Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

[Cancer Research 59, 2029-2023, May 1, 1999]
© 1999 American Association for Cancer Research

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
[Cancer Research 59, 2029-2023, May 1, 1999]
© 1999 American Association for Cancer Research


Advances in Brief

Methylation of CpG in a Small Region of the hMLH1 Promoter Invariably Correlates with the Absence of Gene Expression1

Guoren Deng2, Ada Chen, Joe Hong, Hiun Suk Chae and Young S. Kim

Gastrointestinal Research Laboratory, Veteran Affairs Medical Center and Department of Medicine, University of California San Francisco, San Francisco, California 94121


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Microsatellite instability (MSI) has been described in tumors from patients with hereditary nonpolyposis colorectal cancer, sporadic colorectal cancer, and other types of cancers. MSI is caused by the dysfunction of mismatch repairs genes. Loss of expression and mutation in one of the major mismatch repair genes, hMLH1, and the methylation of CpG sites in its promoter occur frequently in primary tumors and cell lines of colorectal cancer with MSI. To understand the mechanisms involved in the silencing of hMLH1 expression by methylation, we examined the methylation status of all CpG sites in the hMLH1 promoter in 24 colorectal cancer cell lines by the NaHSO3-sequencing method. We identified a small proximal region (-248 to - 178, relative to the transcription start site) in the promoter in which the methylation status invariably correlates with the lack of hMLH1 expression. This correlation was further supported by the observation that cell lines that showed methylation-suppressed hMLH1 expression can be induced to reexpress hMLH1 by a methyl transferase inhibitor, 5-aza-2'-deoxycytidine, and the small region that we identified exhibited significant demethylation in all cell lines examined.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
MMR3 is an important mechanism by which cells correct errors in DNA replication during proliferation to maintain the fidelity of the genome. Cells with MMR defects show mutation rates up to 1000-fold greater than those observed in normal cells. The mutator phenotype, which can be measured by MSI analysis, has been detected in tumors from patients with hereditary nonpolyposis colorectal cancer (1 , 2) , sporadic colorectal cancer (1, 2, 3, 4) , and other types of cancers. Thus far, two major genes, hMLH1 and hMSH2, as well as hMSH3, hMSH6, and hPMS2, have been cloned and demonstrated to participate in DNA MMR (5 , 6) . Germline mutations or somatic mutations in these genes give rise to nonfunctional gene products, leading to the mutator phenotype (7 , 8) . More recently, immunohistochemical analysis has demonstrated that loss of expression of MMR genes (mainly hMLH1) occurs frequently in sporadic colon cancers with MSI (9 , 10) . The loss of hMLH1 expression was further shown to correlate with cytosine methylation of CpG sites in its promoter in colon cancer cell lines and tissues (11, 12, 13, 14) . The epigenetic silencing of hMLH1 by methylation has been shown to be a common route leading to the genesis of MSI in colon cancers. Methylation-sensitive enzyme (e.g., HpaII) digestion and MSP have been successfully applied to determine the methylation status of the hMLH1 promoter (11, 12, 13, 14) . However, methylation-sensitive enzyme digestion can identify only those CpG sites in enzyme-recognition-sequences and, therefore, fails to recognize most CpG sites. Similarly, the MSP method can analyze only two CpG sites at the 3' ends of each of the two PCR primers. To characterize precisely the regions involved in the epigenetic silencing of hMLH1, we have conducted the NaHSO3 treatment-sequencing method for methylation analysis of hMLH1 promoter. In our study, we examined MSI, mutation and expression of hMLH1 gene, and methylation status of hMLH1 promoter in 24 colorectal cancer cell lines. By looking at hMLH1 expression and methylation status of all CpG sites in the promoter, we identified a small proximal region (-248 to -178 relative to the transcription start site) in the promoter in which the methylation status invariably correlates with the lack of hMLH1 expression. This correlation was further supported by the observation that cell lines that showed methylation-suppressed hMLH1 expression can be induced to reexpress hMLH1 by a methyl transferase inhibitor, 5-aza-2' -deoxycytidine. The small region we identified was demethylated by this treatment, as well. Methylation of a more upstream region seemed not to be critical for gene silencing because partial methylation was detected in this area in cell lines that showed normal hMLH1 expression.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Cell Lines.
Colorectal carcinoma cell lines SW1116, HCT8, Colo201, Colo320, CaCo2, SW1463, HRT18, HT29, SW620, LS123, LS174T, HCT116, SW48, Lovo, and H498 were obtained from American Type Culture Collection (Manassas, VA). Cell lines VACO5, VACO6, VACO411, and VACO10P were kindly provided by Dr. Sanford D. Markowitz. Cell lines RW2982 and RW7213 were from Dr. Lance M. Tibbetts. Cell line C1a was derived from 5583s, provided by Dr. Fred T. Bosman. RKO and C cells were from Dr. Michael Brattain. Cells were grown in DMEM supplemented with 10% fetal bovine serum at 37°C with 5% CO2 atmosphere.

5-Aza-2'-Deoxycytidine Treatment.
Cells were seeded at 2 x 105 cells/T75 flask on day 0. The cells were treated with 5, 10, or 15 µM 5-aza-2'-deoxycytidine for 24 h on days 2 and 5. The medium was changed 24 h after adding 5-aza-2'-deoxycytidine. Cells were harvested on day 8 for analysis of hMLH1 expression and methylation status of promoter.

MSI Analysis.
The MSI status of each cell line was determined through analysis of the BAT25 and BAT26 loci, as described by Thibodeau et al. (3) . The DNA patterns were compared with those from an unaffected normal tissue (control). Because BAT25 and BAT26 patterns are essentially monomorphic within the human population, any difference reflects MSI (15) . Thus, a cell line that showed variation with either marker was scored as MSI.

Sequencing of hMLH1 Gene.
Total RNA (1 µg) isolated from cell lines was reverse-transcribed using random hexanucleotides (Boehringer Mannheim) and SuperScript II reverse transcriptase (Life Technologies, Inc.) in a volume of 50 µl. After reverse transcription, 1 µl of cDNA was amplified separately by PCR using five primer sets (F1/R1, F2/R2, F3/R3, F4/R4, and F5/R5) that are designed to amplify five overlapping cDNA fragments covering the entire coding sequence of hMLH1. The sequences of the primers are: F1: 5'CTTGGCTCTTCTGGCGCCAA, R1: 5'CTCCTCGTGGCTATGTTGTAA; F2: 5'AGATCACGGTGGAGGACCTT, R2: 5'TCCTCGTGCAGGA-AGTGAAC; F3: 5'GTGCACCCCACAAAGCATGA, R3: 5'TTCCCGATGTCTCTTTCTGG; F4: 5'AGAGGACCTACTTCCAGCAA, R4: 5'TCT-CAGCCTTCTTCTTCAGAA; F5: 5'GAAGGACTTGCTGAATACATT, R5: 5'CCCACAGTGCATAAATAACCAT. The RT-PCR products were purified by electrophoresis on a 1.5% agarose gel and eluted with QIAquick gel extraction kit (Qiagen). One-third of the eluted DNA was mixed with 5 pmol of the corresponding primer and sequenced on an ABI sequencer with dye terminators (Applied Biosystem).

Determination of hMLH1 mRNA Expression.
RNA isolated from each cell line was reverse-transcribed as described above. cDNA (1 µl) was amplified by PCR, together with two primer sets. The first set was used for amplifying a 196-bp fragment spanning exons 1–3 of the hMLH1 gene (F: 5'CAGCGGCCAGCTAATGCTAT, R: 5'AATCCTCAAAGGACTGCAG-TT). The second primer set was for amplifying a ß-actin fragment, with the size of 242 bp, as an internal control (F: 5' TCACCAACTGGGACGACATG, R: 5'ACCGGAGTCCATCACGATG). The RT-PCR products were analyzed by electrophoresis on a 2% agarose gel, followed by ethidium bromide staining. The amount of each fragment was determined with a densitometer. The RNA expression level was represented as the ratio of the amount of hMLH1 fragment over ß -actin.

DNA Methylation Analysis.
The NaHSO3 treatment-sequencing procedure, as described by Clark et al. (16) , was applied to determine the methylation status of all CpG sites in the hMLH1 promoter (bases -711 to +15, relative to the start of transcription). DNA (1 µg) was diluted in 50 µl of 10 mM Tris-HCl (pH7.6), 1 mM EDTA, and 0.3 N NaOH and incubated at 37°C for 15 min. Hydroquinone (30 µl of 10 mM) and 520 µl of 3.6 M NaHSO3 (pH5.05) were added to the denatured DNA solution. The tube was incubated at 55°C for 16 h. The NaHSO3-treated DNA was purified using the Wizard DNA clean-up system (Promega), denatured by 0.3 N NaOH, precipitated with ethanol, and dissolved in 20 µl of 10 mM Tris-HCl (pH7.6) and 0.1 mM EDTA. DNA (1 µl) was amplified by PCR separately in 50 µl with three primer sets, PF1/PR1, PF2/PR2, and PF3/PR3, which can amplify three overlapping fragments covering the region from -766 to +15. The sequences of primers are: PF1: 5'TTTTAGTTGTGATTTTTTAAGGTT, PR1: 5'AAAACAATAAAACCCTATACCTAA; PF2: 5'GTGATAGATTAGGTATAGGGTT, PR2: 5'AATATCCAACCAATAAAAACAAAAATA; PF3: 5' ATTATTTTAGTAGAGGTATATAAGT, PR3: 5'CCCTACCACAAACAACATTTTAA. The amplified fragments were separated on a 1.5% agarose gel and eluted using a QIAquick gel extraction kit (Qiagen). One-third of the DNA was mixed with 5 pmol of primer and sequenced on an ABI sequencer with dye terminators (Applied Biosystem). This procedure results in the conversion of unmethylated cytosine to thymine, whereas the methylated cytosine was not affected. Thus, the ratio of peak height of C to T at a CpG site indicates the ratio of methylated to unmethylated cytosine. The quotient of C over C+T indicates the percentage of methylation. DNA methylation was also measured by HpaII digestion and MSP, as described (12 , 13) .


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
MSI, hMLH1 Expression, and Mutation Analysis of Colorectal Cancer Cell Lines.
Twenty-four colorectal cancer cell lines were analyzed for MSI, hMLH1 expression, and hMLH1 mutations (Table 1)Citation . Fifteen of 24 cell lines (63%) were microsatellite stable. The other nine cell lines showed MSI. hMLH1 was expressed in 18 of 24 cell lines (75%), with 6 cell lines not expressing message, as determined using the sensitive RT-PCR method. hMLH1 mutation data were obtained by sequencing or collected from published data. In all 15 cell lines that were microsatellite stable, hMLH1 was expressed and no mutation in hMLH1 was detected. Mutations in hMLH1 or hMSH2 and lack of hMLH1 expression were observed in all of the nine cell lines that showed MSI. Cell lines LS174T, C1a, and HCT116 showed hMLH1 mutations (the mutations in LS174T and Cla were determined in this study). Missense mutations were observed in LS174T and C1a, whereas a nonsense mutation was detected in HCT116. hMLH1 expression was observed in LS174T and HCT116, but not in C1a. In other six cell lines with MSI, five cell lines (SW48, VACO5, VACO6, RKO, and C) showed wild-type hMLH1, but did not express hMLH1. Cell line Lovo, showing MSI, had wild-type hMLH1 and expressed hMLH1. But a truncated hMSH2 gene (exons 4–8) was observed in this cell line (17) . Thus, the absence of hMLH1 expression observed in six of nine cell lines with MSI indicates that the silencing of hMLH1 is an important mechanism leading to MSI.


View this table:
[in this window]
[in a new window]

 
Table 1 MSI, hMLH1 mutations, expression, and methylation status in human colorectal cancer cell lines

 
Methylation of CpG Sites in -248 to -178 Region of hMLH1 Promoter Correlates with Loss of hMLH1 Expression.
Methylation status in the region from -711 to +15 of hMLH1 promoter in each of the 24 colorectal cancer cell lines was determined by the NaHSO3-sequencing technique. Of all 18 cell lines that expressed hMLH1, 14 cell lines showed no methylation of CpG sites in the region from -552 to +15 and partial methylation in the region from -711 to -577 (Fig. 1A)Citation . In the other four cell lines showing normal hMLH1 expression (HT29, SW620, LS123, and LS174T), there was no methylation in the proximal area either, but the partially methylated region extended to the CpG sites at -320, -505, -357, and -510, respectively. The six cell lines that did not express hMLH1 (C1a, SW48, VACO5, VACO6, RKO, and C) showed varying degrees of methylation in the entire region from -711 to +15. However, 100% methylation was observed in the region from -248 to -178 in all six cell lines (Fig. 1B)Citation . To summarize the data, we divided the promoter area into four regions [A (from - 711 to -577, containing 23 CpG sites), B (from -552 to -266, 19 CpG sites), C (from -248 to -178, 8 CpG sites), and D (from -109 to +15, 7 CpG sites)] and averaged the percentages of methylation at all CpG sites in each of the four regions (Table 1)Citation . We then examined the relationship between the methylation status in regions A, B, C, and D in each of the 24 cell lines and the hMLH1 expression. Methylation in region A seemed not to be critical in silencing the gene expression because all 18 cell lines with normal expression showed methylation in this area (Table 1Citation and Fig. 1ACitation ). On the other hand, methylation in region C seemed to play an important role in silencing hMLH1 expression because all 18 cell lines that expressed hMLH1 showed no methylation and the 6 cell lines that did not express hMLH1 showed full methylation in this region (Table 1Citation and Fig. 1Citation ). Methylation in regions B and D may also be important in silencing hMLH1 expression, but methylation in these regions did not provide the best correlation between the methylation status and hMLH1 expression. Four of 18 cell lines with normal hMLH1 expression (HT29, SW620, LS123, and LS174T) showed methylation in region B, and methylation percentages in region D were lower than those in region C in all but one cell line (VACO5) that did not express hMLH1 genes (Table 1Citation and Fig. 1Citation ). From these results, we conclude that methylation status of CpG sites in region C provides the best correlation and prediction of hMLH1 expression.



View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Methylation status of the hMLH1 promoter between bases -711 and +15 in 24 colorectal cancer cell lines. The percentage of methylation at each CpG site was plotted against its position in the promoter. The CpG sites are at bases -711, -702, -694, -688, -674, -672, - 670, -666, -663, -659, -649, -645, -636, -624, -616, -609, -606, - 604, -600, -598, -588, -580, -577, -552, -545, -523, -510, -505, - 489, -486, -461, -445, -420, -408, -380, -364, -357, -326, -320, - 289, -280, -266, -248, -241, -231, -229, -223, -204, -193, -178, - 109, -86, -62, -54, -21, -6, and + 15. The locations of the CpG sites are not drawn to scale. A, methylation status in cell lines SW1116, HCT8, Colo201, Colo320, RW2982, RW7213, H498, VACO411, VACO10P, CaCo2, SW1463, HRT18, HT29, SW620, LS123, LS174T, HCT116, and Lovo. B, methylation status in cell lines C1a, SW48, VACO5, VACO6, RKO, and C.

 
The identification of region C is of importance, because the methylation of CpG sites in this region invariably correlates with the loss of expression in all cell lines tested, and methylation outside this region (regions A and B) does not always correlate with inhibition of gene expression. For example, in HT29 cells, the expression of hMLH1 is normal. However, when HpaII digestion was first used for methylation analysis, methylation was observed (data not shown). This inconsistency between the hMLH1 expression and methylation of CpG sites is due to the fact that the four HpaII recognition sites are located in region B (-545, -505, -326, and -320). When the NaHSO3-sequencing method was used to analyze methylation status, partial methylation was detected at CpG sites of these HpaII sites (45%, 45%, 40%, and 20%, respectively; Fig. 1ACitation ). This suggests that methylation of CpG sites located outside region C does not inhibit hMLH1 expression. Another method, MSP, can also be applied to determine the methylation status. Herman et al. (13) selected primers from region A for MSP analysis because of the frequent occurrence of CpG sites in this region. Because all cell lines showed methylation in this region, regardless of whether or not hMLH1 was expressed, the methylation status obtained from MSP of this region may not correlate with the loss of hMLH1 expression. Thus, to analyze the methylation status in hMLH1 promoter by the MSP method, primers located in region C should be used.

5-Aza-2'-Deoxycytidine Treatment Leads to Reexpression of hMLH1 and Demethylation of Its Promoter.
To confirm the critical role of methylation of CpG sites in region C (-248 to -178), four cell lines that did not express hMLH1 (C1a, VACO5, RKO, and C) were treated with 5, 10, or 15 µ M 5-aza-2'-deoxycytidine. hMLH1 expression was detected in all four cell lines after the treatment. The expression levels were dependent on the cell type and dosage of 5-aza-2'-deoxycytidine. In cell lines C1a and C, 5 µM 5-aza-2' -deoxycytidine induced the expression of hMLH1 to the level of normal-expressing cell line LS123. In cell lines RKO and VACO5, the expression levels of hMLH1 induced by 5 µM 5-aza-2'-deoxycytidine was low, but levels increased when the dosage was raised to 10 or 15 µM (Fig. 2)Citation . In SW48, the expression level of hMLH1 induced by 10 µM was also higher than 5 µ M (data not shown).



View larger version (35K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. hMLH1 RNA expression in cell lines treated with 5-aza-2'-deoxycytidine. Cell lines C1a, C, RKO, and VACO5 were treated with 5, 10, or 15µM 5-aza-2'-deoxycytidine. hMLH1-expressing cell line LS123, without 5-aza-2' -deoxycytidine, is included as a positive control. Total RNA isolated from the cells was reverse-transcribed, and the cDNA was amplified by PCR with two primer sets together, hMLH1 primers and ß-actin primers as a control. The relative expression level was calculated by the amount of hMLH1 (lower band) divided by ß-actin (upper band). The number below each lane indicates the concentration of 5-aza-2'-deoxycytidine.

 
The methylation status of CpG sites in the whole promoter region from -711 to +15 was determined in the four 5-aza-2' -deoxycytidine-treated cell lines. The extent of demethylation in regions A, B, C, and D of each four cell lines was obtained (Table 2)Citation . In two of the four cell lines (VACO5 and C), the extent of demethylation in regions A, B, C, and D was similar (around 20% and 30%, respectively), whereas in two other cell lines (C1a and RKO), the extent of demethylation in regions C and D was significantly higher than in regions A and B. These observations are consistent with the notion that methylation of the more proximal regions, especially region C, plays an important role in the regulation of hMLH1 expression.


View this table:
[in this window]
[in a new window]

 
Table 2 Demethylation in different regions of the hMLH1 promoter after 5-aza-2'-deoxycytidine treatment

 
The methylation status in 6 cell lines without hMLH1 expression and 18 cell lines with normal expression showed that methylation in a proximal region (-248 to -178) can silence expression, whereas methylation in two upstream regions (-711 to -577 and -552 to -266) may be less efficient for the silencing effect. 5-Aza-2'-deoxycytidine is an agent which inhibits DNA methyltransferase, resulting in the demethylation of DNA (13 , 14) . In this study, we showed that different regions of the hMLH1 promoter responded to 5-aza-2'-deoxycytidine differently (i.e., the extent of demethylation varied in different regions). In regions C and D, demethylation was usually more significant than in regions A and B. This observation suggests the presence of a methylation-response element in or near region C (18) , which plays an important role in regulating the expression of the gene through methylation and demethylation.

Sp1 element is a DNA sequence to which the transcription factor Sp1 binds. The 10-bp consensus sequence of the Sp1 element is (G/T)(G/A)GG(C/A)G(G/T)(G/A)(G/A)(C/T), and its core sequences are GGGCGG or GGCGGG. Recent studies have shown that CpG sites in promoter regions are protected from methylation by a cluster of Sp1 elements in a variety of genes (19 , 20) . By comparing the consensus and the core sequences of Sp1 element with the 5' flanking region of hMLH1 (from - 711 to +15), we identified nine Sp1 elements that were located at -658, -580, -547, -461, -441, - 393, -366, -182, and -85, respectively. Seven of the nine Sp1 elements are located in regions A and B. This is consistent with the recent discovery that the methylated flanks of promoters are segregated from the unmethylated CpG sites by an Sp1-rich boundary region (20) . The cluster of Sp1 elements in the hMLH1 promoter region suggests that Sp1 may be involved in regulation of hMLH1 gene expression in a mechanism involving methylation. Additional experiments are necessary to determine the differences in Sp1 binding between the cells that do and do not express hMLH1.


    ACKNOWLEDGMENTS
 
We thank Drs. James Gum and Suzanne Crawley for helpful discussions and suggestions during the course of this work.


    FOOTNOTES
 
1 Supported by Theodora Betz Foundation Fund and Veterans Administration Medical Research Service. Back

2 To whom requests for reprints should be addressed, at Gastrointestinal Research Laboratory, 151 M2, Veteran Affairs Medical Center and University of California San Francisco, 4150 Clement Street, San Francisco, CA 94121. Phone: (415) 221-4810, ext. 3401; Fax: (415) 750-6972. Back

3 The abbreviations used are: MMR, mismatch repair; MSI, microsatellite instability; MSP, methylation-specific PCR; RT-PCR, reverse transcription-PCR. Back

Received 12/18/98. Accepted 3/19/99.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Aaltonen L. A., Peltomaki P., Leach F. S., Sistonen P., Pylkkanen L., Mecklin J-P., Jarvinen H., Powell S. M., Jen J., Hamilton S. R., Petersen G. H., Kinzler K. W., Vogelstein B., de la Chapelle A. Clues to the pathogenesis of familial colorectal cancer. Science (Washington, DC), 260: 812-816, 1993.[Abstract/Free Full Text]
  2. Aaltonen L. A., Peltomaki P., Mecklin J-P., Jarvinen H., Jass J. R., Green J. S., Lynch H. T., Watson P., Tallqvist G., Juhola M., Sistonen P., Hamilton S. R., Kinzler K. W., Vogelstein B., de la Chapelle A. Replication errors in benign and malignant tumors from hereditary non-polyposis colorectal cancer patients. Cancer Res., 54: 1645-1648, 1994.[Abstract/Free Full Text]
  3. Thibodeau S. N., Bren G., Schaid D. Microsatellite instability in cancer of the proximal colon. Science (Washington, DC), 260: 816-819, 1993.[Abstract/Free Full Text]
  4. Ionov Y., Peinado M. A., Malkhosyan S., Shibata D., Perucho M. Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature (Lond.), 363: 558-561, 1993.[Medline]
  5. Bronner C. E., Baker S. M., Morrison P. T., Warren G., Smith L. G., Lescoe M. K., Kane M., Earabino C., Lipford J., Lindblom A., Tannergard P., Bollag R-J., Bodwin A. R., Ward D. C., Mordenskjold M., Fishel R., Kolodner R., Liskay R. M. Mutation in DNA mismatch repair gene homologue hMLH1 is associated with hereditary non-polyposis colon cancer. Nature (Lond.), 368: 258-261, 1994.[Medline]
  6. Papadopoulos N., Nicolaides N. C., Wei Y-F., Ruben S. M., Carter K. C., Rosen C. A., Haseltine W. A., Fleischmann R. D., Fraser C. M., Adams M. D., Venter J. C., Hamilton S. R., Petersen G. M., Watson P., Lynch H. T., Peltomaki P., Mecklin J-P., de la Chapelle A., Kinzler K. W., Vogelstein B. Mutation of a mutL homolog in hereditary colon cancer. Science (Washington, DC), 263: 1625-1629, 1994.[Abstract/Free Full Text]
  7. Moslein G., Tester D. J., Lindor N. M., Honchel R., Cunningham J. M., French A. J., Halling K. C., Schwab M., Goretzki P., Thibodeau S. N. Microsatellite instability and mutation analysis of hMLH2 and hMLH1 in patients with sporadic, familial and hereditary colorectal cancer. Hum. Mol. Genet., 5: 1245-1252, 1996.[Abstract/Free Full Text]
  8. Liu B., Nicolaides N. C., Markowitz S., Willson J. K. V., Parsons R. E., Jen J., Papadopolous N., Peltomaki P., de la Chapelle A., Hamilton S. R., Kinzler K. W., Vogelstein B. Mismatch repair gene defects in sporadic colorectal cancers with microsatellite instability. Nat. Genet., 9: 45-55, 1995.
  9. Thibodeau S. N., French A. J., Roche P. C., Cunningham J. M., Tester D. J., Lindor N. M., Moslein G., Baker S, M., Liskay R. M., Burgart L. J., Honchel R., Halling K. C. Altered expression of hMSH2 and hMLH1 in tumors with microsatellite instability and genetic alterations in mismatch repair genes. Cancer Res., 56: 4836-4840, 1996.[Abstract/Free Full Text]
  10. Thibodeau S. N., French A. J., Cunningham J. M., Tester D., Burgart L. J., Roche P. C., McDonnell S. K., Schaid D. J., Vockley C. W., Michels V. V., Farr G. H., Jr., O’Connell M. J. Microsatellite instability in colorectal cancer: different mutator phenotypes and the principal involvement of hMLH1. Cancer Res., 58: 1713-1718, 1998.[Abstract/Free Full Text]
  11. Kane M. F., Loda M., Gaida G. M., Lipman J., Mishra R., Goldman H., Jessup J. M., Kolodner R. Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res., 57: 808-811, 1997.[Abstract/Free Full Text]
  12. Cunningham J. M., Chrislensen E. R., Tester D. J., Kim C-Y., Roche P. C., Burgart L. J., Thibodeau S. N. Hypermethylation of hMLH1 promoter in colon cancer with microsatellite instability. Cancer Res., 58: 3455-3460, 1998.[Abstract/Free Full Text]
  13. Herman J. G., Umar A., Polyak K., Graff J. R., Ahuja N., Issa J-P. J., Markowitz S., Willson J. K. V., Hamilton S. R., Kinzler K. W., Kane M. F., Kolodner R. D., Vogelstein B., Kunkel T. A., Baylin S. B. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. USA, 95: 6870-6875, 1998.[Abstract/Free Full Text]
  14. Veigl M. L., Kasturi L., Olechnowicz J., Ma A., Lutterbaugh J. D., Periyasamy S., Li G., Drummond J., Modrich P. L., Sedwick W. D., Markowitz S. D. Biallelic inactivation of hMLH1 by epigenetic gene silencing, a novel mechanism causing human MSI cancers. Proc. Natl. Acad. Sci. USA, 95: 8698-8702, 1998.[Abstract/Free Full Text]
  15. Hoang J-M., Cottu P. H., Thuille B., Salmon R. J., Thomas G., Hamelin R. BAT-26, an indicator of the replication error phenotype in colorectal cancers and cell lines. Cancer Res., 57: 300-303, 1997.[Abstract/Free Full Text]
  16. Clark S. J., Harrison J., Paul C. L., Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res., 22: 2990-2997, 1994.[Abstract/Free Full Text]
  17. Tomlinson I. P. M., Ilyas M., Bodmer W. F. Allele loss occurs frequently at hMLH1, but rarely at hMSH2, in sporadic colorectal cancers with microsatellite instability. Br. J. Cancer, 74: 1514-1517, 1996.[Medline]
  18. Hu J-F., Vu T. H., Hoffman A. R. Promoter-specific modulation of insulin-like growth factor II genomic imprinting by inhibitors of DNA methylation. J. Biol. Chem., 271: 18253-18262, 1996.[Abstract/Free Full Text]
  19. Brandeis M., Frank D., Keshet I., Siegfried Z., Mondelsohn M., Nemes A., Temper V., Razin A., Cedar H. Sp1 elements protect a CpG island from de novo methylation. Nature (Lond.), 371: 435-438, 1994.[Medline]
  20. Graff J. R., Herman J. G., Myohanen S., Baylin S. B., Vertino P. M. Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation. J. Biol. Chem., 272: 22322-22329, 1997.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
M. Mei, D. Deng, T.-H. Liu, X.-T. Sang, X. Lu, H.-D. Xiang, J. Zhou, H. Wu, Y. Yang, J. Chen, et al.
Clinical Implications of Microsatellite Instability and MLH1 Gene Inactivation in Sporadic Insulinomas
J. Clin. Endocrinol. Metab., September 1, 2009; 94(9): 3448 - 3457.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. A. Edwards, M. Witherspoon, K. Wang, K. Afrasiabi, T. Pham, L. Birnbaumer, and S. M. Lipkin
Epigenetic Repression of DNA Mismatch Repair by Inflammation and Hypoxia in Inflammatory Bowel Disease-Associated Colorectal Cancer
Cancer Res., August 15, 2009; 69(16): 6423 - 6429.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
K. E. Varley, D. G. Mutch, T. B. Edmonston, P. J. Goodfellow, and R. D. Mitra
Intra-tumor heterogeneity of MLH1 promoter methylation revealed by deep single molecule bisulfite sequencing
Nucleic Acids Res., August 1, 2009; 37(14): 4603 - 4612.
[Abstract] [Full Text] [PDF]


Home page
J AndrolHome page
H. Tang and E. Goldberg
Homo sapiens Lactate Dehydrogenase c (Ldhc) Gene Expression in Cancer Cells Is Regulated by Transcription Factor Sp1, CREB, and CpG Island Methylation
J Androl, March 1, 2009; 30(2): 157 - 167.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Deng, S. Kakar, K. Okudiara, E. Choi, M. H. Sleisenger, and Y. S. Kim
Unique Methylation Pattern of Oncostatin M Receptor Gene in Cancers of Colorectum and Other Digestive Organs
Clin. Cancer Res., March 1, 2009; 15(5): 1519 - 1526.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
H. Hampel, W. L. Frankel, E. Martin, M. Arnold, K. Khanduja, P. Kuebler, M. Clendenning, K. Sotamaa, T. Prior, J. A. Westman, et al.
Feasibility of Screening for Lynch Syndrome Among Patients With Colorectal Cancer
J. Clin. Oncol., December 10, 2008; 26(35): 5783 - 5788.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. I. Joensuu, W. M. Abdel-Rahman, M. Ollikainen, S. Ruosaari, S. Knuutila, and P. Peltomaki
Epigenetic Signatures of Familial Cancer Are Characteristic of Tumor Type and Family Category
Cancer Res., June 15, 2008; 68(12): 4597 - 4605.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
R. J. Shaw, G. L. Hall, D. Lowe, T. Liloglou, J. K. Field, P. Sloan, and J. M. Risk
The Role of Pyrosequencing in Head and Neck Cancer Epigenetics: Correlation of Quantitative Methylation Data With Gene Expression
Arch Otolaryngol Head Neck Surg, March 1, 2008; 134(3): 251 - 256.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Li, L. Da, H. Tang, T. Li, and M. Zhao
CpG methylation plays a vital role in determining tissue- and cell-specific expression of the human cell-death-inducing DFF45-like effector A gene through the regulation of Sp1/Sp3 binding
Nucleic Acids Res., January 17, 2008; 36(1): 330 - 341.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. P. Hitchins, V. A. Lin, A. Buckle, K. Cheong, N. Halani, S. Ku, C.-T. Kwok, D. Packham, C. M. Suter, A. Meagher, et al.
Epigenetic Inactivation of a Cluster of Genes Flanking MLH1 in Microsatellite-Unstable Colorectal Cancer
Cancer Res., October 1, 2007; 67(19): 9107 - 9116.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
M. Svrcek, J. El-Bchiri, A. Chalastanis, E. Capel, S. Dumont, O. Buhard, C. Oliveira, R. Seruca, C. Bossard, J.-F. Mosnier, et al.
Specific Clinical and Biological Features Characterize Inflammatory Bowel Disease Associated Colorectal Cancers Showing Microsatellite Instability
J. Clin. Oncol., September 20, 2007; 25(27): 4231 - 4238.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Bettstetter, S. Dechant, P. Ruemmele, M. Grabowski, G. Keller, E. Holinski-Feder, A. Hartmann, F. Hofstaedter, and W. Dietmaier
Distinction of Hereditary Nonpolyposis Colorectal Cancer and Sporadic Microsatellite-Unstable Colorectal Cancer through Quantification of MLH1 Methylation by Real-time PCR
Clin. Cancer Res., June 1, 2007; 13(11): 3221 - 3228.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
E. J. Greenspan, J. L. Cyr, D. C. Pleau, J. Levine, T. V. Rajan, D. W. Rosenberg, and C. D. Heinen
Microsatellite instability in aberrant crypt foci from patients without concurrent colon cancer
Carcinogenesis, April 1, 2007; 28(4): 769 - 776.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. Gonzalez-Paz, W. J. Chng, R. F. McClure, E. Blood, M. M. Oken, B. V. Ness, C. D. James, P. J. Kurtin, K. Henderson, G. J. Ahmann, et al.
Tumor suppressor p16 methylation in multiple myeloma: biological and clinical implications
Blood, February 1, 2007; 109(3): 1228 - 1232.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Hampel, W. Frankel, J. Panescu, J. Lockman, K. Sotamaa, D. Fix, I. Comeras, J. La Jeunesse, H. Nakagawa, J. A. Westman, et al.
Screening for Lynch Syndrome (Hereditary Nonpolyposis Colorectal Cancer) among Endometrial Cancer Patients.
Cancer Res., August 1, 2006; 66(15): 7810 - 7817.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
P. Novakovic, J. M. Stempak, K.-J. Sohn, and Y.-I. Kim
Effects of folate deficiency on gene expression in the apoptosis and cancer pathways in colon cancer cells
Carcinogenesis, May 1, 2006; 27(5): 916 - 924.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y.-W. Cheng, C. Shawber, D. Notterman, P. Paty, and F. Barany
Multiplexed profiling of candidate genes for CpG island methylation status using a flexible PCR/LDR/Universal Array assay
Genome Res., February 1, 2006; 16(2): 282 - 289.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Matsuzaki, G. Deng, H. Tanaka, S. Kakar, S. Miura, and Y. S. Kim
The Relationship between Global Methylation Level, Loss of Heterozygosity, and Microsatellite Instability in Sporadic Colorectal Cancer
Clin. Cancer Res., December 15, 2005; 11(24): 8564 - 8569.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. O. Woods, A. J. Hyde, F. K. Curtis, S. Stuckless, J. S. Green, A. F. Pollett, J. D. Robb, R. C. Green, M. E. Croitoru, A. Careen, et al.
High Frequency of Hereditary Colorectal Cancer in Newfoundland Likely Involves Novel Susceptibility Genes
Clin. Cancer Res., October 1, 2005; 11(19): 6853 - 6861.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
H. Hampel, W. L. Frankel, E. Martin, M. Arnold, K. Khanduja, P. Kuebler, H. Nakagawa, K. Sotamaa, T. W. Prior, J. Westman, et al.
Screening for the Lynch Syndrome (Hereditary Nonpolyposis Colorectal Cancer)
N. Engl. J. Med., May 5, 2005; 352(18): 1851 - 1860.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Z. Petko, M. Ghiassi, A. Shuber, J. Gorham, W. Smalley, M. K. Washington, S. Schultenover, S. Gautam, S. D. Markowitz, and W. M. Grady
Aberrantly Methylated CDKN2A, MGMT, and MLH1 in Colon Polyps and in Fecal DNA from Patients with Colorectal Polyps
Clin. Cancer Res., February 1, 2005; 11(3): 1203 - 1209.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
N. Umetani, H. Takeuchi, A. Fujimoto, M. Shinozaki, A. J. Bilchik, and D. S. B. Hoon
Epigenetic Inactivation of ID4 in Colorectal Carcinomas Correlates with Poor Differentiation and Unfavorable Prognosis
Clin. Cancer Res., November 15, 2004; 10(22): 7475 - 7483.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
C. Oliveira, J. L. Westra, D. Arango, M. Ollikainen, E. Domingo, A. Ferreira, S. Velho, R. Niessen, K. Lagerstedt, P. Alhopuro, et al.
Distinct patterns of KRAS mutations in colorectal carcinomas according to germline mismatch repair defects and hMLH1 methylation status
Hum. Mol. Genet., October 1, 2004; 13(19): 2303 - 2311.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. C. Kim, K. H. Lee, I. H. Ka, K. H. Koo, S. A. Roh, H. C. Kim, C. S. Yu, T. W. Kim, H. M. Chang, G. Y. Gong, et al.
Characterization of Mutator Phenotype in Familial Colorectal Cancer Patients Not Fulfilling Amsterdam Criteria
Clin. Cancer Res., September 15, 2004; 10(18): 6159 - 6168.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Deng, G.-A. Song, E. Pong, M. Sleisenger, and Y. S. Kim
Promoter Methylation Inhibits APC Gene Expression by Causing Changes in Chromatin Conformation and Interfering with the Binding of Transcription Factor CCAAT-Binding Factor
Cancer Res., April 15, 2004; 64(8): 2692 - 2698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Mariadason, D. Arango, Q. Shi, A. J. Wilson, G. A. Corner, C. Nicholas, M. J. Aranes, M. Lesser, E. L. Schwartz, and L. H. Augenlicht
Gene Expression Profiling-Based Prediction of Response of Colon Carcinoma Cells to 5-Fluorouracil and Camptothecin
Cancer Res., December 15, 2003; 63(24): 8791 - 8812.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
B. Diergaarde, H. Braam, G. N. P. van Muijen, M. J. L. Ligtenberg, F. J. Kok, and E. Kampman
Dietary Factors and Microsatellite Instability in Sporadic Colon Carcinomas
Cancer Epidemiol. Biomarkers Prev., November 1, 2003; 12(11): 1130 - 1136.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. L. Ward, K. Cheong, S.-L. Ku, A. Meagher, T. O'Connor, and N. J. Hawkins
Adverse Prognostic Effect of Methylation in Colorectal Cancer Is Reversed by Microsatellite Instability
J. Clin. Oncol., October 15, 2003; 21(20): 3729 - 3736.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
C. T. Warnick, B. Dabbas, S. J. Ilstrup, C. D. Ford, and K. A. Strait
Cell Type-Dependent Regulation of hMLH1 Promoter Activity Is Influenced by the Presence of Multiple Redundant Elements
Mol. Cancer Res., June 1, 2003; 1(8): 610 - 618.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. Bariol, C. Suter, K. Cheong, S.-L. Ku, A. Meagher, N. Hawkins, and R. Ward
The Relationship between Hypomethylation and CpG Island Methylation in Colorectal Neoplasia
Am. J. Pathol., April 1, 2003; 162(4): 1361 - 1371.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. Deng, W.'e. El-Rifai, J. Ji, B. Zhu, P. Trampont, J. Li, M. F. Smith, and S. M. Powel
Hypermethylation of metallothionein-3 CpG island in gastric carcinoma
Carcinogenesis, January 1, 2003; 24(1): 25 - 29.
[Abstract] [Full Text] [PDF]


Home page
Br Med BullHome page
N J Maughan and P Quirke
Pathology - a molecular prognostic approach: Advances in colorectal cancer
Br. Med. Bull., December 1, 2002; 64(1): 59 - 74.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
J. Goffin and E. Eisenhauer
DNA methyltransferase inhibitors--state of the art
Ann. Onc., November 1, 2002; 13(11): 1699 - 1716.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Gazzoli, M. Loda, J. Garber, S. Syngal, and R. D. Kolodner
A Hereditary Nonpolyposis Colorectal Carcinoma Case Associated with Hypermethylation of the MLH1 Gene in Normal Tissue and Loss of Heterozygosity of the Unmethylated Allele in the Resulting Microsatellite Instability-High Tumor
Cancer Res., July 15, 2002; 62(14): 3925 - 3928.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Deng, G. Deng, M. F. Smith, J. Zhou, H. Xin, S. M. Powell, and Y. Lu
Simultaneous detection of CpG methylation and single nucleotide polymorphism by denaturing high performance liquid chromatography
Nucleic Acids Res., February 1, 2002; 30(3): e13 - e13.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Nakagawa, G. J. Nuovo, E. E. Zervos, E. W. Martin Jr., R. Salovaara, L. A. Aaltonen, and A. de la Chapelle
Age-related Hypermethylation of the 5' Region of MLH1 in Normal Colonic Mucosa Is Associated with Microsatellite-unstable Colorectal Cancer Development
Cancer Res., October 1, 2001; 61(19): 6991 - 6995.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
M. M. Pao, M. Tsutsumi, G. Liang, E. Uzvolgyi, F. A. Gonzales, and P. A. Jones
The endothelin receptor B (EDNRB) promoter displays heterogeneous, site specific methylation patterns in normal and tumor cells
Hum. Mol. Genet., April 1, 2001; 10(9): 903 - 910.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Yamamoto, F. Itoh, H. Nakamura, H. Fukushima, S. Sasaki, M. Perucho, and K. Imai
Genetic and Clinical Features of Human Pancreatic Ductal Adenocarcinomas with Widespread Microsatellite Instability
Cancer Res., April 1, 2001; 61(7): 3139 - 3144.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
A. K. Virmani, C. Muller, A. Rathi, S. Zoechbauer-Mueller, M. Mathis, and A. F. Gazdar
Aberrant Methylation during Cervical Carcinogenesis
Clin. Cancer Res., March 1, 2001; 7(3): 584 - 589.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
W. M. Grady, A. Rajput, J. D. Lutterbaugh, and S. D. Markowitz
Detection of Aberrantly Methylated hMLH1 Promoter DNA in the Serum of Patients with Microsatellite Unstable Colon Cancer
Cancer Res., February 1, 2001; 61(3): 900 - 902.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
H. B. Salvesen, N. MacDonald, A. Ryan, O. E. Iversen, I. J. Jacobs, L. A. Akslen, and S. Das
Methylation of hMLH1 in a Population-based Series of Endometrial Carcinomas
Clin. Cancer Res., September 1, 2000; 6(9): 3607 - 3613.
[Abstract] [Full Text]


Home page
Am. J. Pathol.Home page
S. A. Kuismanen, M. T. Holmberg, R. Salovaara, A. de la Chapelle, and P. Peltomaki
Genetic and Epigenetic Modification of MLH1 Accounts for a Major Share of Microsatellite-Unstable Colorectal Cancers
Am. J. Pathol., May 1, 2000; 156(5): 1773 - 1779.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Ueki, M. Toyota, T. Sohn, C. J. Yeo, J.-P. J. Issa, R. H. Hruban, and M. Goggins
Hypermethylation of Multiple Genes in Pancreatic Adenocarcinoma
Cancer Res., April 1, 2000; 60(7): 1835 - 1839.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
T. R. Devereux, I. Horikawa, C. H. Anna, L. A. Annab, C. A. Afshari, and J. C. Barrett
DNA Methylation Analysis of the Promoter Region of the Human Telomerase Reverse Transcriptase (hTERT) Gene
Cancer Res., December 1, 1999; 59(24): 6087 - 6090.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. A. Kuismanen, M. T. Holmberg, R. Salovaara, P. Schweizer, L. A. Aaltonen, A. de la Chapelle, M. Nystrom-Lahti, and P. Peltomaki
Epigenetic phenotypes distinguish microsatellite-stable and -unstable colorectal cancers
PNAS, October 26, 1999; 96(22): 12661 - 12666.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
H. Nakagawa, R. B. Chadwick, P. Peltomaki, C. Plass, Y. Nakamura, and A. de la Chapelle
From the Cover: Loss of imprinting of the insulin-like growth factor II gene occurs by biallelic methylation in a core region of H19-associated CTCF-binding sites in colorectal cancer
PNAS, January 16, 2001; 98(2): 591 - 596.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, G.
Right arrow Articles by Kim, Y. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online