulder, CO). Nucleic acids were precipitated with 3 M sodium acetate (NaAc) in 100% ethanol at -20°C overnight. DNA was pelleted, air-dried, and resuspended in TE (pH 8.0).

Mutational Analysis.
Tumor DNA was evaluated for mutations in the GSK-3ß phosphorylation consensus motif of the ß-catenin gene by PCR-SSCP. DNA sequences of the third coding exon of the ß-catenin gene were amplified using the forward 5'-primer GCTGATTTGATGGAGTTGGA and the reverse 3'-primer GCTACTTGTTCTTGAGTGAA. The PCR was carried out in 30 µl of reaction mixture containing 20–100 ng of genomic DNA, 20 pmol of each primer, 250 µM each dNTP, 2 mM MgCl₂, 10x Perkin-Elmer buffer II (Perkin-Elmer Applied Biosystems Division, Foster City, CA), and 2.5 units of AmpliTaq Gold (Perkin-Elmer). The mixture was heated for 10 min at 94°C for initial DNA denaturation, followed by 35 cycles of denaturation (at 94°C for 1 min), annealing (at 55° for 2 min), and extension (at 72°C for 3 min) on the GeneAmp PCR system 9600 (Perkin -Elmer Corp.). The PCR products were electrophoresed in a 3% Nusieve:Seakem LE agarose gel (2:1) and visualized by staining with ethidium bromide.

For SSCP analysis, 30–40 ng of PCR product were denatured by adding 2.5–5 volumes of stop solution (95% formamide, 5.0M NaOH, 0.1% bromphenol blue, and 0.1% xylene cyanol) and heated at 95°C for 5 min. After quick chill on ice, samples were loaded onto a 40% Mutation Detection Enhancement (MDE) vertical gel (FMG BioProducts, Rockland, ME) and run for 4 h in a SE 600 vertical gel apparatus (Hoefer Scientific, San Francisco, CA) at 400 V at 18°C. Gel temperature was regulated with a cooling circulating bath. After electrophoresis, the gels were stained for 10–20 min with SYBR-Green II (FMC BioProducts) diluted 1:10,000 in TE (pH 7.4). Images were captured on an IS 1000 Digital Imaging System (Alpha-Innotech Corp., San Leandro, CA) using 254 nm or 313 nm UV transillumination and a SG-3 filter. All of the 19 mutations were verified by repeated PCR and SSCP gel analysis.

Sequencing Analysis.
All of the samples exhibiting mobility shifts by SSCP were excised and eluted in TE (pH 8.0). The eluted DNA was amplified using the same corresponding set of primers under the same PCR conditions described previously. The products were separated and purified on a 3% Nusieve:Seakem LE agarose gel (2:1) using NA 45 DEAE membranes (Schleicher and Schuell Inc., Keene, NH). The DNA bound by the membranes was released in 1.0 M NaCl, 0.1 M EDTA, and 20 mM Tris (pH 8.0) at 70°C for 10 min and precipitated with 100% ethanol at -20°C overnight. DNA sequences were determined in all of the cases by dye terminator cycle sequencing using an Applied Biosystem 377 DNA sequencer (Perkin-Elmer Corp). Sequencing from both the sense and antisense orientations was performed for confirmation.

	Results and Discussion

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 
Previous studies (20) have shown that activation of the wnt pathway results in up-regulation of cytoplasmic ß-catenin and its translocation to the nucleus, presumably via the binding of ß-catenin to T-cell factor/lymphoid-enhancing factor family members. Thus, as a first assessment, we examined the subcellular localization of ß-catenin in 37 anaplastic thyroid carcinoma specimens. Nuclear immunofluorescence was observed in 15 (41.6%) of 36 specimens analyzed (Fig. 1) , and another 15 (41.6%) specimens were totally negative for membranous, cytoplasmic, or nuclear ß-catenin staining. Other patterns included discontinuous membranous staining [seen in 7 (19.4%) tumor samples, 2 of which also showed nuclear staining] and abnormal cytoplasmic localization [seen in 5 (13.8%) samples, 3 of which also showed nuclear staining]. ß-catenin nuclear expression was focal in all of the 15 specimens. Due to the appreciable staining intensity variation among the 36 tumor samples stained and within different areas on each tumor, ß-catenin nuclear reactivity was evaluated by H score after examination of at least 10 high-power fields (21) . The nuclear score for each mutated case is shown in Table 1 . Normal thyroid follicles entrapped within the tumor and capillary endothelial cells served as internal positive controls for scoring ß-catenin expression in all of the samples. Negative control sections in all of the cases showed no staining.

View larger version (123K): [in this window] [in a new window]   Fig. 1. Examples of nuclear localization of ß-catenin in anaplastic thyroid tumors. A, H&E-stained tumor. B, a serial section stained with an anti-ß-catenin monoclonal antibody visualized with a Cy3-conjugated fluorescent secondary antibody. Bar, 100 µM.C-F, high power views illustrate ß-catenin immunoreactivity in anaplastic thyroid carcinoma and the corresponding H&E and phase-contrast images. C and D are serial sections, whereas the phase image (E) is the identical field and section as that seen stained with ß-catenin and visualized with Cy3 in F. It shows nuclear localization of ß-catenin as well as membrane junctional staining of the endothelial cells (annotated by white arrows), which provides the internal positive control for ß-catenin expression. Bar (D), 20 µM.

View larger version (120K): [in this window] [in a new window]   Fig. 2. A, SSCP analysis of the PCR amplification of ß-catenin exon 3 in six anaplastic thyroid carcinomas. Lane WT shows the wild-type band pattern, and beneath each of the other lanes are the case numbers of the thyroid tumors. Lowercase lettersa-g, mobility shifts representing somatic mutations at the following codons: a = 40, b = 40 and 49, c = 32, d = 44, e = 54, f = 37, and g = 45. The corresponding sequence changes and amino acid substitutions are shown in Table 1 . B, the sense sequence of case 125 showing two point mutations at serines 37 and 45.

View larger version (12K): [in this window] [in a new window]   Fig. 3. A schematic illustration of the location of the 45 mutations identified in this cohort in exon 3. The standard single letter amino acid code is used. Boldface, cases with nuclear localization of ß-catenin.

Our data demonstrate that anaplastic thyroid carcinoma has the highest frequency of mutations in the CTNNB1 coding region of ß-catenin reported to date. In keeping with this high level of mutations, many cases (14 of 19) showed multiple activating point mutations that might reflect an increased level of genetic instability in this tumor type. The finding of multiple activating point mutations has not been reported previously in human tumors screened for ß-catenin mutations. However, multiple mutations on the same gene (Ki-ras) have been previously described in colon carcinoma and have been shown to correlate with advanced clinical stage (25) . Our observation of multiple mutations is consistent with the fact that anaplastic carcinoma is, as the name implies, an undifferentiated, highly aggressive tumor that is believed to represent the final step in thyroid tumor progression. Moreover, the analysis of multiple samples from tumors exhibiting, in addition to the anaplastic carcinoma, a concurrent better-differentiated component (follicular carcinoma, specimen 104^b, associated with anaplastic carcinoma, specimen 105^b; and papillary carcinoma, specimen 107^c, associated with anaplastic carcinoma, specimen 106^c) indicated that ß-catenin mutations are a late event during thyroid tumor progression because mutations were detected only in the anaplastic carcinoma but not in the better-differentiated component (see Table 1 ). On the other hand, analysis of multiple areas with different microscopic appearance (e.g., spindle or giant cell morphology) but the same histological grade within the same tumor (samples 109^d and 110^d; samples 113^e and 114^e; and samples 120^f and 121^f) demonstrated that ß-catenin mutations may be focal (sample 113^e resulted wild type and sample 114^e resulted mutated) and also that anaplastic thyroid carcinoma exhibits clonal heterogeneity (see samples 109^d and 110^d and samples 120^f and 121^f in Table 1 ). Similar results were seen in a recent study of prostatic adenocarcinomas (17) . Finally, this series also showed for the first time a relatively high rate of silent mutations. Nine of the 19 mutated patients featured at least one silent mutation, with some cases exhibiting multiple third position replacements. Normal thyroid tissue from none of the nine patients was available for PCR-SSCP analysis to establish whether the mutations represent indeed unreported ß-catenin polymorphisms.

In conclusion ß-catenin mutations are very common in anaplastic thyroid carcinoma, and they may activate transcription, as illustrated by frequent nuclear localization of the protein. Our findings indicate that ß-catenin acts as an oncogene in thyroid tumors and contributes to the highly aggressive behavior of anaplastic thyroid carcinoma. Because this tumor carries an extremely poor prognosis (all of the patients in this study died within 1 year of the diagnosis), it is impossible to obtain meaningful survival data, and no attempt was made to correlate either nuclear localization or mutation of ß-catenin to outcome.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ This work is supported by grants from the William and Catherine Weldon Donaghue Foundation for Medical Research and NIH RO-1 GM57604 (to D. L. R.) and the United States Army [DAMD17-94-J4366 (to D. L. R.)] and Fondo Investigacion Sanitaria (FIS) Grant (file 98/5022) from the Spanish Government to (G. G-R.).

² To whom requests for reprints should be addressed, at Department of Pathology, Yale University School of Medicine, Room 2–608 East Pavilion, Yale-New Haven Hospital, 20 York Street, New Haven, CT 06510. Phone: (203) 737-1237; Fax: (203) 737-2922; E-mail: ginesa.rostan{at}yale.edu

³ The abbreviations used are: wnt, wingless; APC, adenomatous polyposis coli; GSK3ß, glycogen synthase kinase 3ß; SSCP, single-strand conformational polymorphism; TBS, Tris-buffered saline [150 mM NaCl and 20 mM Tris (pH = 8)]; TE, 10 mM Tris and 1 mM EDTA.

Received 11/10/98. Accepted 3/ 2/99.

	REFERENCES

Top ABSTRACT Introduction Materials and Methods Results and Discussion REFERENCES

 

1. Ozawa M., Baribault H., Kemler R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J., 8: 1711-1718, 1989.[Medline]
2. Gumbiner B. M. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell, 84: 345-357, 1996.[Medline]
3. Peifer M., McCrea P. D., Green K. J., Wieschaus E., Gumbiner B. M. The vertebrate adhesive junction proteins ß-catenin and plakoglobin and the Drosophila segment polarity gene armadillo form a multigene family with similar properties. J. Cell Biol., 118: 681-691, 1992.[Abstract/Free Full Text]
4. Brown J. D., Moon R. T. Wnt signaling: why is everything so negative. Curr. Opin. Cell Biol., 10: 182-187, 1998.[Medline]
5. Orford K., Crockett C., Jensen J. P., Weissman A. M., Byers S. W. Serine phosphorylation-regulated ubiquitination and degradation of ß-catenin. J. Biol. Chem., 272: 24735-24738, 1997.[Abstract/Free Full Text]
6. Aberle H., Bauer A., Stappert J., Kispert A., Kemler R. ß-catenin is a target for the ubiquitin-proteasome pathway. EMBO J., 16: 3797-3804, 1997.[Medline]
7. Behrens J., von Kries J. P., Kuhl M., Bruhn L., Wedlich D., Grosschedl R., Birchmeier W. Functional interaction of ß-catenin with the transcription factor LEF-1. Nature (Lond.), 382: 638-642, 1996.[Medline]
8. He T. C., Sparks A. B., Rago C., Hermeking H., Zawel L., da Costa L. T., Morin P. J., Vogelstein B., Kinzler K. W. Identification of C-Myc as a target of the APC pathway. Science (Washington DC), 281: 1509-1512, 1998.[Abstract/Free Full Text]
9. Morin P. J., Sparks A. B., Korinek V., Barker N., Clevers H., Vogelstein B., Kinzler K. W. Activation of ß-catenin-Tcf signaling in colon cancer by mutations in ß-catenin or APC. Science (Washington DC), 275: 1787-1790, 1997.[Abstract/Free Full Text]
10. Rubinfeld B., Robbins P., El-Gamil M., Albert I., Porfiri E., Polakis P. Stabilization of ß-catenin by genetic defects in melanoma cell lines. Science (Washington DC), 275: 1790-1792, 1997.[Abstract/Free Full Text]
11. Peifer M. ß-catenin as Oncogene: the smoking gun. Science (Washington DC), 275: 1752-1753, 1997.[Free Full Text]
12. Sparks A. B., Morin P. J., Vogelstein B., Kinzler K. W. Mutational analysis of the APC/ß-catenin/Tcf pathway in colorectal cancer. Cancer Res., 58: 1130-1134, 1998.[Abstract/Free Full Text]
13. Zurawel R. H., Chiappa S. A., Allen C., Raffel C. Sporadic medulloblastomas contain oncogenic ß-catenin mutations. Cancer Res., 58: 896-899, 1998.[Abstract/Free Full Text]
14. Palacios J., Gamallo C. Mutations in the ß-catenin gene (CTNNB1) in endometrioid ovarian carcinomas. Cancer Res., 58: 1344-1347, 1998.[Abstract/Free Full Text]
15. Fukuchi T., Sakamoto M., Tsuda H., Maruyama K., Nozawa S., Hirohashi S. ß-Catenin mutation in carcinoma of the uterine endometrium. Cancer Res., 58: 3526-3528, 1998.[Abstract/Free Full Text]
16. Miyoshi Y., Iwao K., Nagasawa Y., Aihara T., Sasaki Y., Imaoka S., Murata M., Shimano T., Nakamura Y. Activation of the ß-catenin gene in primary hepatocellular carcinomas by somatic alterations involving exon 3. Cancer Res., 58: 2524-2527, 1998.[Abstract/Free Full Text]
17. Voeller H. J., Truica C. I., Gelmann E. P. ß-Catenin mutations in human prostate cancer. Cancer Res., 58: 2520-2523, 1998.[Abstract/Free Full Text]
18. Iwao K., Nakamori S., Kameyama M., Imaoka S., Kinoshita M., Fukui T., Ishiguro S., Nakamura Y., Miyoshi Y. Activation of the ß-catenin gene by interstitial deletions involving exon 3 in primary colorectal carcinomas without adenomatous polyposis coli mutations. Cancer Res., 58: 1021-1026, 1998.[Abstract/Free Full Text]
19. Norton A., Jordan S., Yeomans P. Brief high-temperature heat denaturation (pressure cooking): a simple and effective method of antigen retrieval for routinely processed specimens. J. Pathol., 173: 371-379, 1994.[Medline]
20. Willert K., Nusse R. ß-catenin: a key mediator of Wnt signaling. Curr. Opin. Genet. Dev., 8: 95-102, 1998.[Medline]
21. Bacus S., Flowers J. L., Press M. F., Bacus J. W., McCarty K. S. The evaluation of estrogen receptor in primary breast carcinoma by computer-assisted image analysis. Am. J. Clin. Pathol., 90: 233-239, 1988.[Medline]
22. Venitt S. Mechanisms of spontaneous human cancers. Environ. Health Perspect., 104: 633-637, 1996.
23. Cerrato A., Fulciniti F., Avallone A., Benincasa G., Palombini L., Grieco M. Beta- and gamma-catenin expression in thyroid carcinomas. J. Pathol., 185: 267-272, 1998.[Medline]
24. Hinck L., Nelson W. J., Papkoff J. Wnt-1 modulates cell-cell adhesion in mammalian cells by stabilizing ß-catenin binding to the cell adhesion protein cadherin. J. Cell Biol., 124: 729-741, 1994.[Abstract/Free Full Text]
25. Moerkerk P., Arends J. W., van Driel M., de Bruine A., de Goeij A., ten Kate J. Type and number of Ki-ras point mutations relate to stage of human colorectal cancer. Cancer Res., 54: 3376-3378, 1994.[Abstract/Free Full Text]

This article has been cited by other articles:

				C. J. Guigon, L. Zhao, C. Lu, M. C. Willingham, and S.-y. Cheng Regulation of {beta}-Catenin by a Novel Nongenomic Action of Thyroid Hormone {beta} Receptor Mol. Cell. Biol., July 15, 2008; 28(14): 4598 - 4608. [Abstract] [Full Text] [PDF]

				Y. Li, X. Zhang, R. D. Polakiewicz, T.-P. Yao, and M. J. Comb HDAC6 Is Required for Epidermal Growth Factor-induced {beta}-Catenin Nuclear Localization J. Biol. Chem., May 9, 2008; 283(19): 12686 - 12690. [Abstract] [Full Text] [PDF]

				V. De Falco, V. Guarino, E. Avilla, M. D. Castellone, P. Salerno, G. Salvatore, P. Faviana, F. Basolo, M. Santoro, and R. M. Melillo Biological Role and Potential Therapeutic Targeting of the Chemokine Receptor CXCR4 in Undifferentiated Thyroid Cancer Cancer Res., December 15, 2007; 67(24): 11821 - 11829. [Abstract] [Full Text] [PDF]

				J. Lima, T. Feijao, A. Ferreira da Silva, I. Pereira-Castro, G. Fernandez-Ballester, V. Maximo, A. Herrero, L. Serrano, M. Sobrinho-Simoes, and G. Garcia-Rostan High Frequency of Germline Succinate Dehydrogenase Mutations in Sporadic Cervical Paragangliomas in Northern Spain: Mitochondrial Succinate Dehydrogenase Structure-Function Relationships and Clinical-Pathological Correlations J. Clin. Endocrinol. Metab., December 1, 2007; 92(12): 4853 - 4864. [Abstract] [Full Text] [PDF]

				W. B. Kim, C. J Lewis, K. D McCall, R. Malgor, A. D Kohn, R. T Moon, and L. D Kohn Overexpression of Wnt-1 in thyrocytes enhances cellular growth but suppresses transcription of the thyroperoxidase gene via different signaling mechanisms J. Endocrinol., April 1, 2007; 193(1): 93 - 106. [Abstract] [Full Text] [PDF]

				K. A. B. Knostman, S. M. Jhiang, and C. C. Capen Genetic Alterations in Thyroid Cancer: The Role of Mouse Models Vet. Pathol., January 1, 2007; 44(1): 1 - 14. [Abstract] [Full Text] [PDF]

				G. Garcia-Rostan, A. M. Costa, I. Pereira-Castro, G. Salvatore, R. Hernandez, M. J.A. Hermsem, A. Herrero, A. Fusco, J. Cameselle-Teijeiro, and M. Santoro Mutation of the PIK3CA Gene in Anaplastic Thyroid Cancer Cancer Res., November 15, 2005; 65(22): 10199 - 10207. [Abstract] [Full Text] [PDF]

				T. Guida, G. Salvatore, P. Faviana, R. Giannini, G. Garcia-Rostan, L. Provitera, F. Basolo, A. Fusco, F. Carlomagno, and M. Santoro Mitogenic Effects of the Up-Regulation of Minichromosome Maintenance Proteins in Anaplastic Thyroid Carcinoma J. Clin. Endocrinol. Metab., August 1, 2005; 90(8): 4703 - 4709. [Abstract] [Full Text] [PDF]

				Y. E. Nikiforov Anaplastic Carcinoma of the Thyroid--Will Aurora B Light a Path for Treatment? J. Clin. Endocrinol. Metab., February 1, 2005; 90(2): 1243 - 1245. [Full Text] [PDF]

				M Onda, M Emi, A Yoshida, S Miyamoto, J Akaishi, S Asaka, K Mizutani, K Shimizu, M Nagahama, K Ito, et al. Comprehensive gene expression profiling of anaplastic thyroid cancers with cDNA microarray of 25 344 genes Endocr. Relat. Cancer, December 1, 2004; 11(4): 843 - 854. [Abstract] [Full Text] [PDF]

				A. Podtcheko, A. Ohtsuru, H. Namba, V. Saenko, and S. Yamashita Authors' Response: Effect of Imatinib Mesylate (Gleevec) on Anaplastic Thyroid Carcinoma Cell Lines J. Clin. Endocrinol. Metab., October 1, 2003; 88(10): 5044 - 5044. [Full Text]

				O. Marin, V. H. Bustos, L. Cesaro, F. Meggio, M. A. Pagano, M. Antonelli, C. C. Allende, L. A. Pinna, and J. E. Allende Inaugural Article: A noncanonical sequence phosphorylated by casein kinase 1 in {beta}-catenin may play a role in casein kinase 1 targeting of important signaling proteins PNAS, September 2, 2003; 100(18): 10193 - 10200. [Abstract] [Full Text] [PDF]

				E. Provost, Y. Yamamoto, I. Lizardi, J. Stern, T. G. D'Aquila, R. B. Gaynor, and D. L. Rimm Functional Correlates of Mutations in {beta}-Catenin Exon 3 Phosphorylation Sites J. Biol. Chem., August 22, 2003; 278(34): 31781 - 31789. [Abstract] [Full Text] [PDF]

				M. P.A. Ebert, J. Yu, J. Hoffmann, A. Rocco, C. Rocken, S. Kahmann, O. Muller, M. Korc, J. J. Sung, and P. Malfertheiner Loss of Beta-Catenin Expression in Metastatic Gastric Cancer J. Clin. Oncol., May 1, 2003; 21(9): 1708 - 1714. [Abstract] [Full Text] [PDF]

				R. M. Adam, T. Danciu, D. L. McLellan, J. G. Borer, J. Lin, D. Zurakowski, M. H. Weinstein, P. H. Rajjayabun, J. K. Mellon, and M. R. Freeman A Nuclear Form of the Heparin-binding Epidermal Growth Factor-like Growth Factor Precursor Is a Feature of Aggressive Transitional Cell Carcinoma Cancer Res., January 15, 2003; 63(2): 484 - 490. [Abstract] [Full Text] [PDF]

				J. H. Hwang, J. H. Hwang, H. K. Chung, D. W. Kim, E. S. Hwang, J. M. Suh, H. Kim, K.-H. You, O-Y. Kwon, H. K. Ro, et al. CXC Chemokine Receptor 4 Expression and Function in Human Anaplastic Thyroid Cancer Cells J. Clin. Endocrinol. Metab., January 1, 2003; 88(1): 408 - 416. [Abstract] [Full Text] [PDF]

				S. M. Wiseman, T. R. Loree, W. L. Hicks Jr, N. R. Rigual, J. S. Winston, D. Tan, G. R. Anderson, and D. L. Stoler Anaplastic Thyroid Cancer Evolved From Papillary Carcinoma: Demonstration of Anaplastic Transformation by Means of the Inter-Simple Sequence Repeat Polymerase Chain Reaction Arch Otolaryngol Head Neck Surg, January 1, 2003; 129(1): 96 - 100. [Abstract] [Full Text] [PDF]

				J.-S. Kim, H. Crooks, A. Foxworth, and T. Waldman Proof-of-Principle: Oncogenic {beta}-Catenin Is a Valid Molecular Target for the Development of Pharmacological Inhibitors Mol. Cancer Ther., December 1, 2002; 1(14): 1355 - 1359. [Abstract] [Full Text] [PDF]

				D. Wolf, M. Rodova, E. A. Miska, J. P. Calvet, and T. Kouzarides Acetylation of beta -Catenin by CREB-binding Protein (CBP) J. Biol. Chem., July 5, 2002; 277(28): 25562 - 25567. [Abstract] [Full Text] [PDF]

				K. Ishigaki, H. Namba, M. Nakashima, T. Nakayama, N. Mitsutake, T. Hayashi, S. Maeda, M. Ichinose, T. Kanematsu, and S. Yamashita Aberrant Localization of {beta}-Catenin Correlates with Overexpression of Its Target Gene in Human Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3433 - 3440. [Abstract] [Full Text] [PDF]

				W. M. Clements, J. Wang, A. Sarnaik, O. J. Kim, J. MacDonald, C. Fenoglio-Preiser, J. Groden, and A. M. Lowy {beta}-Catenin Mutation Is a Frequent Cause of Wnt Pathway Activation in Gastric Cancer Cancer Res., June 1, 2002; 62(12): 3503 - 3506. [Abstract] [Full Text] [PDF]

				J. E. Pawlowski, J. R. Ertel, M. P. Allen, M. Xu, C. Butler, E. M. Wilson, and M. E. Wierman Liganded Androgen Receptor Interaction with beta -Catenin. NUCLEAR CO-LOCALIZATION AND MODULATION OF TRANSCRIPTIONAL ACTIVITY IN NEURONAL CELLS J. Biol. Chem., May 31, 2002; 277(23): 20702 - 20710. [Abstract] [Full Text] [PDF]

				S. C. Abraham, T.-T. Wu, R. H. Hruban, J.-H. Lee, C. J. Yeo, K. Conlon, M. Brennan, J. L. Cameron, and D. S. Klimstra Genetic and Immunohistochemical Analysis of Pancreatic Acinar Cell Carcinoma : Frequent Allelic Loss on Chromosome 11p and Alterations in the APC/{beta}-Catenin Pathway Am. J. Pathol., March 1, 2002; 160(3): 953 - 962. [Abstract] [Full Text] [PDF]

				M. P.A. Ebert, G. Fei, S. Kahmann, O. Muller, J. Yu, J. J.Y. Sung, and P. Malfertheiner Increased {beta}-catenin mRNA levels and mutational alterations of the APC and {beta}-catenin gene are present in intestinal-type gastric cancer Carcinogenesis, January 1, 2002; 23(1): 87 - 91. [Abstract] [Full Text] [PDF]

				K. Helmbrecht, A. Kispert, R. von Wasielewski, and G. Brabant Identification of a Wnt/{beta}-Catenin Signaling Pathway in Human Thyroid Cells Endocrinology, December 1, 2001; 142(12): 5261 - 5266. [Abstract] [Full Text] [PDF]

				E. Sadot, B. Geiger, M. Oren, and A. Ben-Ze'ev Down-Regulation of {beta}-Catenin by Activated p53 Mol. Cell. Biol., October 15, 2001; 21(20): 6768 - 6781. [Abstract] [Full Text] [PDF]

				M. Fujimori, S. Ikeda, Y. Shimizu, M. Okajima, and T. Asahara Accumulation of {beta}-Catenin Protein and Mutations in Exon 3 of {beta}-Catenin Gene in Gastrointestinal Carcinoid Tumor Cancer Res., September 1, 2001; 61(18): 6656 - 6659. [Abstract] [Full Text] [PDF]

				D. F. Calvisi, V. M. Factor, R. Loi, and S. S. Thorgeirsson Activation of {beta}-Catenin during Hepatocarcinogenesis in Transgenic Mouse Models: Relationship to Phenotype and Tumor Grade Cancer Res., March 1, 2001; 61(5): 2085 - 2091. [Abstract] [Full Text]

				G. Garcia-Rostan, R. L. Camp, A. Herrero, M. L. Carcangiu, D. L. Rimm, and G. Tallini {beta}-Catenin Dysregulation in Thyroid Neoplasms : Down-Regulation, Aberrant Nuclear Expression, and CTNNB1 Exon 3 Mutations Are Markers for Aggressive Tumor Phenotypes and Poor Prognosis Am. J. Pathol., March 1, 2001; 158(3): 987 - 996. [Abstract] [Full Text] [PDF]

				S. C. Abraham, B. Nobukawa, F. M. Giardiello, S. R. Hamilton, and T.-T. Wu Sporadic Fundic Gland Polyps : Common Gastric Polyps Arising Through Activating Mutations in the {beta}-Catenin Gene Am. J. Pathol., March 1, 2001; 158(3): 1005 - 1010. [Abstract] [Full Text] [PDF]

				S. C. Abraham, E. A. Montgomery, F. M. Giardiello, and T.-T. Wu Frequent {beta}-Catenin Mutations in Juvenile Nasopharyngeal Angiofibromas Am. J. Pathol., March 1, 2001; 158(3): 1073 - 1078. [Abstract] [Full Text] [PDF]

				M J Pukkila, J A Virtaniemi, E J Kumpulainen, R T Pirinen, R T Johansson, H J Valtonen, M T Juhola, and V-M Kosma Nuclear {beta} catenin expression is related to unfavourable outcome in oropharyngeal and hypopharyngeal squamous cell carcinoma J. Clin. Pathol., January 1, 2001; 54(1): 42 - 47. [Abstract] [Full Text] [PDF]

				J. Böhm, L. Niskanen, K. Kiraly, J. Kellokoski, M. Eskelinen, S. Hollmen, E. Alhava, and V.-M. Kosma Expression and Prognostic Value of {{alpha}}-, {beta}-, and {{gamma}}-Catenins in Differentiated Thyroid Carcinoma J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4806 - 4811. [Abstract] [Full Text]