Cancer Research Meeting Calendar  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Esteller, M.
Right arrow Articles by Herman, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Esteller, M.
Right arrow Articles by Herman, J. G.
[Cancer Research 60, 129-133, January 1, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

Hypermethylation-associated Inactivation of p14ARF Is Independent of p16INK4a Methylation and p53 Mutational Status1

Manel Esteller, Silvia Tortola, Minoru Toyota, Gabriel Capella, Miguel Angel Peinado, Stephen B. Baylin and James G. Herman2

The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 [M. E., M. T., S. B. B., J. G. H.]; Laboratori d’Investigacio Gastrointestinal, Hospital de la Santa Creu i Sant Pau, Barcelona, 08025 Spain [G. C.]; and Institut de Recerca Oncologica, Hospital Duran i Reynals, Barcelona, 08907 Spain [S. T., M. A. P.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The INK4a/ARF locus encodes two cell cycle-regulatory proteins, p16INK4a and p14ARF, which share an exon using different reading frames. p14ARF antagonizes MDM2-dependent p53 degradation. However, no point mutations in p14ARF not altering p16INK4a have been described in primary tumors. We report that p14ARF is epigenetically inactivated in several colorectal cell lines, and its expression is restored by treatment with demethylating agents. In primary colorectal carcinomas, p14ARF promoter hypermethylation was found in 31 of 110 (28%) of the tumors and observed in 13 of 41 (32%) colorectal adenomas but was not present in any normal tissues. p14ARF methylation appears in the context of an adjacent unmethylated p16INK4a promoter in 16 of 31 (52%) of the carcinomas methylated at p14ARF. Although p14ARF hypermethylation was slightly overrepresented in tumors with wild-type p53 compared to tumors harboring p53 mutations [19 of 55 (34%) versus 12 of 55 (22%)], this difference did not reach statistical significance. p14ARF aberrant methylation was not related to the presence of K-ras mutations. Our results demonstrate that p14ARF promoter hypermethylation is frequent in colorectal cancer and occurs independently of the p16INK4a methylation status and only marginally in relation to the p53 mutational status.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Disruption of the p53 and Rb3 tumor suppressor pathways is a fundamental trend of most human cancer cells (1) . In tumorigenesis, loss of Rb function can occur by direct inactivation of the Rb gene itself through mutation, sequestration of the Rb protein by viral oncoproteins, or promoter hypermethylation or by deregulation of the genes controlling Rb phosphorylation status (2) . These last alterations include cyclin D1 gene amplification, CDK4 activating mutations, and also gene amplification and inactivation of the inhibitors of CDK4, the INK4 family (composed of p15INK4b, p16INK4a, p18INK4c, and p19INK4d; Refs. 1 and 3 ). The p16INK4a gene was implicated as a tumor suppressor gene by its frequent mutation, deletion, or promoter hypermethylation in a variety of human tumors (1 , 4 , 5) . In addition, p16INK4a germ-line mutations have been associated with familial melanoma (6) . Recently, it was demonstrated that a portion of the p16INK4a gene has the capacity to encode a second product, murine p19ARF (7) . p19ARF, or human p14ARF, has a unique first exon (denominated exon 1ß), located approximately 20 kb centromeric to the first exon of p16INK4a (denoted as exon 1{alpha}). Under the control of its own promoter, exon 1ß splices into exon 2 of INK4a in an alternative reading frame, producing a different protein than p16INK4a (1 , 3 , 7 , 8) .

p19ARF overexpression induces G1- and G2-phase arrest through a p16INK4a-independent mechanism (9) . Furthermore, the p19ARF-mediated cell cycle arrest seems to be abolished in mouse embryo fibroblasts lacking functional p53 (8) . Recent work suggests that p19ARF and p14ARF interact in vivo with the MDM2 protein, neutralizing MDM2-mediated degradation of p53 (10, 11, 12, 13) . Thus, theoretically, inactivation of p14ARF would then be predicted to decrease the frequency for concomitant p53 mutations. p19ARF binds to MDM2 through its NH2 terminus end, which encodes exon 1ß (13) . p19ARF-specific null mice carrying a disrupted exon 1ß are cancer prone at an early age (8) , but no human point mutations in exon 1ß have been reported. Interestingly, exon 1ß-specific deletions have been described in melanoma cell lines (14) , and p14ARF genomic alterations are found in a majority of T-cell acute lymphocytic leukemias (15) . However, to date, most of the functional studies of p14ARF have involved murine systems, and little is known about the putative p14ARF function as a tumor suppressor gene in humans. Recently, the human p14ARF promoter has been cloned and contains a CpG island that is aberrantly methylated in colorectal cancer cell lines (16) . Hypermethylation of normally unmethylated CpG islands in the promoter regions of tumor suppressor and DNA repair genes, including p16INK4a, E-cadherin, hMLH1, GSTP1, and MGMT (4 , 17, 18, 19, 20) , correlates with loss of transcription. Thus, promoter hypermethylation could be a mechanism for p14ARF inactivation in human tumors. In addition, methylation of p16INK4a and p15INK4b can occur with more tumor-specific patterns than found for homozygous deletions involving the entire 9p region encompassing these genes (21) .

In the present study, we studied CpG island promoter methylation of the human p14ARF gene in cancer cell lines and more than 100 primary colorectal carcinomas. Colorectal tumors were chosen because homozygous deletions of the INK4a/ARF locus are not present in this tumor type (22) , and colorectal carcinoma has well-characterized mutational inactivation of p53, thus allowing us to examine the relationship to p53 mutations. Our results demonstrate that p14ARF can be silenced by promoter hypermethylation in colorectal cancer cell lines. In the primary colorectal tumors, p14ARF is aberrantly methylated in approximately a quarter of the neoplasms studied, and this methylation represents an event independent of the p16INK4a methylation status. Furthermore, p14ARF hypermethylation, although more frequent in tumors with wild-type p53, is also observed in those cancers with p53 mutations.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
MSP.
DNA methylation patterns in the CpG islands of the p14ARF gene were determined by MSP (23) . MSP distinguishes unmethylated from methylated alleles in a given gene based on sequence changes produced after bisulfite treatment of DNA, which converts unmethylated (but not methylated) cytosines to uracil, and subsequent PCR using primers designed for either methylated or unmethylated DNA (23) . The primer sequences designed for p14ARF spanned six CpGs within the 5' region of the gene. Primer sequences of p14ARF for the unmethylated reaction were 5'-TTTTTGGTGTTAAAGGGTGGTGTAGT-3' (sense) and 5'-CACAAAAACCCTCACTCACAACAA-3' (antisense), which amplify a 132-bp product, and primer sequences of p14ARF for the methylated reaction were 5'-GTGTTAAAGGGCGGCGTAGC-3' (sense) and 5'-AAAACCCTCACTCGCGACGA-3' (antisense), which amplify a 122-bp product. The 5' position of the sense unmethylated and methylated primers corresponds to bp 195 and 201 of GenBank sequence number L41934. Both antisense primers originate from bp 303 of this sequence. The annealing temperature for both the unmethylated and methylated reactions was 60°C. Placental DNA treated in vitro with SssI methyltransferase was used as a positive control for methylated alleles. DNA from normal lymphocytes was used as a negative control for methylated genes. Ten µl of each PCR reaction were loaded directly onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under UV illumination. DNA methylation patterns in the 5'-CpG island of p16INK4a were determined by MSP as described previously (23) .

RT-PCR.
RT-PCR was performed as described previously (21) , using 3 µg of total cellular RNA to generate cDNA. This cDNA (100 ng) was amplified by PCR with primers for exon 1ß (5'-GGTTTTCGTGGTTCACATCCCGCG-3') and exon 2 (5'-CAGGAAGCCCTCCCGGGCAGC-3') of p14ARF, which amplify a 254-bp product spanning sequence 204–437 from GenBank accession number S78535. RT-PCR for GAPDH served as a positive control. Ten µl of each PCR reaction were loaded directly onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under UV illumination.

Detection of K-ras and p53 Mutations.
Mutations at codons 12 and 13 of the K-ras gene were detected and characterized by a RFLP/PCR approach (24) . p53 mutations in exons 4–9 were analyzed by single-strand conformational polymorphism analysis. Briefly, a first PCR was performed using primers 12979U (GCTGCCGTGTTCCAGTTGCT) and 14875D (AGGCATCACTGCCCCCTGAT). The resulting 1897-bp fragment was then used as a template to separately amplify a fragment of 410 bp including exons 5 and 6 [with primers 13054U (TACTCCCCTGCCCTCAACAAG) and 13463D (CTCCTCCCAGAGACCCCAGT)] and a fragment of 622 bp including exons 7 and 8 [with primers 13966U (CTGGCCTCATCTTGGGCCTG) and 14587D (CTCGCTTAGTGCTCCCTGGG)]. These two fragments were then digested with restriction enzyme HpaII, and the resulting fragments were run on a 6% polyacrylamide gel without glycerol (0.2 h at 30 W and 5–6 h at 6 W) and with 10% glycerol (0.2 h at 30 W and 13–14 h at 6 W) to detect mobility shifts. Mutations were confirmed by direct cycle sequencing of the PCR products using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branchburg, NJ). Exons 4 and 9 were only analyzed on those samples negative for mutations in exons 5–8. Exon 4 was amplified directly from DNA using primers 12019U (GTCCCCCTTGCCGTCCCAAG) and 12349D (TACGGCCAGGCATTGAAGTC). The resulting 331-bp fragment was run without previous digestion on a 6% polyacrylamide/10% glycerol gel for 0.2 h at 30 W and 19 h at 6 W. To analyze exon 9, a fragment of 788 bp including exons 7–9 was amplified with primers 13966U (CTGGCCTCATCTTGGGCCTG) and 14753D (CTGAAGGGTGAAATATTCTCC) and digested with HhaI to produce two fragments of 548 and 240 bp, the latter of which contained exon 9.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Promoter Hypermethylation and Expression of p14ARF in Cancer Cell Lines.
Structurally, p14ARF is a candidate for hypermethylation-associated inactivation because a 5'-CpG island is located around the transcription start site (16) . The region chosen for the MSP analysis spans the area of greatest CpG density studied recently for methylation changes in several cell lines (16) . Normal lymphocytes, colon, breast, endometrium, and lung were found completely unmethylated at the p14ARF promoter (Fig. 1ACitation ). Normal kidney and liver were also unmethylated at p14ARF. We also examined 16 cancer cell lines derived from these tissues. p14ARF was fully methylated in four (25%) colorectal carcinoma cell lines (SW48, RKO, DLD-1, and LoVo; Fig. 1BCitation ). Among these, expression of the p14ARF transcript by RT-PCR was assessed in LoVo and DLD-1, both of which lack p14ARF expression (Fig. 1CCitation ). Treatment of these cell lines with the demethylating agent 5-aza-2'-deoxycytidine restored the expression of the transcript in both cases (Fig. 1CCitation ). These results agree with those recently reported by Robertson et al. (16) , although in that case, the colorectal cancer cell line HCT-15, which is isogenic to the DLD-1 cell line (25) , was used. The colorectal cancer cell line RKO methylated at p14ARF showed a low level of expression but demonstrated an increase in RNA after the treatment with 5-aza-2'-deoxycytidine. A similar phenomenon has been described previously in the case of the colorectal cancer cell line SW48 (16) , which was also methylated at p14ARF in our study. The colorectal cancer cell lines SW1417, SK-CO1, LS180T, and HT-29 were partially methylated, and p14ARF expression was demonstrated in the last one (Fig. 1CCitation ). Normal lymphocytes and the unmethylated colorectal cell line SW480 and the unmethylated leukemia cell line HL-60 demonstrated expression of the p14ARF transcript (Fig. 1CCitation ).



View larger version (55K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. MSP analysis of the promoter region of p14ARF and reactivation of p14ARF by treatment with 5'-aza-2'-deoxycytidine. The presence of a visible PCR product in Lanes U indicates the presence of unmethylated genes of p14ARF; the presence of product in Lanes M indicates the presence of methylated genes. In vitro methylated DNA (IVD) was used as a positive control for p14ARF promoter hypermethylation, and normal lymphocytes (NL) were used as a negative control for methylation. Water controls for PCR reactions are also shown. MSP of p14ARF in normal tissues (A) and cancer cell lines (B). C, the pattern of expression determined by RT-PCR of the p14ARF transcript in cancer cell lines SW480, DLD-1, DLD-1 after 5-aza-2'-deoxycytidine treatment, LoVo, LoVo after 5-aza-2'-deoxycytidine treatment, HT-29, and HL-60 and in normal lymphocytes. GAPDH expression demonstrates relatively equal amounts of initial mRNA. D, MSP of p14ARF in primary colorectal carcinomas (CRC) of p14ARF (top panel) and p16INK4a (bottom panel). CRC1 and CRC6 are unmethylated at both genes, CRC2 and CRC5 are methylated only at p16INK4a, CRC3 is methylated only at p14ARF, and CRC4 is methylated at both genes. E, MSP of p14ARF in colorectal adenomas. p14ARF promoter hypermethylation is demonstrated in samples A2, A4, A5, and A7.

 
The proposed role of p14ARF in modulating p53-MDM2 function would predict the diminishing need of p53 mutations in those tumors or cell lines with p14ARF promoter hypermethylation, assuming that only one "hit" in the same pathway would be necessary in the transforming process. In this series of cancer cell lines, cell lines fully methylated at p14ARF (LoVo, DLD-1, SW48, and RKO) were more frequently found to have an intact p53 [three of four cell lines (75%), with the exception DLD-1]. Among cell lines with an unmethylated promoter, including colorectal cells, non-small cell lung cancer, and leukemia (SW480, HCT116, SW837, COLO205, H157, H1618, U1752, and HL-60), only one (HCT116) had a wild-type p53. Thus, most cancer cell lines methylated at p14ARF are wild-type p53, and those unmethylated have a mutant p53, but this difference did not reach statistical significance (Fisher’s exact test, P = 0.07).

Promoter Hypermethylation of p14ARF in Primary Colorectal Carcinomas.
DNA obtained from 110 primary colorectal carcinomas was subjected to p14ARF promoter methylation study using MSP. Among all of the colorectal tumors studied, p14ARF promoter hypermethylation was present in 31 of 110 (28%) samples (Fig. 1DCitation ). In 32 patients from whom normal adjacent mucosa DNA was available, no methylation of the p14ARF promoter was observed in any case (an example is shown in Fig. 1ACitation ). Thus, the methylation observed in the colorectal cancers and cell lines is a tumor-specific change. Abnormal methylation of the p14ARF promoter region in the colorectal carcinomas was not associated with significant differences of gender, age of onset, clinical status, Duke’s stage, DNA ploidy, or the presence of residual disease. When the samples were decoded for their p53 status, p14ARF was hypermethylated in 19 of 55 (34%) colorectal tumors with wild-type p53 and in 12 of 55 (22%) tumors with a mutant p53 (Fig. 2ACitation ). Thus, although the tumors with functional p53 more often harbor p14ARF epigenetic inactivation than tumors with p53 mutations, this trend does not reach statistical significance (Fisher’s exact test, P = 0.20) and was certainly not limited to p53 wild-type tumors (Fig. 2ACitation ).



View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Patterns of p14ARF promoter hypermethylation according to p53 mutational status (A) and p16INK4a promoter hypermethylation (B) in colorectal tumors.

 
We also wondered whether p14ARF promoter hypermethylation would be related to promoter hypermethylation of the adjacent gene, p16INK4a. Aberrant methylation of p16INK4a was assessed in the same samples analyzed for p14ARF methylation and demonstrated in 41 of 110 (37%) of the primary colorectal carcinomas studied, a frequency similar to that described previously (Ref. 26 ; Fig. 1DCitation ). p14ARF was hypermethylated in the presence of an unmethylated p16INK4a promoter in 16 of 110 (14%) of the cases, whereas p14ARF promoter hypermethylation was coincident with p16INK4a promoter hypermethylation in 15 of 110 (14%) of the cases (Fig. 2BCitation ). In 26 of 110 (24%) of the cases, p16INK4a was methylated without p14ARF methylation (Fig. 2BCitation ). Thus, methylation at the p14ARF and p16INK4a promoters does not seem to be directly related (Fisher’s exact test, P = 0.28). It has been hypothesized that mutations in exons 1–4 of p53 may be concomitant with alterations in both p16INK4a and p14ARF (27) . Although we did not address this aspect specifically, in the three cases in which exon 4 mutations were found, p16INK4a was unmethylated in all three, and p14ARF was methylated in only one case.

Because it has been recently reported that p19ARF (the mouse homologue of p14ARF) is essential for the activation of p53 in response to oncogenic Ras (28) , we also examined the p14ARF promoter hypermethylation in relation to the K-ras status of the tumor. A total of 43 of 110 (39%) primary colorectal carcinomas had a K-ras point mutation. The frequency of p14ARF methylation was slightly higher in tumors with K-ras mutations than in those without K-ras mutations [15 of 43 (35%) versus 16 of 67 (24%)], but this difference was not statistically significant (Fisher’s exact test, P = 0.28). Thus, no evident linkage between these epigenetic and genetic alterations was observed.

Promoter Hypermethylation and Expression of p14ARF in Colorectal Adenomas.
DNA obtained from 41 primary colorectal adenomas was subjected to p14ARF promoter methylation study using MSP. Among all of the adenomas studied, p14ARF promoter hypermethylation was present in 13 of 41 (32%) samples (Fig. 1ECitation ). We also examined the expression of p14ARF using RT-PCR in these colorectal adenomas. Among 20 early lesions with available cDNA, 12 colorectal adenomas unmethylated at p14ARF expressed high levels of p14ARF mRNA, whereas 8 adenomas with p14ARF methylation expressed no detectable p14ARF mRNA (n = 7) or very little p14ARF mRNA (n = 1), demonstrating an exact correlation of transcriptional loss with p14ARF hypermethylation (Fig. 3Citation ). The similar rate of p14ARF methylation in adenomas and carcinomas suggests that like p16INK4a methylation, inactivation of p14ARF appears to be an early event in colorectal tumorigenesis.



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Pattern of expression determined by RT-PCR of the p14ARF transcript in colorectal adenomas. The adenomas with p14ARF promoter hypermethylation show a complete lack (A2, A7, A11, A20, A4, A5, A18) or strongly diminished (A14) p14ARF expression. The colorectal adenomas unmethylated at p14ARF (A1, A3, A8, A9, A10, A12, A13, A15, A16, A17, A6, A19) show high levels of the transcript. GAPDH expression demonstrates relatively equal amounts of initial mRNA.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our study represents the first finding of a specific lesion in p14ARF, promoter hypermethylation, in primary human tumors. In many cases, this does not affect the neighboring gene, p16INK4a. Furthermore, our data establish that, at least in colorectal tumors, the inactivation on p14ARF is not restricted to those neoplasms with intact p53. It has been postulated that due to the fact that p53 is directly targeted in approximately 50% of human malignancies (29) , other mechanisms are required to shut down the p53 pathway in tumors with wild-type p53. For example, lesions in the MDM2 gene such as amplification can lead to MDM2 overexpression and abrogation of p53 function. MDM2 represses p53 transcriptional activity and mediates the degradation of p53 (30) . However, MDM2 gene amplification is restricted to a few tumor types (30) . p53 degradation mediated by the viral protein E6 is also limited to a minority of neoplasms (31) . Another event contributing to abrogate the p53 pathway in the cancer cell may be p14ARF loss of function. Somatic mutations affecting exons 2 and 3 p14ARF, shared in an alternative reading frame with p16INK4a, have been demonstrated in tumors (1 , 5) , but no mutations in the specific exon 1ß of p14ARF have been reported. p14ARF can also be lost by homozygous deletion in several tumor types (22) , but this loss also targets p16INK4a in the vast majority of cases. However, p14ARF has been proposed as the crucial target in T-cell acute lymphocytic leukemias and glioblastomas that exhibit 9p21 lesions (15) . Recently, aberrant methylation of the p14ARF promoter has been demonstrated in cancer cell lines (16) . Our data corroborate the findings of loss of p14ARF expression associated with CpG island methylation and its restoration by the use of demethylating agents. We now demonstrate that such hypermethylation of p14ARF is not limited to cell lines and is not a rare event. Colorectal carcinomas were selected because these cancers do not show homozygous deletion of the 9p21 locus (22) and thus allow the separate study of p14ARF and p16INK4a inactivation. In addition, the considerable rate of p53 mutations in colorectal tumors helps us to address the existence or nonexistence of a relation between p14ARF and p53 status.

Our results demonstrate that p14ARF promoter hypermethylation occurs in approximately one-fourth of primary colorectal carcinomas. p14ARF promoter hypermethylation also seems to be an early event in colorectal tumorigenesis because, like p16INK4a methylation, it can be found in colon adenomas. When the p14ARF promoter methylation analysis is compared with the p53 status, we observe only a slightly decreased occurrence of p53 mutations in those primary tumors with p14ARF inactivation. Thus, p14ARF and p53 can be inactivated simultaneously in the same tumor. Such a scenario is also observed in a mouse model, where tumors arising in p19ARF-/- mice can harbor p53 mutations (8) .

Finally, it is relevant to note that p14ARF promoter hypermethylation is not dependent on p16INK4a promoter methylation status. In our set of colorectal tumors, the most common situation is the simultaneous absence of methylation in both promoters (48%), but after this, the three possible scenarios (p16INK4a methylated alone, p14ARF methylated alone, and both methylated) are similarly represented. In primary colorectal carcinoma, hypermethylation of p14ARF and p16INK4a are independent events. In colorectal cancer cell lines, because the vast majority of cell lines are methylated at p16INK4a, no cell line has p14ARF methylation with an unmethylated p16INK4a promoter. It is also interesting that the CpG island of p15INK4b, which is located only 14 kb upstream of the p14ARF promoter, remains unmethylated in colorectal tumors and cell lines, although it is methylated in leukemia (21) . Thus, the p14ARF promoter demonstrates selective epigenetic silencing in a subset of colorectal tumors, with a hypermethylated promoter (p14ARF) between two unmethylated promoters (p16INK4a and p15INK4b) that are frequently methylated in other tumors.

In summary, our data suggest that promoter hypermethylation of p14ARF is a relatively common and early event in colorectal tumorigenesis and is not necessarily related to the methylation status of neighbor gene p16INK4a or restricted to tumors with intact p53.


    ACKNOWLEDGMENTS
 
We thank Andrew B. Sparks and Kenneth W. Kinzler for providing cell lines for this study.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by NIH Grant CA54396 and Grants from Fondo de Investigacion Sanitaria and Comision Interministerial de Ciencia y Tecnología. M. E. is a recipient of a Spanish Ministerio de Educacion y Cultura Award. J. G. H. is a Valvano Foundation Scholar. S. B. B. and J. G. H. receive research funding and are entitled to sales royalties from ONCOR, which is developing products related to the research described in this article. The terms of this arrangement have been reviewed and approved by The Johns Hopkins University in accordance with its conflict of interest policies. Back

2 To whom requests for reprints should be addressed, at Tumor Biology, The Johns Hopkins Oncology Center, 424 North Bond Street, Baltimore, MD 21231. Phone: (410) 955-8506; Fax: (410) 614-9884; E-mail: hermanji{at}jhmi.edu Back

3 The abbreviations used are: Rb, retinoblastoma; MSP, methylation-specific PCR; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. Back

Received 6/21/99. Accepted 10/27/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Sherr C. J. Cancer cell cycles. Science (Washington DC), 276: 1672-1677, 1996.[Abstract/Free Full Text]
  2. Weinberg R. A. The retinoblastoma protein and cell cycle control. Cell, 81: 323-330, 1995.[Medline]
  3. Chin L., Pomerantz J., DePinho R. A. The INK4a/ARF tumor suppressor: one gene-two products-two pathways. Trends Biochem. Sci., 23: 291-296, 1998.[Medline]
  4. Merlo A., Herman J. G., Mao L., Lee D. J., Gabrielson E., Burger P. C., Baylin S. B., Sidransky D. 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med., 1: 686-692, 1995.[Medline]
  5. Kamb A. Cell-cycle regulators and cancer. Trends Genet., 11: 136-140, 1995.[Medline]
  6. Hussussian C. J., Struewing J. P., Goldtein A. M., Higgins P. A. T., Ally D. S., Sheahan M. D., Clark W. H., Tucker M. A., Dracopoli N. C. Germline p16 mutations in familial adenoma. Nat. Genet., 8: 15-21, 1994.[Medline]
  7. Quelle D. E., Zindy F., Ashmun R. A., Scherr C. J. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993-1000, 1995.[Medline]
  8. Kamijo T., Zindy F., Roussel M. F., Quelle D. E., Downing J. R., Ashmun R. A., Grosveld G., Sherr C. J. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19ARF. Cell, 91: 649-659, 1997.[Medline]
  9. Sherr C. J. Tumor surveillance via the ARF-p53 pathway. Genes Dev., 12: 2434-2442, 1998.[Abstract/Free Full Text]
  10. Pomerantz J., Schreiber-Agus N., Liegeois N. J., Silverman A., Alland L., Chin L., Potes J., Chen K., Orlow I., Lee H. W., Cordon-Cardo C., DePinho R. A. The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2’s inhibition of p53. Cell, 92: 713-723, 1998.[Medline]
  11. Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 92: 725-734, 1998.[Medline]
  12. Kamijo T., Weber J. D., Zambetti G., Zindy F., Roussel M. F., Sherr C. J. Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc. Natl. Acad. Sci. USA, 95: 8292-8297, 1998.[Abstract/Free Full Text]
  13. Stott F. J., Bates S., James M. C., McConnell B. B., Starborg M., Brookes S., Palmero I., Ryan K., Hara E., Vousden K. H., Peters G. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J., 17: 5001-5014, 1998.[Medline]
  14. Larsen C. J. p16INK4a: a gene with dual capacity to encode unrelated proteins that inhibit cell cycle progression. Oncogene, 12: 2041-2044, 1996.[Medline]
  15. Gardie B., Cayuela J. M., Martini S., Sigaux F. Genomic alterations of the p19ARF encoding exons in T-cell acute lymphoblastic leukemia. Blood, 91: 1016-1020, 1998.[Abstract/Free Full Text]
  16. Robertson K. D., Jones P. A. The human ARF cell cycle regulatory gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol. Cell. Biol., 18: 6457-6473, 1998.[Abstract/Free Full Text]
  17. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  18. Herman J. G., Umar A., Polyak K., Graff J. R., Ahuja N., Issa J. P., Markowitz S., Willson J. K., Hamilton S. R., Kinzler K. W., Kane M. F., Kolodner R. D., Vogelstein B., Kunkel T. A., Baylin S. B. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. USA, 95: 6870-6875, 1998.[Abstract/Free Full Text]
  19. Esteller M., Corn P. G., Urena J. M., Gabrielson E., Baylin S. B., Herman J. G. Inactivation of glutathione S-transferase P1 gene by promoter hypermethylation in human neoplasia. Cancer Res., 58: 4515-4518, 1998.[Abstract/Free Full Text]
  20. Esteller M., Hamilton S. R., Burger P. C., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59: 793-797, 1999.[Abstract/Free Full Text]
  21. Herman J. G., Jen J., Merlo A., Baylin S. B. Hypermethylation-associated inactivation indicates a tumor suppressor role for p15INK4B. Cancer Res., 56: 722-727, 1996.[Abstract/Free Full Text]
  22. Cairns P., Polascik T. J., Eby Y., Tokino K., Califano J., Merlo A., Mao L., Herath J., Jenkins R., Westra W., Rutter J. L., Buckler A., Gabrielson E., Tockman M., Cho K. R., Hedrick L., Bova G. S., Isaacs W., Koch W., Schwab D., Sidransky D. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat. Genet., 11: 210-212, 1995.[Medline]
  23. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
  24. Capella G., Cronauer-Mitra S., Peinado M. A., Perucho M. Frequency and spectrum of mutations at codons 12 and 13 of the c-K-ras gene in human tumors. Environ. Heath Persp., 93: 125-131, 1991.
  25. Vermeulen S. J., Chen T. R., Speleman F., Nollet F., Van Roy F. M., Mareel M. M. Did the four human cancer cell lines DLD-1, HCT-15, HCT-8, and HRT-18 originate from one and the same patient?. Cancer Genet. Cytogenet., 107: 76-79, 1998.[Medline]
  26. Herman J. G., Merlo A., Mao L., Lapidus R. G., Issa J. P., Davidson N. E., Sidransky D., Baylin S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55: 4525-4530, 1995.[Abstract/Free Full Text]
  27. Markl I. D., Jones P. A. Presence and location of TP53 mutation determines pattern of CDKN2A/ARF pathway inactivation in bladder cancer. Cancer Res., 58: 5348-5353, 1998.[Abstract/Free Full Text]
  28. Palmero I., Pantoja C., Serrano M. p19ARF links the tumour suppressor p53 to Ras. Nature (Lond.), 395: 125-126, 1998.[Medline]
  29. Hainaut P., Soussi T., Shomer B., Hollstein M., Greenblatt M., Hovig E., Harris C. C., Montesano R. Database of p53 gene somatic mutations in human tumors and cell lines: updated compilation and future prospects. Nucleic Acids Res., 25: 151-157, 1997.[Abstract/Free Full Text]
  30. Prives C. Signaling to p53: breaking the MDM2–p53 circuit. Cell, 95: 5-8, 1998.[Medline]
  31. Rapp L., Chen J. J. The papillomavirus E6 proteins. Biochim. Biophys. Acta, 1378: F1-F19, 1998.[Medline]



This article has been cited by other articles:


Home page
Cancer Prevention ResearchHome page
A. Boquoi, T. Chen, and G. H. Enders
Chemoprevention of Mouse Intestinal Tumorigenesis by the Cyclin-Dependent Kinase Inhibitor SNS-032
Cancer Prevention Research, September 1, 2009; 2(9): 800 - 806.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
T. TAHARA, T. SHIBATA, T. ARISAWA, M. NAKAMURA, H. YAMASHITA, D. YOSHIOKA, M. OKUBO, N. MARUYAMA, T. KAMANO, Y. KAMIYA, et al.
Impact of Catechol-O-methyltransferase (COMT) Gene Polymorphism on Promoter Methylation Status in Gastric Mucosa
Anticancer Res, July 1, 2009; 29(7): 2857 - 2861.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. Xiong and R. J. Epstein
Growth inhibition of human cancer cells by 5-aza-2'-deoxycytidine does not correlate with its effects on INK4a/ARF expression or initial promoter methylation status
Mol. Cancer Ther., April 1, 2009; 8(4): 779 - 785.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
D. E. Freedberg, S. H. Rigas, J. Russak, W. Gai, M. Kaplow, I. Osman, F. Turner, J. A. Randerson-Moor, A. Houghton, K. Busam, et al.
Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
J Natl Cancer Inst, June 4, 2008; 100(11): 784 - 795.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
N B Kiss, J Geli, F Lundberg, C Avci, D Velazquez-Fernandez, J Hashemi, G Weber, A Hoog, T J Ekstrom, M Backdahl, et al.
Methylation of the p16INK4A promoter is associated with malignant behavior in abdominal extra-adrenal paragangliomas but not pheochromocytomas
Endocr. Relat. Cancer, June 1, 2008; 15(2): 609 - 621.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
R. Sailasree, A. Abhilash, K.M. Sathyan, K.R. Nalinakumari, S. Thomas, and S. Kannan
Differential Roles of p16INK4A and p14ARF Genes in Prognosis of Oral Carcinoma
Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 414 - 420.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. J. Apicelli, L. B. Maggi Jr., A. C. Hirbe, A. P. Miceli, M. E. Olanich, C. L. Schulte-Winkeler, A. J. Saporita, M. Kuchenreuther, J. Sanchez, K. Weilbaecher, et al.
A Non-Tumor Suppressor Role for Basal p19ARF in Maintaining Nucleolar Structure and Function
Mol. Cell. Biol., February 1, 2008; 28(3): 1068 - 1080.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H. Zou, J. J. Harrington, A. M. Shire, R. L. Rego, L. Wang, M. E. Campbell, A. L. Oberg, and D. A. Ahlquist
Highly Methylated Genes in Colorectal Neoplasia: Implications for Screening
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2686 - 2696.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. A. Benanti, M. L. Wang, H. E. Myers, K. L. Robinson, C. Grandori, and D. A. Galloway
Epigenetic Down-Regulation of ARF Expression Is a Selection Step in Immortalization of Human Fibroblasts by c-Myc
Mol. Cancer Res., November 1, 2007; 5(11): 1181 - 1189.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
D. Fontijn, A. D. Adema, K. K. Bhakat, H. M. Pinedo, G. J. Peters, and E. Boven
O6-Methylguanine-DNA-methyltransferase promoter demethylation is involved in basic fibroblast growth factor induced resistance against temozolomide in human melanoma cells
Mol. Cancer Ther., October 1, 2007; 6(10): 2807 - 2815.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
C.-S. Chim, R. Liang, T.-K. Fung, C.-L. Choi, and Y.-L. Kwong
Epigenetic dysregulation of the death-associated protein kinase/p14/HDM2/p53/Apaf-1 apoptosis pathway in multiple myeloma
J. Clin. Pathol., June 1, 2007; 60(6): 664 - 669.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
R. W.K. Chiu, S. S.C. Chim, I. H.N. Wong, C. S.C. Wong, W.-S. Lee, K. F. To, J. H.M. Tong, R. K.C. Yuen, A. S.W. Shum, J. K.C. Chan, et al.
Hypermethylation of RASSF1A in Human and Rhesus Placentas
Am. J. Pathol., March 1, 2007; 170(3): 941 - 950.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Wallner, A. Herbst, A. Behrens, A. Crispin, P. Stieber, B. Goke, R. Lamerz, and F. T. Kolligs
Methylation of Serum DNA Is an Independent Prognostic Marker in Colorectal Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7347 - 7352.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. Paliwal, S. Pande, R. C. Kovi, N. E. Sharpless, N. Bardeesy, and S. R. Grossman
Targeting of C-Terminal Binding Protein (CtBP) by ARF Results in p53-Independent Apoptosis.
Mol. Cell. Biol., March 1, 2006; 26(6): 2360 - 2372.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles
Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype
Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Alaminos, V. Davalos, S. Ropero, F. Setien, M. F. Paz, M. Herranz, M. F. Fraga, J. Mora, N.-K. V. Cheung, W. L. Gerald, et al.
EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma
Cancer Res., April 1, 2005; 65(7): 2565 - 2571.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Matsubayashi, N. Sato, K. Brune, A. L. Blackford, R. H. Hruban, M. Canto, C. J. Yeo, and M. Goggins
Age- and Disease-Related Methylation of Multiple Genes in Nonneoplastic Duodenum and in Duodenal Juice
Clin. Cancer Res., January 15, 2005; 11(2): 573 - 583.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
W.-C. Xue, K. Y.K. Chan, H.-C. Feng, P.-M. Chiu, H. Y.S. Ngan, S.-W. Tsao, and A. N.Y. Cheung
Promoter Hypermethylation of Multiple Genes in Hydatidiform Mole and Choriocarcinoma
J. Mol. Diagn., November 1, 2004; 6(4): 326 - 334.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Roman-Gomez, A. Jimenez-Velasco, J. A. Castillejo, X. Agirre, M. Barrios, G. Navarro, F. J. Molina, M. J. Calasanz, F. Prosper, A. Heiniger, et al.
Promoter hypermethylation of cancer-related genes: a strong independent prognostic factor in acute lymphoblastic leukemia
Blood, October 15, 2004; 104(8): 2492 - 2498.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. I. de Caceres, C. Battagli, M. Esteller, J. G. Herman, E. Dulaimi, M. I. Edelson, C. Bergman, H. Ehya, B. L. Eisenberg, and P. Cairns
Tumor Cell-Specific BRCA1 and RASSF1A Hypermethylation in Serum, Plasma, and Peritoneal Fluid from Ovarian Cancer Patients
Cancer Res., September 15, 2004; 64(18): 6476 - 6481.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Datta, A. Nag, W. Pan, N. Hay, A. L. Gartel, O. Colamonici, Y. Mori, and P. Raychaudhuri
Myc-ARF (Alternate Reading Frame) Interaction Inhibits the Functions of Myc
J. Biol. Chem., August 27, 2004; 279(35): 36698 - 36707.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Alaminos, V. Davalos, N.-K. V. Cheung, W. L. Gerald, and M. Esteller
Clustering of Gene Hypermethylation Associated With Clinical Risk Groups in Neuroblastoma
J Natl Cancer Inst, August 18, 2004; 96(16): 1208 - 1219.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H.-S. Hsu, Y.-C. Wang, R.-C. Tseng, J.-W. Chang, J.-T. Chen, C.-M. Shih, C.-Y. Chen, and Y.-C. Wang
CpG Island Methylation Is Responsible for p14ARF Inactivation and Inversely Correlates with p53 Overexpression in Resected Non-Small Cell Lung Cancer
Clin. Cancer Res., July 15, 2004; 10(14): 4734 - 4741.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Pellise, A. Castells, A. Gines, R. Agrelo, M. Sole, S. Castellvi-Bel, G. Fernandez-Esparrach, J. Llach, M. Esteller, J. M. Bordas, et al.
Detection of Lymph Node Micrometastases by Gene Promoter Hypermethylation in Samples Obtained by Endosonography- Guided Fine-Needle Aspiration Biopsy
Clin. Cancer Res., July 1, 2004; 10(13): 4444 - 4449.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S.-i. Maruya, J.-P. J. Issa, R. S. Weber, D. I. Rosenthal, J. C. Haviland, R. Lotan, and A. K. El-Naggar
Differential Methylation Status of Tumor-Associated Genes in Head and Neck Squamous Carcinoma: Incidence and Potential Implications
Clin. Cancer Res., June 1, 2004; 10(11): 3825 - 3830.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
R. Tang, C. R. Changchien, M.-C. Wu, C.-W. Fan, K.-W. Liu, J.-S. Chen, H.-T. Chien, and L.-L. Hsieh
Colorectal cancer without high microsatellite instability and chromosomal instability--an alternative genetic pathway to human colorectal cancer
Carcinogenesis, May 1, 2004; 25(5): 841 - 846.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M.-J. Boucher, D. Jean, A. Vezina, and N. Rivard
Dual role of MEK/ERK signaling in senescence and transformation of intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, May 1, 2004; 286(5): G736 - G746.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C V A Wynter, M D Walsh, T Higuchi, B A Leggett, J Young, and J R Jass
Methylation patterns define two types of hyperplastic polyp associated with colorectal cancer
Gut, April 1, 2004; 53(4): 573 - 580.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Dulaimi, R. G. Uzzo, R. E. Greenberg, T. Al-Saleem, and P. Cairns
Detection of Bladder Cancer in Urine by a Tumor Suppressor Gene Hypermethylation Panel
Clin. Cancer Res., March 15, 2004; 10(6): 1887 - 1893.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Battagli, R. G. Uzzo, E. Dulaimi, I. Ibanez de Caceres, R. Krassenstein, T. Al-Saleem, R. E. Greenberg, and P. Cairns
Promoter Hypermethylation of Tumor Suppressor Genes in Urine from Kidney Cancer Patients
Cancer Res., December 15, 2003; 63(24): 8695 - 8699.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L. Kopelovich, J. A. Crowell, and J. R. Fay
The Epigenome as a Target for Cancer Chemoprevention
J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
J. G. Herman and S. B. Baylin
Gene Silencing in Cancer in Association with Promoter Hypermethylation
N. Engl. J. Med., November 20, 2003; 349(21): 2042 - 2054.
[Full Text] [PDF]


Home page
JCOHome page
R. L. Ward, K. Cheong, S.-L. Ku, A. Meagher, T. O'Connor, and N. J. Hawkins
Adverse Prognostic Effect of Methylation in Colorectal Cancer Is Reversed by Microsatellite Instability
J. Clin. Oncol., October 15, 2003; 21(20): 3729 - 3736.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
T. Watanabe, Y. Katayama, A. Yoshino, C. Komine, and T. Yokoyama
Deregulation of the TP53/p14ARF Tumor Suppressor Pathway in Low-Grade Diffuse Astrocytomas and Its Influence on Clinical Course
Clin. Cancer Res., October 15, 2003; 9(13): 4884 - 4890.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. H. Kang, H. J. Lee, K. S. Hwang, S. Lee, J.-H. Kim, and J.-S. Kim
Aberrant CpG Island Hypermethylation of Chronic Gastritis, in Relation to Aging, Gender, Intestinal Metaplasia, and Chronic Inflammation
Am. J. Pathol., October 1, 2003; 163(4): 1551 - 1556.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. van Rijnsoever, H. Elsaleh, D. Joseph, K. McCaul, and B. Iacopetta
CpG Island Methylator Phenotype Is an Independent Predictor of Survival Benefit from 5-Fluorouracil in Stage III Colorectal Cancer
Clin. Cancer Res., August 1, 2003; 9(8): 2898 - 2903.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
A H Prowse, D C Schultz, S Guo, L Vanderveer, J Dangel, B Bove, P Cairns, M Daly, and A K Godwin
Identification of a splice acceptor site mutation in p16INK4A/p14ARF within a breast cancer, melanoma, neurofibroma prone kindred
J. Med. Genet., August 1, 2003; 40(8): e102 - 102.
[Full Text] [PDF]


Home page
Cancer Res.Home page
D.-H. Kim, J. S. Kim, Y.-I. Ji, Y. M. Shim, H. Kim, J. Han, and J. Park
Hypermethylation of RASSF1A Promoter Is Associated with the Age at Starting Smoking and a Poor Prognosis in Primary Non-Small Cell Lung Cancer
Cancer Res., July 1, 2003; 63(13): 3743 - 3746.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. van Engeland, M. P. Weijenberg, G. M. J. M. Roemen, M. Brink, A. P. de Bruine, R. A. Goldbohm, P. A. van den Brandt, S. B. Baylin, A. F. P. M. de Goeij, and J. G. Herman
Effects of Dietary Folate and Alcohol Intake on Promoter Methylation in Sporadic Colorectal Cancer: The Netherlands Cohort Study on Diet and Cancer
Cancer Res., June 15, 2003; 63(12): 3133 - 3137.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. V. Bulavin, O. Kovalsky, M. C. Hollander, and A. J. Fornace Jr.
Loss of Oncogenic H-ras-Induced Cell Cycle Arrest and p38 Mitogen-Activated Protein Kinase Activation by Disruption of Gadd45a
Mol. Cell. Biol., June 1, 2003; 23(11): 3859 - 3871.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. P. Whitcomb, D. G. Mutch, T. J. Herzog, J. S. Rader, R. K. Gibb, and P. J. Goodfellow
Frequent HOXA11 and THBS2 Promoter Methylation, and a Methylator Phenotype in Endometrial Adenocarcinoma
Clin. Cancer Res., June 1, 2003; 9(6): 2277 - 2287.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
B. Klump, C.-J. Hsieh, S. Dette, K. Holzmann, R. Kiesslich, M. Jung, U. Sinn, M. Ortner, R. Porschen, and M. Gregor
Promoter Methylation of INK4a/ARF As Detected in Bile-Significance for the Differential Diagnosis in Biliary Disease
Clin. Cancer Res., May 1, 2003; 9(5): 1773 - 1778.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Gibson, C. Y. Dai, H.-W. Lee, R. A. DePinho, M. S. Gee, W. M. F. Lee, E. E. Furth, C. Brensinger, and G. H. Enders
Inhibition of Colon Tumor Progression and Angiogenesis by the Ink4a/Arf Locus
Cancer Res., February 15, 2003; 63(4): 742 - 746.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Rizos, E. Diefenbach, P. Badhwar, S. Woodruff, T. M. Becker, R. J. Rooney, and R. F. Kefford
Association of p14ARF with the p120E4F Transcriptional Repressor Enhances Cell Cycle Inhibition
J. Biol. Chem., February 7, 2003; 278(7): 4981 - 4989.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. S. Tam, T. R. Devereux, A. C. Patel, J. F. Foley, R. R. Maronpot, and T. E. Massey
Perturbations of the Ink4a/Arf gene locus in aflatoxin B1-induced mouse lung tumors
Carcinogenesis, January 1, 2003; 24(1): 121 - 132.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
J R Jass, M Barker, L Fraser, M D Walsh, V L J Whitehall, B Gabrielli, J Young, and B A Leggett
APC mutation and tumour budding in colorectal cancer
J. Clin. Pathol., January 1, 2003; 56(1): 69 - 73.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Kusy, M. Cividin, N. Sorel, F. Brizard, F. Guilhot, A. Brizard, C. Larsen, and J. Roche
p14ARF, p15INK4b, and p16INK4a methylation status in chronic myelogenous leukemia
Blood, January 1, 2003; 101(1): 374 - 374.
[Full Text] [PDF]


Home page
GutHome page
M van Rijnsoever, F Grieu, H Elsaleh, D Joseph, and B Iacopetta
Characterisation of colorectal cancers showing hypermethylation at multiple CpG islands
Gut, December 1, 2002; 51(6): 797 - 802.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind
INK4a-ARF alterations in liver cell adenoma
Mol. Pathol., December 1, 2002; 55(6): 379 - 384.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
V. L. J. Whitehall, C. V. A. Wynter, M. D. Walsh, L. A. Simms, D. Purdie, N. Pandeya, J. Young, S. J. Meltzer, B. A. Leggett, and J. R. Jass
Morphological and Molecular Heterogeneity within Nonmicrosatellite Instability-High Colorectal Cancer
Cancer Res., November 1, 2002; 62(21): 6011 - 6014.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Ogi, M. Toyota, M. Ohe-Toyota, N. Tanaka, M. Noguchi, T. Sonoda, G. Kohama, and T. Tokino
Aberrant Methylation of Multiple Genes and Clinicopathological Features in Oral Squamous Cell Carcinoma
Clin. Cancer Res., October 1, 2002; 8(10): 3164 - 3171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Javelaud and F. Besancon
Inactivation of p21WAF1Sensitizes Cells to Apoptosis via an Increase of Both p14ARF and p53 Levels and an Alteration of the Bax/Bcl-2 Ratio
J. Biol. Chem., September 27, 2002; 277(40): 37949 - 37954.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
Q. Tao, H. Huang, T. M. Geiman, C. Y. Lim, L. Fu, G.-H. Qiu, and K. D. Robertson
Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells
Hum. Mol. Genet., September 1, 2002; 11(18): 2091 - 2102.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind
INK4a-ARF alterations in liver cell adenoma
Gut, August 1, 2002; 51(2): 253 - 258.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Gloghini, G. Gaidano, L. M. Larocca, F. Pierconti, A. Cingolani, L. Dal Maso, D. Capello, S. Franceschi, U. Tirelli, M. Libra, et al.
Expression of Cyclin-Dependent Kinase Inhibitor p27Kip1 in AIDS-Related Diffuse Large-Cell Lymphomas Is Associated with Epstein-Barr Virus-Encoded Latent Membrane Protein 1
Am. J. Pathol., July 1, 2002; 161(1): 163 - 171.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
K. W. Choy, C. P. Pang, K. F. To, C. B. O. Yu, J. S. K. Ng, and D. S. C. Lam
Impaired Expression and Promotor Hypermethylation of O6-Methylguanine-DNA Methyltransferase in Retinoblastoma Tissues
Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1344 - 1349.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Smeds, P. Berggren, X. Ma, Z. Xu, K. Hemminki, and R. Kumar
Genetic status of cell cycle regulators in squamous cell carcinoma of the oesophagus: the CDKN2A (p16INK4a and p14ARF ) and p53 genes are major targets for inactivation
Carcinogenesis, April 1, 2002; 23(4): 645 - 655.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla
p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients
Clin. Cancer Res., April 1, 2002; 8(4): 980 - 985.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
N. Konishi, M. Nakamura, M. Kishi, M. Nishimine, E. Ishida, and K. Shimada
Heterogeneous Methylation and Deletion Patterns of the INK4a/ARF Locus Within Prostate Carcinomas
Am. J. Pathol., April 1, 2002; 160(4): 1207 - 1214.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Sanchez-Aguilera, M. Sanchez-Beato, J. F. Garcia, I. Prieto, M. Pollan, and M. A. Piris
p14ARF nuclear overexpression in aggressive B-cell lymphomas is a sensor of malfunction of the common tumor suppressor pathways
Blood, February 15, 2002; 99(4): 1411 - 1418.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Sato, N. Harpaz, D. Shibata, Y. Xu, J. Yin, Y. Mori, T.-T. Zou, S. Wang, K. Desai, A. Leytin, et al.
Hypermethylation of the p14ARF Gene in Ulcerative Colitis-associated Colorectal Carcinogenesis
Cancer Res., February 1, 2002; 62(4): 1148 - 1151.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. F. Garcia, R. Villuendas, M. Sanchez-Beato, A. Sanchez-Aguilera, L. Sanchez, I. Prieto, and M. A. Piris
Nucleolar p14ARF Overexpression in Reed-Sternberg Cells in Hodgkin's Lymphoma : Absence of p14ARF/Hdm2 Complexes Is Associated with Expression of Alternatively Spliced Hdm2 Transcripts
Am. J. Pathol., February 1, 2002; 160(2): 569 - 578.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Korgaonkar, L. Zhao, M. Modestou, and D. E. Quelle
ARF Function Does Not Require p53 Stabilization or Mdm2 Relocalization
Mol. Cell. Biol., January 1, 2002; 22(1): 196 - 206.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Kwong, K.-W. Lo, K.-F. To, P. M. L. Teo, P. J. Johnson, and D. P. Huang
Promoter Hypermethylation of Multiple Genes in Nasopharyngeal Carcinoma
Clin. Cancer Res., January 1, 2002; 8(1): 131 - 137.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Ueki, M. Toyota, H. Skinner, K. M. Walter, C. J. Yeo, J.-P. J. Issa, R. H. Hruban, and M. Goggins
Identification and Characterization of Differentially Methylated CpG Islands in Pancreatic Carcinoma
Cancer Res., December 1, 2001; 61(23): 8540 - 8546.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. T. Nguyen, F. A. Gonzales, and P. A. Jones
Altered chromatin structure associated with methylation-induced gene silencing in cancer cells: correlation of accessibility, methylation, MeCP2 binding and acetylation
Nucleic Acids Res., November 15, 2001; 29(22): 4598 - 4606.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Wong, T. G. Paulson, L. J. Prevo, P. C. Galipeau, G. Longton, P. L. Blount, and B. J. Reid
p16INK4a Lesions Are Common, Early Abnormalities that Undergo Clonal Expansion in Barrett's Metaplastic Epithelium
Cancer Res., November 1, 2001; 61(22): 8284 - 8289.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Nakamura, T. Sakaki, H. Hashimoto, H. Nakase, E. Ishida, K. Shimada, and N. Konishi
Frequent Alterations of the p14ARF and p16INK4a Genes in Primary Central Nervous System Lymphomas
Cancer Res., September 1, 2001; 61(17): 6335 - 6339.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Lubomierski, M. Kersting, T. Bert, K. Muench, U. Wulbrand, M. Schuermann, D. Bartsch, and B. Simon
Tumor Suppressor Genes in the 9p21 Gene Cluster Are Selective Targets of Inactivation in Neuroendocrine Gastroenteropancreatic Tumors
Cancer Res., August 1, 2001; 61(15): 5905 - 5910.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Chakravarti, M. A. Delaney, E. Noll, P. McL. Black, J. S. Loeffler, A. Muzikansky, and N. J. Dyson
Prognostic and Pathologic Significance of Quantitative Protein Expression Profiling in Human Gliomas
Clin. Cancer Res., August 1, 2001; 7(8): 2387 - 2395.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. A. Nicholson, N. T. Okby, M. A. Khan, J. A. Welsh, M. G. McMenamin, W. D. Travis, J. R. Jett, H. D. Tazelaar, V. Trastek, P. C. Pairolero, et al.
Alterations of p14ARF, p53, and p73 Genes Involved in the E2F-1-mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma
Cancer Res., July 1, 2001; 61(14): 5636 - 5643.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Magdinier and A. P. Wolffe
Selective association of the methyl-CpG binding protein MBD2 with the silent p14/p16 locus in human neoplasia
PNAS, April 12, 2001; (2001) 101617298.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
S. B. Baylin, M. Esteller, M. R. Rountree, K. E. Bachman, K. Schuebel, and J. G. Herman
Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer
Hum. Mol. Genet., April 1, 2001; 10(7): 687 - 692.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Esteller, C. Cordon-Cardo, P. G. Corn, S. J. Meltzer, K. S. Pohar, D. N. Watkins, G. Capella, M. A. Peinado, X. Matias-Guiu, J. Prat, et al.
p14ARF Silencing by Promoter Hypermethylation Mediates Abnormal Intracellular Localization of MDM2
Cancer Res., April 1, 2001; 61(7): 2816 - 2821.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman
A Gene Hypermethylation Profile of Human Cancer
Cancer Res., April 1, 2001; 61(8): 3225 - 3229.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
C. A. Eads, R. V. Lord, K. Wickramasinghe, T. I. Long, S. K. Kurumboor, L. Bernstein, J. H. Peters, S. R. DeMeester, T. R. DeMeester, K. A. Skinner, et al.
Epigenetic Patterns in the Progression of Esophageal Adenocarcinoma
Cancer Res., April 1, 2001; 61(8): 3410 - 3418.
[Abstract] [Full Text]


Home page
JCOHome page
M. Esteller, S. Gonzalez, R. A. Risques, E. Marcuello, R. Mangues, J. R. Germa, J. G. Herman, G. Capella, and M. A. Peinado
K-ras and p16 Aberrations Confer Poor Prognosis in Human Colorectal Cancer
J. Clin. Oncol., January 15, 2001; 19(2): 299 - 304.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Zöchbauer-Müller, K. M. Fong, A. K. Virmani, J. Geradts, A. F. Gazdar, and J. D. Minna
Aberrant Promoter Methylation of Multiple Genes in Non-Small Cell Lung Cancers
Cancer Res., January 1, 2001; 61(1): 249 - 255.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Esteller, A. Sparks, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, S. Gonzalez, G. Tarafa, D. Sidransky, S. J. Meltzer, et al.
Analysis of Adenomatous Polyposis Coli Promoter Hypermethylation in Human Cancer
Cancer Res., August 1, 2000; 60(16): 4366 - 4371.
[Abstract] [Full Text]


Home page
CarcinogenesisHome page
M. Serrano
The INK4a/ARF locus in murine tumorigenesis
Carcinogenesis, May 1, 2000; 21(5): 865 - 869.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Esteller, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, D. N. Watkins, J.-P. J. Issa, D. Sidransky, S. B. Baylin, and J. G. Herman
Inactivation of the DNA Repair Gene O6-Methylguanine-DNA Methyltransferase by Promoter Hypermethylation Is Associated with G to A Mutations in K-ras in Colorectal Tumorigenesis
Cancer Res., May 1, 2000; 60(9): 2368 - 2371.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Magdinier and A. P. Wolffe
Selective association of the methyl-CpG binding protein MBD2 with the silent p14/p16 locus in human neoplasia
PNAS, April 24, 2001; 98(9): 4990 - 4995.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Esteller, M.
Right arrow Articles by Herman, J. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Esteller, M.
Right arrow Articles by Herman, J. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online