| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Gastrointestinal Research Laboratory, Veteran Affairs Medical Center and Department of Medicine, University of California San Francisco, San Francisco, California 94121
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
5-Aza-2'-Deoxycytidine Treatment.
Cells were seeded at 2 x 105 cells/T75 flask on day 0. The cells were treated with 5, 10, or 15 µM 5-aza-2'-deoxycytidine for 24 h on days 2 and 5. The medium was changed 24 h after adding 5-aza-2'-deoxycytidine. Cells were harvested on day 8 for analysis of hMLH1 expression and methylation status of promoter.
MSI Analysis.
The MSI status of each cell line was determined through analysis of the BAT25 and BAT26 loci, as described by Thibodeau et al. (3)
. The DNA patterns were compared with those from an unaffected normal tissue (control). Because BAT25 and BAT26 patterns are essentially monomorphic within the human population, any difference reflects MSI (15)
. Thus, a cell line that showed variation with either marker was scored as MSI.
Sequencing of hMLH1 Gene.
Total RNA (1 µg) isolated from cell lines was reverse-transcribed using random hexanucleotides (Boehringer Mannheim) and SuperScript II reverse transcriptase (Life Technologies, Inc.) in a volume of 50 µl. After reverse transcription, 1 µl of cDNA was amplified separately by PCR using five primer sets (F1/R1, F2/R2, F3/R3, F4/R4, and F5/R5) that are designed to amplify five overlapping cDNA fragments covering the entire coding sequence of hMLH1. The sequences of the primers are: F1: 5'CTTGGCTCTTCTGGCGCCAA, R1: 5'CTCCTCGTGGCTATGTTGTAA; F2: 5'AGATCACGGTGGAGGACCTT, R2: 5'TCCTCGTGCAGGA-AGTGAAC; F3: 5'GTGCACCCCACAAAGCATGA, R3: 5'TTCCCGATGTCTCTTTCTGG; F4: 5'AGAGGACCTACTTCCAGCAA, R4: 5'TCT-CAGCCTTCTTCTTCAGAA; F5: 5'GAAGGACTTGCTGAATACATT, R5: 5'CCCACAGTGCATAAATAACCAT. The RT-PCR products were purified by electrophoresis on a 1.5% agarose gel and eluted with QIAquick gel extraction kit (Qiagen). One-third of the eluted DNA was mixed with 5 pmol of the corresponding primer and sequenced on an ABI sequencer with dye terminators (Applied Biosystem).
Determination of hMLH1 mRNA Expression.
RNA isolated from each cell line was reverse-transcribed as described above. cDNA (1 µl) was amplified by PCR, together with two primer sets. The first set was used for amplifying a 196-bp fragment spanning exons 13 of the hMLH1 gene (F: 5'CAGCGGCCAGCTAATGCTAT, R: 5'AATCCTCAAAGGACTGCAG-TT). The second primer set was for amplifying a ß-actin fragment, with the size of 242 bp, as an internal control (F: 5' TCACCAACTGGGACGACATG, R: 5'ACCGGAGTCCATCACGATG). The RT-PCR products were analyzed by electrophoresis on a 2% agarose gel, followed by ethidium bromide staining. The amount of each fragment was determined with a densitometer. The RNA expression level was represented as the ratio of the amount of hMLH1 fragment over ß -actin.
DNA Methylation Analysis.
The NaHSO3 treatment-sequencing procedure, as described by Clark et al. (16)
, was applied to determine the methylation status of all CpG sites in the hMLH1 promoter (bases -711 to +15, relative to the start of transcription). DNA (1 µg) was diluted in 50 µl of 10 mM Tris-HCl (pH7.6), 1 mM EDTA, and 0.3 N NaOH and incubated at 37°C for 15 min. Hydroquinone (30 µl of 10 mM) and 520 µl of 3.6 M NaHSO3 (pH5.05) were added to the denatured DNA solution. The tube was incubated at 55°C for 16 h. The NaHSO3-treated DNA was purified using the Wizard DNA clean-up system (Promega), denatured by 0.3 N NaOH, precipitated with ethanol, and dissolved in 20 µl of 10 mM Tris-HCl (pH7.6) and 0.1 mM EDTA. DNA (1 µl) was amplified by PCR separately in 50 µl with three primer sets, PF1/PR1, PF2/PR2, and PF3/PR3, which can amplify three overlapping fragments covering the region from -766 to +15. The sequences of primers are: PF1: 5'TTTTAGTTGTGATTTTTTAAGGTT, PR1: 5'AAAACAATAAAACCCTATACCTAA; PF2: 5'GTGATAGATTAGGTATAGGGTT, PR2: 5'AATATCCAACCAATAAAAACAAAAATA; PF3: 5' ATTATTTTAGTAGAGGTATATAAGT, PR3: 5'CCCTACCACAAACAACATTTTAA. The amplified fragments were separated on a 1.5% agarose gel and eluted using a QIAquick gel extraction kit (Qiagen). One-third of the DNA was mixed with 5 pmol of primer and sequenced on an ABI sequencer with dye terminators (Applied Biosystem). This procedure results in the conversion of unmethylated cytosine to thymine, whereas the methylated cytosine was not affected. Thus, the ratio of peak height of C to T at a CpG site indicates the ratio of methylated to unmethylated cytosine. The quotient of C over C+T indicates the percentage of methylation. DNA methylation was also measured by HpaII digestion and MSP, as described (12
, 13)
.
| Results and Discussion |
|---|
|
|
|---|
|
|
5-Aza-2'-Deoxycytidine Treatment Leads to Reexpression of hMLH1 and Demethylation of Its Promoter.
To confirm the critical role of methylation of CpG sites in region C (-248 to -178), four cell lines that did not express hMLH1 (C1a, VACO5, RKO, and C) were treated with 5, 10, or 15 µ M 5-aza-2'-deoxycytidine. hMLH1 expression was detected in all four cell lines after the treatment. The expression levels were dependent on the cell type and dosage of 5-aza-2'-deoxycytidine. In cell lines C1a and C, 5 µM 5-aza-2' -deoxycytidine induced the expression of hMLH1 to the level of normal-expressing cell line LS123. In cell lines RKO and VACO5, the expression levels of hMLH1 induced by 5 µM 5-aza-2'-deoxycytidine was low, but levels increased when the dosage was raised to 10 or 15 µM (Fig. 2)
. In SW48, the expression level of hMLH1 induced by 10 µM was also higher than 5 µ M (data not shown).
|
|
Sp1 element is a DNA sequence to which the transcription factor Sp1 binds. The 10-bp consensus sequence of the Sp1 element is (G/T)(G/A)GG(C/A)G(G/T)(G/A)(G/A)(C/T), and its core sequences are GGGCGG or GGCGGG. Recent studies have shown that CpG sites in promoter regions are protected from methylation by a cluster of Sp1 elements in a variety of genes (19 , 20) . By comparing the consensus and the core sequences of Sp1 element with the 5' flanking region of hMLH1 (from - 711 to +15), we identified nine Sp1 elements that were located at -658, -580, -547, -461, -441, - 393, -366, -182, and -85, respectively. Seven of the nine Sp1 elements are located in regions A and B. This is consistent with the recent discovery that the methylated flanks of promoters are segregated from the unmethylated CpG sites by an Sp1-rich boundary region (20) . The cluster of Sp1 elements in the hMLH1 promoter region suggests that Sp1 may be involved in regulation of hMLH1 gene expression in a mechanism involving methylation. Additional experiments are necessary to determine the differences in Sp1 binding between the cells that do and do not express hMLH1.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 To whom requests for reprints should be addressed, at Gastrointestinal Research Laboratory, 151 M2, Veteran Affairs Medical Center and University of California San Francisco, 4150 Clement Street, San Francisco, CA 94121. Phone: (415) 221-4810, ext. 3401; Fax: (415) 750-6972. ![]()
3 The abbreviations used are: MMR, mismatch repair; MSI, microsatellite instability; MSP, methylation-specific PCR; RT-PCR, reverse transcription-PCR. ![]()
Received 12/18/98. Accepted 3/19/99.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. E. Varley, D. G. Mutch, T. B. Edmonston, P. J. Goodfellow, and R. D. Mitra Intra-tumor heterogeneity of MLH1 promoter methylation revealed by deep single molecule bisulfite sequencing Nucleic Acids Res., June 3, 2009; (2009) gkp457v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tang and E. Goldberg Homo sapiens Lactate Dehydrogenase c (Ldhc) Gene Expression in Cancer Cells Is Regulated by Transcription Factor Sp1, CREB, and CpG Island Methylation J Androl, March 1, 2009; 30(2): 157 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deng, S. Kakar, K. Okudiara, E. Choi, M. H. Sleisenger, and Y. S. Kim Unique Methylation Pattern of Oncostatin M Receptor Gene in Cancers of Colorectum and Other Digestive Organs Clin. Cancer Res., March 1, 2009; 15(5): 1519 - 1526. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hampel, W. L. Frankel, E. Martin, M. Arnold, K. Khanduja, P. Kuebler, M. Clendenning, K. Sotamaa, T. Prior, J. A. Westman, et al. Feasibility of Screening for Lynch Syndrome Among Patients With Colorectal Cancer J. Clin. Oncol., December 10, 2008; 26(35): 5783 - 5788. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Joensuu, W. M. Abdel-Rahman, M. Ollikainen, S. Ruosaari, S. Knuutila, and P. Peltomaki Epigenetic Signatures of Familial Cancer Are Characteristic of Tumor Type and Family Category Cancer Res., June 15, 2008; 68(12): 4597 - 4605. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Shaw, G. L. Hall, D. Lowe, T. Liloglou, J. K. Field, P. Sloan, and J. M. Risk The Role of Pyrosequencing in Head and Neck Cancer Epigenetics: Correlation of Quantitative Methylation Data With Gene Expression Arch Otolaryngol Head Neck Surg, March 1, 2008; 134(3): 251 - 256. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Li, L. Da, H. Tang, T. Li, and M. Zhao CpG methylation plays a vital role in determining tissue- and cell-specific expression of the human cell-death-inducing DFF45-like effector A gene through the regulation of Sp1/Sp3 binding Nucleic Acids Res., January 17, 2008; 36(1): 330 - 341. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. P. Hitchins, V. A. Lin, A. Buckle, K. Cheong, N. Halani, S. Ku, C.-T. Kwok, D. Packham, C. M. Suter, A. Meagher, et al. Epigenetic Inactivation of a Cluster of Genes Flanking MLH1 in Microsatellite-Unstable Colorectal Cancer Cancer Res., October 1, 2007; 67(19): 9107 - 9116. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Svrcek, J. El-Bchiri, A. Chalastanis, E. Capel, S. Dumont, O. Buhard, C. Oliveira, R. Seruca, C. Bossard, J.-F. Mosnier, et al. Specific Clinical and Biological Features Characterize Inflammatory Bowel Disease Associated Colorectal Cancers Showing Microsatellite Instability J. Clin. Oncol., September 20, 2007; 25(27): 4231 - 4238. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bettstetter, S. Dechant, P. Ruemmele, M. Grabowski, G. Keller, E. Holinski-Feder, A. Hartmann, F. Hofstaedter, and W. Dietmaier Distinction of Hereditary Nonpolyposis Colorectal Cancer and Sporadic Microsatellite-Unstable Colorectal Cancer through Quantification of MLH1 Methylation by Real-time PCR Clin. Cancer Res., June 1, 2007; 13(11): 3221 - 3228. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. J. Greenspan, J. L. Cyr, D. C. Pleau, J. Levine, T. V. Rajan, D. W. Rosenberg, and C. D. Heinen Microsatellite instability in aberrant crypt foci from patients without concurrent colon cancer Carcinogenesis, April 1, 2007; 28(4): 769 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gonzalez-Paz, W. J. Chng, R. F. McClure, E. Blood, M. M. Oken, B. V. Ness, C. D. James, P. J. Kurtin, K. Henderson, G. J. Ahmann, et al. Tumor suppressor p16 methylation in multiple myeloma: biological and clinical implications Blood, February 1, 2007; 109(3): 1228 - 1232. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hampel, W. Frankel, J. Panescu, J. Lockman, K. Sotamaa, D. Fix, I. Comeras, J. La Jeunesse, H. Nakagawa, J. A. Westman, et al. Screening for Lynch Syndrome (Hereditary Nonpolyposis Colorectal Cancer) among Endometrial Cancer Patients. Cancer Res., August 1, 2006; 66(15): 7810 - 7817. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Novakovic, J. M. Stempak, K.-J. Sohn, and Y.-I. Kim Effects of folate deficiency on gene expression in the apoptosis and cancer pathways in colon cancer cells Carcinogenesis, May 1, 2006; 27(5): 916 - 924. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Cheng, C. Shawber, D. Notterman, P. Paty, and F. Barany Multiplexed profiling of candidate genes for CpG island methylation status using a flexible PCR/LDR/Universal Array assay Genome Res., February 1, 2006; 16(2): 282 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Matsuzaki, G. Deng, H. Tanaka, S. Kakar, S. Miura, and Y. S. Kim The Relationship between Global Methylation Level, Loss of Heterozygosity, and Microsatellite Instability in Sporadic Colorectal Cancer Clin. Cancer Res., December 15, 2005; 11(24): 8564 - 8569. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. O. Woods, A. J. Hyde, F. K. Curtis, S. Stuckless, J. S. Green, A. F. Pollett, J. D. Robb, R. C. Green, M. E. Croitoru, A. Careen, et al. High Frequency of Hereditary Colorectal Cancer in Newfoundland Likely Involves Novel Susceptibility Genes Clin. Cancer Res., October 1, 2005; 11(19): 6853 - 6861. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hampel, W. L. Frankel, E. Martin, M. Arnold, K. Khanduja, P. Kuebler, H. Nakagawa, K. Sotamaa, T. W. Prior, J. Westman, et al. Screening for the Lynch Syndrome (Hereditary Nonpolyposis Colorectal Cancer) N. Engl. J. Med., May 5, 2005; 352(18): 1851 - 1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Petko, M. Ghiassi, A. Shuber, J. Gorham, W. Smalley, M. K. Washington, S. Schultenover, S. Gautam, S. D. Markowitz, and W. M. Grady Aberrantly Methylated CDKN2A, MGMT, and MLH1 in Colon Polyps and in Fecal DNA from Patients with Colorectal Polyps Clin. Cancer Res., February 1, 2005; 11(3): 1203 - 1209. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Umetani, H. Takeuchi, A. Fujimoto, M. Shinozaki, A. J. Bilchik, and D. S. B. Hoon Epigenetic Inactivation of ID4 in Colorectal Carcinomas Correlates with Poor Differentiation and Unfavorable Prognosis Clin. Cancer Res., November 15, 2004; 10(22): 7475 - 7483. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Oliveira, J. L. Westra, D. Arango, M. Ollikainen, E. Domingo, A. Ferreira, S. Velho, R. Niessen, K. Lagerstedt, P. Alhopuro, et al. Distinct patterns of KRAS mutations in colorectal carcinomas according to germline mismatch repair defects and hMLH1 methylation status Hum. Mol. Genet., October 1, 2004; 13(19): 2303 - 2311. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Kim, K. H. Lee, I. H. Ka, K. H. Koo, S. A. Roh, H. C. Kim, C. S. Yu, T. W. Kim, H. M. Chang, G. Y. Gong, et al. Characterization of Mutator Phenotype in Familial Colorectal Cancer Patients Not Fulfilling Amsterdam Criteria Clin. Cancer Res., September 15, 2004; 10(18): 6159 - 6168. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deng, G.-A. Song, E. Pong, M. Sleisenger, and Y. S. Kim Promoter Methylation Inhibits APC Gene Expression by Causing Changes in Chromatin Conformation and Interfering with the Binding of Transcription Factor CCAAT-Binding Factor Cancer Res., April 15, 2004; 64(8): 2692 - 2698. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deng, I. Bell, S. Crawley, J. Gum, J. P. Terdiman, B. A. Allen, B. Truta, M. H. Sleisenger, and Y. S. Kim BRAF Mutation Is Frequently Present in Sporadic Colorectal Cancer with Methylated hMLH1, But Not in Hereditary Nonpolyposis Colorectal Cancer Clin. Cancer Res., January 1, 2004; 10(1): 191 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Mariadason, D. Arango, Q. Shi, A. J. Wilson, G. A. Corner, C. Nicholas, M. J. Aranes, M. Lesser, E. L. Schwartz, and L. H. Augenlicht Gene Expression Profiling-Based Prediction of Response of Colon Carcinoma Cells to 5-Fluorouracil and Camptothecin Cancer Res., December 15, 2003; 63(24): 8791 - 8812. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Diergaarde, H. Braam, G. N. P. van Muijen, M. J. L. Ligtenberg, F. J. Kok, and E. Kampman Dietary Factors and Microsatellite Instability in Sporadic Colon Carcinomas Cancer Epidemiol. Biomarkers Prev., November 1, 2003; 12(11): 1130 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Ward, K. Cheong, S.-L. Ku, A. Meagher, T. O'Connor, and N. J. Hawkins Adverse Prognostic Effect of Methylation in Colorectal Cancer Is Reversed by Microsatellite Instability J. Clin. Oncol., October 15, 2003; 21(20): 3729 - 3736. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. T. Warnick, B. Dabbas, S. J. Ilstrup, C. D. Ford, and K. A. Strait Cell Type-Dependent Regulation of hMLH1 Promoter Activity Is Influenced by the Presence of Multiple Redundant Elements Mol. Cancer Res., June 1, 2003; 1(8): 610 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bariol, C. Suter, K. Cheong, S.-L. Ku, A. Meagher, N. Hawkins, and R. Ward The Relationship between Hypomethylation and CpG Island Methylation in Colorectal Neoplasia Am. J. Pathol., April 1, 2003; 162(4): 1361 - 1371. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Deng, W.'e. El-Rifai, J. Ji, B. Zhu, P. Trampont, J. Li, M. F. Smith, and S. M. Powel Hypermethylation of metallothionein-3 CpG island in gastric carcinoma Carcinogenesis, January 1, 2003; 24(1): 25 - 29. [Abstract] [Full Text] [PDF] |
||||
![]() |
N J Maughan and P Quirke Pathology - a molecular prognostic approach: Advances in colorectal cancer Br. Med. Bull., December 1, 2002; 64(1): 59 - 74. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goffin and E. Eisenhauer DNA methyltransferase inhibitors--state of the art Ann. Onc., November 1, 2002; 13(11): 1699 - 1716. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gazzoli, M. Loda, J. Garber, S. Syngal, and R. D. Kolodner A Hereditary Nonpolyposis Colorectal Carcinoma Case Associated with Hypermethylation of the MLH1 Gene in Normal Tissue and Loss of Heterozygosity of the Unmethylated Allele in the Resulting Microsatellite Instability-High Tumor Cancer Res., July 15, 2002; 62(14): 3925 - 3928. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kohya, K. Miyazaki, S. Matsukura, H. Yakushiji, Y. Kitajima, K. Kitahara, M. Fukuhara, Y. Nakabeppu, and M. Sekiguchi Deficient Expression of O6-Methylguanine-DNA Methyltransferase Combined With Mismatch-Repair Proteins hMLH1 and hMSH2 Is Related to Poor Prognosis in Human Biliary Tract Carcinoma Ann. Surg. Oncol., May 1, 2002; 9(4): 371 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Deng, G. Deng, M. F. Smith, J. Zhou, H. Xin, S. M. Powell, and Y. Lu Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography Nucleic Acids Res., February 1, 2002; 30(3): e13 - e13. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nakagawa, G. J. Nuovo, E. E. Zervos, E. W. Martin Jr., R. Salovaara, L. A. Aaltonen, and A. de la Chapelle Age-related Hypermethylation of the 5' Region of MLH1 in Normal Colonic Mucosa Is Associated with Microsatellite-unstable Colorectal Cancer Development Cancer Res., October 1, 2001; 61(19): 6991 - 6995. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F Costello and C. Plass Methylation matters J. Med. Genet., May 1, 2001; 38(5): 285 - 303. [Abstract] [Full Text] |
||||
![]() |
M. M. Pao, M. Tsutsumi, G. Liang, E. Uzvolgyi, F. A. Gonzales, and P. A. Jones The endothelin receptor B (EDNRB) promoter displays heterogeneous, site specific methylation patterns in normal and tumor cells Hum. Mol. Genet., April 1, 2001; 10(9): 903 - 910. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamamoto, F. Itoh, H. Nakamura, H. Fukushima, S. Sasaki, M. Perucho, and K. Imai Genetic and Clinical Features of Human Pancreatic Ductal Adenocarcinomas with Widespread Microsatellite Instability Cancer Res., April 1, 2001; 61(7): 3139 - 3144. [Abstract] [Full Text] |
||||
![]() |
A. K. Virmani, C. Muller, A. Rathi, S. Zoechbauer-Mueller, M. Mathis, and A. F. Gazdar Aberrant Methylation during Cervical Carcinogenesis Clin. Cancer Res., March 1, 2001; 7(3): 584 - 589. [Abstract] [Full Text] |
||||
![]() |
W. M. Grady, A. Rajput, J. D. Lutterbaugh, and S. D. Markowitz Detection of Aberrantly Methylated hMLH1 Promoter DNA in the Serum of Patients with Microsatellite Unstable Colon Cancer Cancer Res., February 1, 2001; 61(3): 900 - 902. [Abstract] [Full Text] |
||||
![]() |
H. B. Salvesen, N. MacDonald, A. Ryan, O. E. Iversen, I. J. Jacobs, L. A. Akslen, and S. Das Methylation of hMLH1 in a Population-based Series of Endometrial Carcinomas Clin. Cancer Res., September 1, 2000; 6(9): 3607 - 3613. [Abstract] [Full Text] |
||||
![]() |
S. A. Kuismanen, M. T. Holmberg, R. Salovaara, A. de la Chapelle, and P. Peltomaki Genetic and Epigenetic Modification of MLH1 Accounts for a Major Share of Microsatellite-Unstable Colorectal Cancers Am. J. Pathol., May 1, 2000; 156(5): 1773 - 1779. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ueki, M. Toyota, T. Sohn, C. J. Yeo, J.-P. J. Issa, R. H. Hruban, and M. Goggins Hypermethylation of Multiple Genes in Pancreatic Adenocarcinoma Cancer Res., April 1, 2000; 60(7): 1835 - 1839. [Abstract] [Full Text] |
||||
![]() |
T. R. Devereux, I. Horikawa, C. H. Anna, L. A. Annab, C. A. Afshari, and J. C. Barrett DNA Methylation Analysis of the Promoter Region of the Human Telomerase Reverse Transcriptase (hTERT) Gene Cancer Res., December 1, 1999; 59(24): 6087 - 6090. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Kuismanen, M. T. Holmberg, R. Salovaara, P. Schweizer, L. A. Aaltonen, A. de la Chapelle, M. Nystrom-Lahti, and P. Peltomaki Epigenetic phenotypes distinguish microsatellite-stable and -unstable colorectal cancers PNAS, October 26, 1999; 96(22): 12661 - 12666. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nakagawa, R. B. Chadwick, P. Peltomaki, C. Plass, Y. Nakamura, and A. de la Chapelle From the Cover: Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer PNAS, January 16, 2001; 98(2): 591 - 596. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |