Cancer Research Annual Meeting 2010  2010 Workshops
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 1837-1839, April 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Turker, M. S.
Right arrow Articles by Tischfield, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turker, M. S.
Right arrow Articles by Tischfield, J. A.
[Cancer Research 59, 1837-1839, April 15, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

A Novel Signature Mutation for Oxidative Damage Resembles a Mutational Pattern Found Commonly in Human Cancers1

Mitchell S. Turker2, Blythe M. Gage, Jennifer A. Rose, Daniel Elroy, Olga N. Ponomareva, Peter J. Stambrook and Jay A. Tischfield3

Center for Research on Occupational and Environmental Toxicology, Oregon Health Sciences University, Portland, Oregon 97201 [M. S. T., B. M. G., J. A. R., D. E., O. N. P.]; Department of Cell Biology, Neurobiology, and Anatomy, University of Cincinnati, College of Medicine, Cincinnati, Ohio 45267-0521 [P. J. S.]; and Department of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, Indiana 46202-5251 [J. A. T.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
To determine the types of mutations induced by oxidative damage, a kidney cell line with a heterozygous deficiency for the autosomal Aprt (adenine phosphoribosyltransferase) gene was tested for its mutagenic response to hydrogen peroxide. Aprt-deficient cells were selected and scored for loss of heterozygosity (LOH) for 11 microsatellite loci on mouse chromosome 8. On the basis of the LOH analysis, spontaneous mutants (n = 38) were distributed into four classes: apparent point mutation, mitotic recombination, chromosome loss, and large interstitial deletion. However, 9 of 20 (45%) hydrogen peroxide-induced mutants exhibited a novel class of mutations characterized by "discontinuous LOH" for one or more of the microsatellite loci. Interestingly, mutations resembling discontinuous LOH are commonly observed in a wide variety of human cancers. Our data suggest that discontinuous LOH is a signature mutational pattern for oxidative damage and further suggest that such genetic damage is widespread in cancer.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
A role for oxidative stress in malignancy is widely accepted (1 , 2) . It is assumed that mutations induced by oxidative damage contribute significantly to this role. Recent evidence supporting a link between oxidative damage and cancer includes a loss of transcription-coupled-repair of this damage in cells with BRCA1 deficiencies (3) and of mutations in the OGG1 gene in human kidney and lung cancers (4) . The OGG1 protein is responsible for removing mutagenic 8-oxyguanine lesions. To document the presence of mutations induced by oxidative damage in cancers, it will be important to identify signature mutations that are found commonly in cells exposed to oxidative conditions, but found rarely in unexposed cells. On the basis of work with prokaryotic systems, the CC -> TT double bp substitution has been proposed as a potential signature mutation for oxidative damage in carcinogenesis (5) . However, there is no evidence from mammalian cells to support this suggestion, except as a consequence of UV light irradiation (6) . In more recent work, also with a prokaryotic system, it was shown that frameshift mutations in microsatellites are induced specifically by hydrogen peroxide (7) . Another recent study describes deletions on human chromosome 11 in the AL hamster/human hybrid cell line after exposure to arsenite, which is known to produce ROS4 (8) . However, a significant concern with most cell culture systems that have been used to determine the types of mutation induced by oxidative damage is their restricted mutational response. In previous studies, we demonstrated that a wide spectrum of spontaneous mutations were detected when the mouse Aprt gene, which is located on chromosome 8, was used as a target. Moreover, in these studies, mutations characteristic of ionizing radiation (9) , UV light, and an alkylating agent (10) were also detected. In the present study, we have used a newly derived kidney cell line with an Aprt heterozygous deficiency to determine the mutagenic effect of hydrogen peroxide. Hydrogen peroxide was selected because it can react with intracellular metals to produce mutagenic ROS (1 , 2) . We report that hydrogen peroxide produces a novel mutational pattern when Aprt is the target locus. This pattern is characterized by discontinuous LOH for polymorphic markers on chromosome 8. We propose discontinuous LOH as a signature mutational pattern for oxidative damage in mammalian cells and note its common occurrence in a variety of human cancers.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Isolation of a Kidney Cell Line with an Aprt Heterozygous Deficiency.
A kidney from a mouse with an Aprt heterozygous deficiency was digested with collagenase, as described previously (11) , and the resultant cell suspension was diluted and plated to obtain primary clones. The mouse was obtained by backcrossing a 129/Sv X C57BL/6 hybrid male (knockout allele derived from 129/Sv genome; Ref. 12 ) with a C57/BL6 female. Several primary clones were expanded and underwent spontaneous immortalization. One of these, termed KO6, was chosen for the current study. It was grown in DMEM (Life Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum (JRH Biosciences, Lenexa, KS). Chromosome 8 microsatellite loci characteristic of the C57/BL6 strain are linked to the wild type Aprt allele in the KO6 cell line.

Mutagenesis and Selection of Aprt-deficient Clones.
Subclones of early passage KO6 cells were isolated and expanded until confluent T-25 flasks were obtained. In some cases, these flasks were split into two to compare spontaneous and induced mutant frequencies (see Table 1Citation ). To determine spontaneous mutant frequencies, 4 x 105 unexposed cells were divided into four 100-mm dishes and exposed the next day to medium supplemented with 80 µg/ml DAP (Sigma Chemical Co., St. Louis, MO). DAP specifically selects for cells with APRT deficiencies. Cloning efficiency plates were also established. After 16–20 days, all clones were visually identified or identified after staining with crystal violet and counted. One or two DAP-resistant clones from each parental subclone were expanded for the LOH analysis. Induced mutants were obtained by exposing 1 x 106 cells to 40 µM hydrogen peroxide (Sigma Chemical Co.) and allowing a 5-day recovery period before plating 4.0 x 105 surviving cells for selection of DAP-resistant clones, as described for the spontaneous mutants. A dose-response curve demonstrated ~90% killing of KO6 cells with 40 µM hydrogen peroxide when the cells were plated 24 h after exposure for cloning efficiency determinations.


View this table:
[in this window]
[in a new window]

 
Table 1 Spontaneous and hydrogen peroxide-induced mutant frequenciesa

 
LOH Analysis.
LOH for chromosome 8 loci was performed as described elsewhere (9) . All primer pairs were obtained from Research Genetics (Huntsville, AL), with the exception of the primers used for D8Tur1 microsatellite. The primer pair for this microsatellite locus is: TTCATAACGGAGCTTCCCTTTAGT (CA3) and GGACCTTCCTGTGAGCCCGTG (CA4).


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
The ability of hydrogen peroxide to induce mutations at the Aprt locus was determined by comparing spontaneous and induced mutant frequencies for split subclones. In 11 of 12 cases in which the cultures were split, the mutant frequency was higher for the hydrogen peroxide-treated cultures than that for the untreated aliquot (Table 1)Citation . Induction indices (defined as the ratio of the mutant frequency for the hydrogen peroxide-treated sib culture divided by the mutant frequency for the untreated culture) ranged from 1.5 to > 47.7. These results demonstrate that hydrogen peroxide can induce Aprt mutants.

A LOH analysis was performed with 11 polymorphic loci on mouse chromosome 8 for 38 spontaneous mutants isolated from 25 independent KO6 subclones. Fig. 1Citation shows 28 of the 38 spontaneous mutants that were analyzed. One of these markers, D8Tur1, represents a CA repeat region located 0.7 kb upstream of the mouse Aprt promoter. This repeat region, which was found from a sequence analysis, is polymorphic when comparing the mouse 129/Sv and C57BL/6 Aprt alleles (data not shown). The LOH analysis for all 38 spontaneous mutants revealed four mutational categories: (a) chromosome loss (47%), defined by LOH for all markers; (b) mitotic recombination (21%), defined by a shift from heterozygosity to LOH at a position proximal to Aprt; (c) large interstitial deletion (3%), defined by a region of LOH inclusive of Aprt that is bracketed by heterozygous regions; and (d) apparent point mutation (29%), defined by heterozygosity for all chromosome 8 markers, including ca-aprt. Nine of the 11 apparent point mutations were examined with a sequence and/or Southern blot analysis; five point mutations were found to be due to bp substitutions, two were found to be due to 4 bp deletions, and two were found to be due to intragenic deletions of ~150 and 250 bp. In 13 cases, two DAP-resistant clones were isolated from a parental subclone, which means they could be sibs representing a single mutational event. However, in nine of these cases the mutational events were distinct, indicating that the number of possible sib clone pairs is no >4 and, therefore, such clones have minimal impact on the mutational analysis. From the analysis of apparent point mutations, it seems that clones 4a and 4b and 27a and 27b are, indeed, sib pairs.



View larger version (79K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. LOH analysis for chromosome 8 markers. A, chromosome 8 map. The relative and schematic locations of polymorphic microsatellite loci on mouse chromosome 8 examined in this study are shown. The relative locations of all microsatellite loci shown, except for D8Tur1, were determined from genetic maps provided by Research Genetics (Huntsville, AL) and the Massachusetts Institute of Technology (Cambridge, MA) database.5 The mouse Aprt locus was mapped precisely from an analysis of deletions induced by ionizing radiation (9) . The D8Tur1 locus is a CA repeat region located 700 bp upstream of the gene. B, results for hydrogen peroxide-induced mutants. Underlined numbers represent "discontinuous LOH" mutations. {circ}, loci retaining heterozygosity; •, loci with LOH; hatched circle, regions that have LOH for the nonselected chromosome (i.e., the chromosome bearing the knockout Aprt allele). Heterozygosity for all microsatellite loci is shown for the KO6 cells on the left. The numbers underneath each mutant represent specific parental subclones. C, results for 28 of 38 spontaneous mutants analyzed. When the numbers are identical for the induced and spontaneous mutants, a single parental subclone was split into two and both types of mutants were isolated. Results were not obtained for marker 13 for mutants 118a and 118b.

 
On the basis of the analysis of spontaneous KO6 mutants and previous studies of 78 spontaneous and 80 ionizing radiation-induced mutants from the P19H22 Aprt hemizygous-deficient cell line (9) , three consistent relationships were noted for chromosome 8 mutational patterns: (a) when LOH is observed for two or more chromosome 8 microsatellite markers, it is continuous regardless of the mutational event that occurred (deletion, mitotic recombination, or chromosome loss); (b) when LOH is observed for chromosome 8 markers, the loci lost are located on the same chromosome as the expressed (i.e., wild type) Aprt allele; and (c) when heterozygosity remains for D8Tur1 (i.e., an apparent point mutation has occurred within the Aprt gene), LOH is not observed elsewhere on the chromosome.

For the hydrogen peroxide-treated cultures, 20 mutants were isolated from 14 KO6 subclones. The LOH analysis of these mutants revealed LOH patterns that deviated from the above relationships in 9 of 20 (45%) cases (Fig. 1)Citation . The most common observation was the occurrence of LOH at nonadjacent loci on the same homologue. For mutant H5b, LOH was observed at one marker linked to the Aprt knockout allele, and for mutant H6, LOH was observed at four separate markers linked to the knockout allele. In three of seven cases in which heterozygosity was retained for the D8Tur1 locus, LOH was observed for at least one additional polymorphic locus elsewhere on the chromosome (mutants H17, H21a, and H26). We use the term "discontinuous LOH" to describe this novel set of mutations. An exact unconditional test to compare the difference in spectra between spontaneous and induced mutants yielded a P of 0.001. This result demonstrates that the presence of the discontinuous LOH mutants in the hydrogen peroxide-treated cultures is statistically significant. Five of the seven apparent point mutants induced by hydrogen peroxide were examined with a sequence and/or Southern blot analysis; one was found to be a bp substitution, two were found to be 5 bp deletions (H12a and H12b, suggesting a sib pair), one was found to be a deletion of ~50 bp, and one appeared to be a gene conversion event. Finally, 2 of 20 (10%) induced mutations were defined as large interstitial deletional events (H4b and H11).

Although the discontinuous LOH mutants have a variety of patterns, it is assumed, at this time, that they have a single underlying cause. One possibility is that oxidative stress produces a markedly elevated rate of mitotic recombination. The formation of multiple deletional events is a second potential explanation. Complex deletional patterns for human chromosome 11 were observed in one study for untreated AL cells and when these cells were exposed to caffeine (13) . These "complex" deletions, however, were not induced by arsenite-stimulated ROS (8) or by ionizing radiation (13) , although continuous deletions were induced by these mutagenic agents. The AL system cannot detect recombinational events, which are readily detected when Aprt is used as the selectable locus.

Although there are no other reports of mutational spectra resembling discontinuous LOH in cultured cells, there are a variety of reports of similar mutational patterns in human cancers when specific chromosomes have been examined in detail. Recent examples include chromosomes 9 (14) and 18 (15) in head and neck cancers, chromosome 9 in lung cancer (16) , chromosome 13 in prostate cancer (17) , chromosome 3 in oral, cervix, breast, lung, and colorectal cancers (18 , 19) , chromosome 17 in breast cancer (20) , chromosome 16 in prostate cancer (21) , chromosome 8 in male breast cancer (22) , chromosome 11 in carcinoid cancer (23) , and chromosome 7 in myeloid cancers (24) . Some of these mutation patterns included homozygous deletions in addition to LOH events. Although there are many potential explanations for discontinuous LOH in these diverse cancers, including chromosomal instability genotypes (25) , this is the first time that a specific mutagenic agent that can cause oxidative damage has been shown to cause a similar mutational pattern. Therefore, it is feasible that oxidative damage plays a role in causing at least some discontinuous LOH mutations that have been reported in human cancers.

Finally, in this study, mutant selection was based on the loss of APRT activity, making Aprt the target locus in the hydrogen peroxide-treated KO6 cells. However, in many cases discrete distal and proximal loci were also affected, as revealed by the discontinuous pattern of LOH. Many times when discrete regions of LOH are observed on a given chromosome for a given cancer, it is assumed that multiple tumor suppressor genes are located on that chromosome. Moreover, it is assumed that the LOH event has affected loci on the chromosome bearing a wild type version of the putative tumor suppressor genes. Our data would suggest that interpretation of results is more complex when oxidative damage is responsible for the observed LOH events.


    ACKNOWLEDGMENTS
 
We thank Maura Pieretti for critical reading of the manuscript.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by NIH Grants CA56383 (to M. S. T.), PO 1 ES05652 (to P. J. S.), and DK38185 (to J. A. T.), and by a grant from the Oregon Medical Research Foundation (to M. S. T.). D. E. was supported by a CROET summer research fellowship. Back

2 To whom requests for reprints should be addressed, at CROET, L606, Oregon Health Sciences University, 3181 SW Sam Jackson Park Road, Portland, OR 97201. Phone: (503) 494-2168; Fax: (503) 494-6831; E-mail: turkerm{at}ohsu.edu Back

3 Present address: Department of Genetics, Rutgers University, Piscataway, NJ 08854. Back

4 The abbreviations used are: ROS, reactive oxygen species; LOH, loss of heterozygosity; DAP, 2,6-diaminopurine; Aprt, adenine phosphoribosyltransferase. Back

5 http://carbon.wi.mit.edu:8000/cgi-bin/mouse/index. Back

Received 11/25/98. Accepted 3/ 3/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Loft S., Poulsen H. E. Cancer risk and oxidative DNA damage in man. J. Mol. Med., 74: 297-312, 1996.[Medline]
  2. Li Y., Zhu H., Stansbury K. H., Trush M. A. Role of reactive oxygen species in multistage carcinogenesis Thomas C. E. Kalyanaram B. eds. . Oxygen Radicals and the Disease Process, : 237-277, Harwood Academic Publishers Amsterdam 1997.
  3. Gowen L. C., Avrutskaya A. V., Latour A. M., Koller B. H., Leadon S. A. BRCA1 required for transcription-coupled repair of oxidative DNA damage. Science (Washington DC), 281: 1009-1012, 1998.[Abstract/Free Full Text]
  4. Chevillard S., Radicella J. P., Levalois C., Lebeau J., Poupon M-F., Oudard S., Dutrillaux B., Boiteux S. Mutations in OGG1, a gene involved in the repair of oxidative DNA damage, are found in human lung and kidney tumors. Oncogene, 16: 3083-3086, 1998.[Medline]
  5. Reid T. M., Feig D. I., Loeb L. A. Mutagenesis by metal-induced oxygen radicals. Environ. Health Perspect., 3: 57-61, 1994.
  6. Solomon E., Borrow J., Goddard A. D. Chromosome aberrations and cancer. Science (Washington DC), 254: 1153-1160, 1991.[Abstract/Free Full Text]
  7. Jackson A. L., Chen R., Loeb L. A. Induction of microsatellite instability by oxidative DNA damage. Proc. Natl. Acad. Sci. USA, 95: 12468-12473, 1998.[Abstract/Free Full Text]
  8. Hei T. K., Liu S. X., Waldren C. Mutagenicity of arsenic in mammalian cells: role of reactive oxygen species. Proc. Natl. Acad. Sci. USA, 95: 8103-8107, 1998.[Abstract/Free Full Text]
  9. Turker M. S., Pieretti M., Kumar S. Molecular evidence for the induction of large interstitial deletions on mouse chromosome 8 by ionizing radiation. Mutat. Res., 374: 201-208, 1997.[Medline]
  10. Khattar N. H., Turker M. S. A role for certain mouse Aprt sequences in resistance to toxic adenine analogs. Somatic Cell Mol. Genet., 23: 51-61, 1997.[Medline]
  11. Horn P. L., Turker M. S., Ogburn C. E., Disteche C. M., Martin G. M. A cloning assay for 6-thioguanine resistance provides evidence against certain somatic mutational theories of aging. J. Cell. Physiol., 121: 309-315, 1984.[Medline]
  12. Stambrook P. J., Shao C., Stockelman M., Boivin G., Engle S. J., Tischfield J. A. APRT: a versatile in vivo resident reporter of local mutation and loss of heterozygosity. Environ. Mol. Mutagen., 28: 471-482, 1996.[Medline]
  13. McGuinness S. M., Shibuya M. L., Ueno A. M., Vannais D. B., Waldren C. A. Mutant quantity and quality in mammalian cells (AL) exposed to cesium-137 {gamma} radiation: effect of caffeine. Radiat. Res., 142: 247-255, 1995.[Medline]
  14. Waber P., Dlugosz S., Cheng Q-C., Truelson J., Nisen P. D. Genetic alterations of chromosome band 9p21–22 in head and neck cancer are not restricted to p16INK4a. Oncogene, 15: 1699-1704, 1997.[Medline]
  15. Papdimitrakopoulou V. A., Oh Y., El-Naggar A., Izzo J., Clayman G., Mao L. Presence of multiple incontiguous deleted regions at the long arm of chromosome 18 in head and neck cancer. Clin. Cancer Res., 4: 539-544, 1998.[Abstract]
  16. Kim S. K., Ro J. Y., Kemp B. L., Lee J. S., Kwon T. J., Fong K. M., Sekido Y., Minna J. D., Hong W. K., Mao L. Identification of three distinct tumor suppressor loci on the short arm of chromosome 9 in small cell lung cancer. Cancer Res., 57: 400-403, 1997.[Abstract/Free Full Text]
  17. Li C., Larsson C., Futreal A., Lancaster J., Phelan C., Aspenbland U., Sundelin B., Liu Y., Ekman P., Auer G., Bergerheim U. S. R. Identification of two distinct deleted regions on chromosome 13 in prostate cancer. Oncogene, 16: 481-487, 1998.[Medline]
  18. Boldog F., Gemmill R. M., West J., Robinson M., Robinson L., Li E., Roche J., Todd S., Waggoner B., Lundstrom R., Jacobson J., Mullokandov M. R., Klinger H., Drabkin H. A. Chromosome 3p14 homozygous deletions and sequence analysis of FRA3B. Hum. Mol. Genet., 6: 193-203, 1997.[Abstract/Free Full Text]
  19. Roz L., Wu C. L., Porter S., Scully C., Speight P., Read A., Sloan P., Thakker N. Allelic imbalance on chromosome 3p in oral dysplastic lesions: an early event in oral carcinogenesis. Cancer Res., 56: 1228-1231, 1996.[Abstract/Free Full Text]
  20. Phelan C. M., Borg A., Cuny M., Crichton D. N., Baldersson T., Ikdahl T., et al Consortium study on 1280 breast carcinomas: allelic loss on chromosome 17 targets subregions associated with family history and clinical parameters. Cancer Res., 58: 1004-1012, 1998.[Abstract/Free Full Text]
  21. Latil A., Cussenot O., Fournier G., Driouch K., Lidereau R. Loss of heterozygosity at chromosome 16q in prostate adenocarcinoma: identification of three independent regions. Cancer Res., 57: 1058-1062, 1997.[Abstract/Free Full Text]
  22. Chuaqui R. F., Sanz-Ortega J., Vocke C., Linehan W. M., Sanz-Esponera J., Zhuang Z., Emmert-Buck M. R., Merino M. J. Loss of heterozygosity on the short arm of chromosome 8 in male breast carcinomas. Cancer Res., 55: 4995-4998, 1995.[Abstract/Free Full Text]
  23. Jakobovitz O., Nass D., DeMarco L., Barbosa A. J. A., Simoni F. B., Richavi G., Friedman E. Carcinoid tumors frequently display genetic abnormalities involving chromosome 11. J. Clin. Endocrinol. Metab., 81: 3164-3167, 1996.[Abstract]
  24. Liang H., Fairman J., Claxton D. F., Nowell P. C., Green E. D., Nagarajan L. Molecular anatomy of chromosome 7q deletions in myeloid neoplasms: evidence for multiple critical loci. Proc. Natl. Acad. Sci. USA, 95: 3781-3785, 1998.[Abstract/Free Full Text]
  25. Lengauer C., Kinzler K. W., Vogelstein B. Genetic instability in colorectal cancers. Nature (Lond.), 386: 623-627, 1997.[Medline]



This article has been cited by other articles:


Home page
MutagenesisHome page
F. S. Van Osch, M. Piliguian, and K. A. Hill
Spontaneous mutation frequency is elevated in skin of harlequin (hq)/Big Blue(R) mice
Mutagenesis, January 20, 2010; (2010) gep069v1.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
T. Karasawa, Q. Wang, Y. Fu, D. M. Cohen, and P. S. Steyger
TRPV4 enhances the cellular uptake of aminoglycoside antibiotics
J. Cell Sci., September 1, 2008; 121(17): 2871 - 2879.
[Abstract] [Full Text] [PDF]


Home page
Sci Aging Knowl EnvironHome page
A. M. Skinner and M. S. Turker
Oxidative Mutagenesis, Mismatch Repair, and Aging
Sci. Aging Knowl. Environ., March 2, 2005; 2005(9): re3 - re3.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
M. S. COOKE, M. D. EVANS, M. DIZDAROGLU, and J. LUNEC
Oxidative DNA damage: mechanisms, mutation, and disease
FASEB J, July 1, 2003; 17(10): 1195 - 1214.
[Abstract] [Full Text] [PDF]


Home page
MutagenesisHome page
M. S. Turker
Autosomal mutation in somatic cells of the mouse
Mutagenesis, January 1, 2003; 18(1): 1 - 6.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. N. Ponomareva, J. A. Rose, M. Lasarev, J. Rasey, and M. S. Turker
Tissue-specific Deletion and Discontinuous Loss of Heterozygosity Are Signatures for the Mutagenic Effects of Ionizing Radiation in Solid Tissues
Cancer Res., March 1, 2002; 62(5): 1518 - 1523.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Maitra, I. I. Wistuba, C. Washington, A. K. Virmani, R. Ashfaq, S. Milchgrub, A. F. Gazdar, and J. D. Minna
High-Resolution Chromosome 3p Allelotyping of Breast Carcinomas and Precursor Lesions Demonstrates Frequent Loss of Heterozygosity and a Discontinuous Pattern of Allele Loss
Am. J. Pathol., July 1, 2001; 159(1): 119 - 130.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Girard, S. Zöchbauer-Müller, A. K. Virmani, A. F. Gazdar, and J. D. Minna
Genome-wide Allelotyping of Lung Cancer Identifies New Regions of Allelic Loss, Differences between Small Cell Lung Cancer and Non-Small Cell Lung Cancer, and Loci Clustering
Cancer Res., September 1, 2000; 60(17): 4894 - 4906.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
S. Zienolddiny, D. Ryberg, and A. Haugen
Induction of microsatellite mutations by oxidative agents in human lung cancer cell lines
Carcinogenesis, August 1, 2000; 21(8): 1521 - 1526.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. A. Rose, P. A. Yates, J. Simpson, J. A. Tischfield, P. J. Stambrook, and M. S. Turker
Biallelic Methylation and Silencing of Mouse Aprt in Normal Kidney Cells
Cancer Res., July 1, 2000; 60(13): 3404 - 3408.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
I. I. Wistuba, C. Behrens, A. K. Virmani, G. Mele, S. Milchgrub, L. Girard, J. W. Fondon III, H. R. Garner, B. McKay, F. Latif, et al.
High Resolution Chromosome 3p Allelotyping of Human Lung Cancer and Preneoplastic/Preinvasive Bronchial Epithelium Reveals Multiple, Discontinuous Sites of 3p Allele Loss and Three Regions of Frequent Breakpoints
Cancer Res., April 1, 2000; 60(7): 1949 - 1960.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. S. Turker, B. M. Gage, J. A. Rose, O. N. Ponomareva, J. A. Tischfield, P. J. Stambrook, C. Barlow, and A. Wynshaw-Boris
Solid Tissues Removed from Atm Homozygous Deficient Mice Do Not Exhibit a Mutator Phenotype for Second-Step Autosomal Mutations
Cancer Res., October 1, 1999; 59(19): 4781 - 4783.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Turker, M. S.
Right arrow Articles by Tischfield, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Turker, M. S.
Right arrow Articles by Tischfield, J. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online