This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Esteller, M. Articles by Herman, J. G. Search for Related Content PubMed PubMed Citation Articles by Esteller, M. Articles by Herman, J. G.

Hypermethylation-associated Inactivation of p14^ARF Is Independent of p16^INK4a Methylation and p53 Mutational Status¹

The Johns Hopkins Oncology Center, Baltimore, Maryland 21231 [M. E., M. T., S. B. B., J. G. H.]; Laboratori d’Investigacio Gastrointestinal, Hospital de la Santa Creu i Sant Pau, Barcelona, 08025 Spain [G. C.]; and Institut de Recerca Oncologica, Hospital Duran i Reynals, Barcelona, 08907 Spain [S. T., M. A. P.]

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The INK4a/ARF locus encodes two cell cycle-regulatory proteins, p16^INK4a and p14^ARF, which share an exon using different reading frames. p14^ARF antagonizes MDM2-dependent p53 degradation. However, no point mutations in p14^ARF not altering p16^INK4a have been described in primary tumors. We report that p14^ARF is epigenetically inactivated in several colorectal cell lines, and its expression is restored by treatment with demethylating agents. In primary colorectal carcinomas, p14^ARF promoter hypermethylation was found in 31 of 110 (28%) of the tumors and observed in 13 of 41 (32%) colorectal adenomas but was not present in any normal tissues. p14^ARF methylation appears in the context of an adjacent unmethylated p16^INK4a promoter in 16 of 31 (52%) of the carcinomas methylated at p14^ARF. Although p14^ARF hypermethylation was slightly overrepresented in tumors with wild-type p53 compared to tumors harboring p53 mutations [19 of 55 (34%) versus 12 of 55 (22%)], this difference did not reach statistical significance. p14^ARF aberrant methylation was not related to the presence of K-ras mutations. Our results demonstrate that p14^ARF promoter hypermethylation is frequent in colorectal cancer and occurs independently of the p16^INK4a methylation status and only marginally in relation to the p53 mutational status.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Disruption of the p53 and Rb³ tumor suppressor pathways is a fundamental trend of most human cancer cells (1) . In tumorigenesis, loss of Rb function can occur by direct inactivation of the Rb gene itself through mutation, sequestration of the Rb protein by viral oncoproteins, or promoter hypermethylation or by deregulation of the genes controlling Rb phosphorylation status (2) . These last alterations include cyclin D1 gene amplification, CDK4 activating mutations, and also gene amplification and inactivation of the inhibitors of CDK4, the INK4 family (composed of p15^INK4b, p16^INK4a, p18^INK4c, and p19^INK4d; Refs. 1 and 3 ). The p16^INK4a gene was implicated as a tumor suppressor gene by its frequent mutation, deletion, or promoter hypermethylation in a variety of human tumors (1 , 4 , 5) . In addition, p16^INK4a germ-line mutations have been associated with familial melanoma (6) . Recently, it was demonstrated that a portion of the p16^INK4a gene has the capacity to encode a second product, murine p19^ARF (7) . p19^ARF, or human p14^ARF, has a unique first exon (denominated exon 1ß), located approximately 20 kb centromeric to the first exon of p16^INK4a (denoted as exon 1). Under the control of its own promoter, exon 1ß splices into exon 2 of INK4a in an alternative reading frame, producing a different protein than p16^INK4a (1 , 3 , 7 , 8) .

p19^ARF overexpression induces G₁- and G₂-phase arrest through a p16^INK4a-independent mechanism (9) . Furthermore, the p19^ARF-mediated cell cycle arrest seems to be abolished in mouse embryo fibroblasts lacking functional p53 (8) . Recent work suggests that p19^ARF and p14^ARF interact in vivo with the MDM2 protein, neutralizing MDM2-mediated degradation of p53 (10, 11, 12, 13) . Thus, theoretically, inactivation of p14^ARF would then be predicted to decrease the frequency for concomitant p53 mutations. p19^ARF binds to MDM2 through its NH₂ terminus end, which encodes exon 1ß (13) . p19^ARF-specific null mice carrying a disrupted exon 1ß are cancer prone at an early age (8) , but no human point mutations in exon 1ß have been reported. Interestingly, exon 1ß-specific deletions have been described in melanoma cell lines (14) , and p14^ARF genomic alterations are found in a majority of T-cell acute lymphocytic leukemias (15) . However, to date, most of the functional studies of p14^ARF have involved murine systems, and little is known about the putative p14^ARF function as a tumor suppressor gene in humans. Recently, the human p14^ARF promoter has been cloned and contains a CpG island that is aberrantly methylated in colorectal cancer cell lines (16) . Hypermethylation of normally unmethylated CpG islands in the promoter regions of tumor suppressor and DNA repair genes, including p16^INK4a, E-cadherin, hMLH1, GSTP1, and MGMT (4 , 17, 18, 19, 20) , correlates with loss of transcription. Thus, promoter hypermethylation could be a mechanism for p14^ARF inactivation in human tumors. In addition, methylation of p16^INK4a and p15^INK4b can occur with more tumor-specific patterns than found for homozygous deletions involving the entire 9p region encompassing these genes (21) .

In the present study, we studied CpG island promoter methylation of the human p14^ARF gene in cancer cell lines and more than 100 primary colorectal carcinomas. Colorectal tumors were chosen because homozygous deletions of the INK4a/ARF locus are not present in this tumor type (22) , and colorectal carcinoma has well-characterized mutational inactivation of p53, thus allowing us to examine the relationship to p53 mutations. Our results demonstrate that p14^ARF can be silenced by promoter hypermethylation in colorectal cancer cell lines. In the primary colorectal tumors, p14^ARF is aberrantly methylated in approximately a quarter of the neoplasms studied, and this methylation represents an event independent of the p16^INK4a methylation status. Furthermore, p14^ARF hypermethylation, although more frequent in tumors with wild-type p53, is also observed in those cancers with p53 mutations.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
MSP.
DNA methylation patterns in the CpG islands of the p14^ARF gene were determined by MSP (23) . MSP distinguishes unmethylated from methylated alleles in a given gene based on sequence changes produced after bisulfite treatment of DNA, which converts unmethylated (but not methylated) cytosines to uracil, and subsequent PCR using primers designed for either methylated or unmethylated DNA (23) . The primer sequences designed for p14^ARF spanned six CpGs within the 5' region of the gene. Primer sequences of p14^ARF for the unmethylated reaction were 5'-TTTTTGGTGTTAAAGGGTGGTGTAGT-3' (sense) and 5'-CACAAAAACCCTCACTCACAACAA-3' (antisense), which amplify a 132-bp product, and primer sequences of p14^ARF for the methylated reaction were 5'-GTGTTAAAGGGCGGCGTAGC-3' (sense) and 5'-AAAACCCTCACTCGCGACGA-3' (antisense), which amplify a 122-bp product. The 5' position of the sense unmethylated and methylated primers corresponds to bp 195 and 201 of GenBank sequence number L41934. Both antisense primers originate from bp 303 of this sequence. The annealing temperature for both the unmethylated and methylated reactions was 60°C. Placental DNA treated in vitro with SssI methyltransferase was used as a positive control for methylated alleles. DNA from normal lymphocytes was used as a negative control for methylated genes. Ten µl of each PCR reaction were loaded directly onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under UV illumination. DNA methylation patterns in the 5'-CpG island of p16^INK4a were determined by MSP as described previously (23) .

RT-PCR.
RT-PCR was performed as described previously (21) , using 3 µg of total cellular RNA to generate cDNA. This cDNA (100 ng) was amplified by PCR with primers for exon 1ß (5'-GGTTTTCGTGGTTCACATCCCGCG-3') and exon 2 (5'-CAGGAAGCCCTCCCGGGCAGC-3') of p14^ARF, which amplify a 254-bp product spanning sequence 204–437 from GenBank accession number S78535. RT-PCR for GAPDH served as a positive control. Ten µl of each PCR reaction were loaded directly onto nondenaturing 6% polyacrylamide gels, stained with ethidium bromide, and visualized under UV illumination.

Detection of K-ras and p53 Mutations.
Mutations at codons 12 and 13 of the K-ras gene were detected and characterized by a RFLP/PCR approach (24) . p53 mutations in exons 4–9 were analyzed by single-strand conformational polymorphism analysis. Briefly, a first PCR was performed using primers 12979U (GCTGCCGTGTTCCAGTTGCT) and 14875D (AGGCATCACTGCCCCCTGAT). The resulting 1897-bp fragment was then used as a template to separately amplify a fragment of 410 bp including exons 5 and 6 [with primers 13054U (TACTCCCCTGCCCTCAACAAG) and 13463D (CTCCTCCCAGAGACCCCAGT)] and a fragment of 622 bp including exons 7 and 8 [with primers 13966U (CTGGCCTCATCTTGGGCCTG) and 14587D (CTCGCTTAGTGCTCCCTGGG)]. These two fragments were then digested with restriction enzyme HpaII, and the resulting fragments were run on a 6% polyacrylamide gel without glycerol (0.2 h at 30 W and 5–6 h at 6 W) and with 10% glycerol (0.2 h at 30 W and 13–14 h at 6 W) to detect mobility shifts. Mutations were confirmed by direct cycle sequencing of the PCR products using the AmpliCycle Sequencing Kit (Perkin-Elmer, Branchburg, NJ). Exons 4 and 9 were only analyzed on those samples negative for mutations in exons 5–8. Exon 4 was amplified directly from DNA using primers 12019U (GTCCCCCTTGCCGTCCCAAG) and 12349D (TACGGCCAGGCATTGAAGTC). The resulting 331-bp fragment was run without previous digestion on a 6% polyacrylamide/10% glycerol gel for 0.2 h at 30 W and 19 h at 6 W. To analyze exon 9, a fragment of 788 bp including exons 7–9 was amplified with primers 13966U (CTGGCCTCATCTTGGGCCTG) and 14753D (CTGAAGGGTGAAATATTCTCC) and digested with HhaI to produce two fragments of 548 and 240 bp, the latter of which contained exon 9.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Promoter Hypermethylation and Expression of p14^ARF in Cancer Cell Lines.
Structurally, p14^ARF is a candidate for hypermethylation-associated inactivation because a 5'-CpG island is located around the transcription start site (16) . The region chosen for the MSP analysis spans the area of greatest CpG density studied recently for methylation changes in several cell lines (16) . Normal lymphocytes, colon, breast, endometrium, and lung were found completely unmethylated at the p14^ARF promoter (Fig. 1A ). Normal kidney and liver were also unmethylated at p14^ARF. We also examined 16 cancer cell lines derived from these tissues. p14^ARF was fully methylated in four (25%) colorectal carcinoma cell lines (SW48, RKO, DLD-1, and LoVo; Fig. 1B ). Among these, expression of the p14^ARF transcript by RT-PCR was assessed in LoVo and DLD-1, both of which lack p14^ARF expression (Fig. 1C ). Treatment of these cell lines with the demethylating agent 5-aza-2'-deoxycytidine restored the expression of the transcript in both cases (Fig. 1C ). These results agree with those recently reported by Robertson et al. (16) , although in that case, the colorectal cancer cell line HCT-15, which is isogenic to the DLD-1 cell line (25) , was used. The colorectal cancer cell line RKO methylated at p14^ARF showed a low level of expression but demonstrated an increase in RNA after the treatment with 5-aza-2'-deoxycytidine. A similar phenomenon has been described previously in the case of the colorectal cancer cell line SW48 (16) , which was also methylated at p14^ARF in our study. The colorectal cancer cell lines SW1417, SK-CO1, LS180T, and HT-29 were partially methylated, and p14^ARF expression was demonstrated in the last one (Fig. 1C ). Normal lymphocytes and the unmethylated colorectal cell line SW480 and the unmethylated leukemia cell line HL-60 demonstrated expression of the p14^ARF transcript (Fig. 1C ).

View larger version (55K): [in this window] [in a new window] [Download PPT slide]   Fig. 1. MSP analysis of the promoter region of p14ARF and reactivation of p14ARF by treatment with 5'-aza-2'-deoxycytidine. The presence of a visible PCR product in Lanes U indicates the presence of unmethylated genes of p14ARF; the presence of product in Lanes M indicates the presence of methylated genes. In vitro methylated DNA (IVD) was used as a positive control for p14ARF promoter hypermethylation, and normal lymphocytes (NL) were used as a negative control for methylation. Water controls for PCR reactions are also shown. MSP of p14ARF in normal tissues (A) and cancer cell lines (B). C, the pattern of expression determined by RT-PCR of the p14ARF transcript in cancer cell lines SW480, DLD-1, DLD-1 after 5-aza-2'-deoxycytidine treatment, LoVo, LoVo after 5-aza-2'-deoxycytidine treatment, HT-29, and HL-60 and in normal lymphocytes. GAPDH expression demonstrates relatively equal amounts of initial mRNA. D, MSP of p14ARF in primary colorectal carcinomas (CRC) of p14ARF (top panel) and p16INK4a (bottom panel). CRC1 and CRC6 are unmethylated at both genes, CRC2 and CRC5 are methylated only at p16INK4a, CRC3 is methylated only at p14ARF, and CRC4 is methylated at both genes. E, MSP of p14ARF in colorectal adenomas. p14ARF promoter hypermethylation is demonstrated in samples A2, A4, A5, and A7.

Promoter Hypermethylation of p14^ARF in Primary Colorectal Carcinomas.
DNA obtained from 110 primary colorectal carcinomas was subjected to p14^ARF promoter methylation study using MSP. Among all of the colorectal tumors studied, p14^ARF promoter hypermethylation was present in 31 of 110 (28%) samples (Fig. 1D ). In 32 patients from whom normal adjacent mucosa DNA was available, no methylation of the p14^ARF promoter was observed in any case (an example is shown in Fig. 1A ). Thus, the methylation observed in the colorectal cancers and cell lines is a tumor-specific change. Abnormal methylation of the p14^ARF promoter region in the colorectal carcinomas was not associated with significant differences of gender, age of onset, clinical status, Duke’s stage, DNA ploidy, or the presence of residual disease. When the samples were decoded for their p53 status, p14^ARF was hypermethylated in 19 of 55 (34%) colorectal tumors with wild-type p53 and in 12 of 55 (22%) tumors with a mutant p53 (Fig. 2A ). Thus, although the tumors with functional p53 more often harbor p14^ARF epigenetic inactivation than tumors with p53 mutations, this trend does not reach statistical significance (Fisher’s exact test, P = 0.20) and was certainly not limited to p53 wild-type tumors (Fig. 2A ).

View larger version (25K): [in this window] [in a new window] [Download PPT slide]   Fig. 2. Patterns of p14ARF promoter hypermethylation according to p53 mutational status (A) and p16INK4a promoter hypermethylation (B) in colorectal tumors.

Because it has been recently reported that p19^ARF (the mouse homologue of p14^ARF) is essential for the activation of p53 in response to oncogenic Ras (28) , we also examined the p14^ARF promoter hypermethylation in relation to the K-ras status of the tumor. A total of 43 of 110 (39%) primary colorectal carcinomas had a K-ras point mutation. The frequency of p14^ARF methylation was slightly higher in tumors with K-ras mutations than in those without K-ras mutations [15 of 43 (35%) versus 16 of 67 (24%)], but this difference was not statistically significant (Fisher’s exact test, P = 0.28). Thus, no evident linkage between these epigenetic and genetic alterations was observed.

Promoter Hypermethylation and Expression of p14^ARF in Colorectal Adenomas.
DNA obtained from 41 primary colorectal adenomas was subjected to p14^ARF promoter methylation study using MSP. Among all of the adenomas studied, p14^ARF promoter hypermethylation was present in 13 of 41 (32%) samples (Fig. 1E ). We also examined the expression of p14^ARF using RT-PCR in these colorectal adenomas. Among 20 early lesions with available cDNA, 12 colorectal adenomas unmethylated at p14^ARF expressed high levels of p14^ARF mRNA, whereas 8 adenomas with p14^ARF methylation expressed no detectable p14^ARF mRNA (n = 7) or very little p14^ARF mRNA (n = 1), demonstrating an exact correlation of transcriptional loss with p14^ARF hypermethylation (Fig. 3 ). The similar rate of p14^ARF methylation in adenomas and carcinomas suggests that like p16^INK4a methylation, inactivation of p14^ARF appears to be an early event in colorectal tumorigenesis.

View larger version (37K): [in this window] [in a new window] [Download PPT slide]   Fig. 3. Pattern of expression determined by RT-PCR of the p14ARF transcript in colorectal adenomas. The adenomas with p14ARF promoter hypermethylation show a complete lack (A2, A7, A11, A20, A4, A5, A18) or strongly diminished (A14) p14ARF expression. The colorectal adenomas unmethylated at p14ARF (A1, A3, A8, A9, A10, A12, A13, A15, A16, A17, A6, A19) show high levels of the transcript. GAPDH expression demonstrates relatively equal amounts of initial mRNA.

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Our results demonstrate that p14^ARF promoter hypermethylation occurs in approximately one-fourth of primary colorectal carcinomas. p14^ARF promoter hypermethylation also seems to be an early event in colorectal tumorigenesis because, like p16^INK4a methylation, it can be found in colon adenomas. When the p14^ARF promoter methylation analysis is compared with the p53 status, we observe only a slightly decreased occurrence of p53 mutations in those primary tumors with p14^ARF inactivation. Thus, p14^ARF and p53 can be inactivated simultaneously in the same tumor. Such a scenario is also observed in a mouse model, where tumors arising in p19^ARF-/- mice can harbor p53 mutations (8) .

Finally, it is relevant to note that p14^ARF promoter hypermethylation is not dependent on p16^INK4a promoter methylation status. In our set of colorectal tumors, the most common situation is the simultaneous absence of methylation in both promoters (48%), but after this, the three possible scenarios (p16^INK4a methylated alone, p14^ARF methylated alone, and both methylated) are similarly represented. In primary colorectal carcinoma, hypermethylation of p14^ARF and p16^INK4a are independent events. In colorectal cancer cell lines, because the vast majority of cell lines are methylated at p16^INK4a, no cell line has p14^ARF methylation with an unmethylated p16^INK4a promoter. It is also interesting that the CpG island of p15^INK4b, which is located only 14 kb upstream of the p14^ARF promoter, remains unmethylated in colorectal tumors and cell lines, although it is methylated in leukemia (21) . Thus, the p14^ARF promoter demonstrates selective epigenetic silencing in a subset of colorectal tumors, with a hypermethylated promoter (p14^ARF) between two unmethylated promoters (p16^INK4a and p15^INK4b) that are frequently methylated in other tumors.

In summary, our data suggest that promoter hypermethylation of p14^ARF is a relatively common and early event in colorectal tumorigenesis and is not necessarily related to the methylation status of neighbor gene p16^INK4a or restricted to tumors with intact p53.

	ACKNOWLEDGMENTS

 
We thank Andrew B. Sparks and Kenneth W. Kinzler for providing cell lines for this study.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported in part by NIH Grant CA54396 and Grants from Fondo de Investigacion Sanitaria and Comision Interministerial de Ciencia y Tecnología. M. E. is a recipient of a Spanish Ministerio de Educacion y Cultura Award. J. G. H. is a Valvano Foundation Scholar. S. B. B. and J. G. H. receive research funding and are entitled to sales royalties from ONCOR, which is developing products related to the research described in this article. The terms of this arrangement have been reviewed and approved by The Johns Hopkins University in accordance with its conflict of interest policies.

² To whom requests for reprints should be addressed, at Tumor Biology, The Johns Hopkins Oncology Center, 424 North Bond Street, Baltimore, MD 21231. Phone: (410) 955-8506; Fax: (410) 614-9884; E-mail: hermanji{at}jhmi.edu

³ The abbreviations used are: Rb, retinoblastoma; MSP, methylation-specific PCR; RT-PCR, reverse transcription-PCR; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Received 6/21/99. Accepted 10/27/99.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Sherr C. J. Cancer cell cycles. Science (Washington DC), 276: 1672-1677, 1996.[Abstract/Free Full Text]
2. Weinberg R. A. The retinoblastoma protein and cell cycle control. Cell, 81: 323-330, 1995.[Medline]
3. Chin L., Pomerantz J., DePinho R. A. The INK4a/ARF tumor suppressor: one gene-two products-two pathways. Trends Biochem. Sci., 23: 291-296, 1998.[Medline]
4. Merlo A., Herman J. G., Mao L., Lee D. J., Gabrielson E., Burger P. C., Baylin S. B., Sidransky D. 5' CpG island methylation is associated with transcriptional silencing of the tumour suppressor p16/CDKN2/MTS1 in human cancers. Nat. Med., 1: 686-692, 1995.[Medline]
5. Kamb A. Cell-cycle regulators and cancer. Trends Genet., 11: 136-140, 1995.[Medline]
6. Hussussian C. J., Struewing J. P., Goldtein A. M., Higgins P. A. T., Ally D. S., Sheahan M. D., Clark W. H., Tucker M. A., Dracopoli N. C. Germline p16 mutations in familial adenoma. Nat. Genet., 8: 15-21, 1994.[Medline]
7. Quelle D. E., Zindy F., Ashmun R. A., Scherr C. J. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell, 83: 993-1000, 1995.[Medline]
8. Kamijo T., Zindy F., Roussel M. F., Quelle D. E., Downing J. R., Ashmun R. A., Grosveld G., Sherr C. J. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19^ARF. Cell, 91: 649-659, 1997.[Medline]
9. Sherr C. J. Tumor surveillance via the ARF-p53 pathway. Genes Dev., 12: 2434-2442, 1998.[Abstract/Free Full Text]
10. Pomerantz J., Schreiber-Agus N., Liegeois N. J., Silverman A., Alland L., Chin L., Potes J., Chen K., Orlow I., Lee H. W., Cordon-Cardo C., DePinho R. A. The Ink4a tumor suppressor gene product, p19Arf, interacts with MDM2 and neutralizes MDM2’s inhibition of p53. Cell, 92: 713-723, 1998.[Medline]
11. Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 92: 725-734, 1998.[Medline]
12. Kamijo T., Weber J. D., Zambetti G., Zindy F., Roussel M. F., Sherr C. J. Functional and physical interactions of the ARF tumor suppressor with p53 and Mdm2. Proc. Natl. Acad. Sci. USA, 95: 8292-8297, 1998.[Abstract/Free Full Text]
13. Stott F. J., Bates S., James M. C., McConnell B. B., Starborg M., Brookes S., Palmero I., Ryan K., Hara E., Vousden K. H., Peters G. The alternative product from the human CDKN2A locus, p14(ARF), participates in a regulatory feedback loop with p53 and MDM2. EMBO J., 17: 5001-5014, 1998.[Medline]
14. Larsen C. J. p16^INK4a: a gene with dual capacity to encode unrelated proteins that inhibit cell cycle progression. Oncogene, 12: 2041-2044, 1996.[Medline]
15. Gardie B., Cayuela J. M., Martini S., Sigaux F. Genomic alterations of the p19^ARF encoding exons in T-cell acute lymphoblastic leukemia. Blood, 91: 1016-1020, 1998.[Abstract/Free Full Text]
16. Robertson K. D., Jones P. A. The human ARF cell cycle regulatory gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol. Cell. Biol., 18: 6457-6473, 1998.[Abstract/Free Full Text]
17. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
18. Herman J. G., Umar A., Polyak K., Graff J. R., Ahuja N., Issa J. P., Markowitz S., Willson J. K., Hamilton S. R., Kinzler K. W., Kane M. F., Kolodner R. D., Vogelstein B., Kunkel T. A., Baylin S. B. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. USA, 95: 6870-6875, 1998.[Abstract/Free Full Text]
19. Esteller M., Corn P. G., Urena J. M., Gabrielson E., Baylin S. B., Herman J. G. Inactivation of glutathione S-transferase P1 gene by promoter hypermethylation in human neoplasia. Cancer Res., 58: 4515-4518, 1998.[Abstract/Free Full Text]
20. Esteller M., Hamilton S. R., Burger P. C., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O⁶-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59: 793-797, 1999.[Abstract/Free Full Text]
21. Herman J. G., Jen J., Merlo A., Baylin S. B. Hypermethylation-associated inactivation indicates a tumor suppressor role for p15^INK4B. Cancer Res., 56: 722-727, 1996.[Abstract/Free Full Text]
22. Cairns P., Polascik T. J., Eby Y., Tokino K., Califano J., Merlo A., Mao L., Herath J., Jenkins R., Westra W., Rutter J. L., Buckler A., Gabrielson E., Tockman M., Cho K. R., Hedrick L., Bova G. S., Isaacs W., Koch W., Schwab D., Sidransky D. Frequency of homozygous deletion at p16/CDKN2 in primary human tumours. Nat. Genet., 11: 210-212, 1995.[Medline]
23. Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation specific PCR: a novel PCR assay for methylation status of CpG islands. Proc. Natl. Acad. Sci. USA, 93: 9821-9826, 1996.[Abstract/Free Full Text]
24. Capella G., Cronauer-Mitra S., Peinado M. A., Perucho M. Frequency and spectrum of mutations at codons 12 and 13 of the c-K-ras gene in human tumors. Environ. Heath Persp., 93: 125-131, 1991.
25. Vermeulen S. J., Chen T. R., Speleman F., Nollet F., Van Roy F. M., Mareel M. M. Did the four human cancer cell lines DLD-1, HCT-15, HCT-8, and HRT-18 originate from one and the same patient?. Cancer Genet. Cytogenet., 107: 76-79, 1998.[Medline]
26. Herman J. G., Merlo A., Mao L., Lapidus R. G., Issa J. P., Davidson N. E., Sidransky D., Baylin S. B. Inactivation of the CDKN2/p16/MTS1 gene is frequently associated with aberrant DNA methylation in all common human cancers. Cancer Res., 55: 4525-4530, 1995.[Abstract/Free Full Text]
27. Markl I. D., Jones P. A. Presence and location of TP53 mutation determines pattern of CDKN2A/ARF pathway inactivation in bladder cancer. Cancer Res., 58: 5348-5353, 1998.[Abstract/Free Full Text]
28. Palmero I., Pantoja C., Serrano M. p19^ARF links the tumour suppressor p53 to Ras. Nature (Lond.), 395: 125-126, 1998.[Medline]
29. Hainaut P., Soussi T., Shomer B., Hollstein M., Greenblatt M., Hovig E., Harris C. C., Montesano R. Database of p53 gene somatic mutations in human tumors and cell lines: updated compilation and future prospects. Nucleic Acids Res., 25: 151-157, 1997.[Abstract/Free Full Text]
30. Prives C. Signaling to p53: breaking the MDM2–p53 circuit. Cell, 95: 5-8, 1998.[Medline]
31. Rapp L., Chen J. J. The papillomavirus E6 proteins. Biochim. Biophys. Acta, 1378: F1-F19, 1998.[Medline]

This article has been cited by other articles:

				A. Boquoi, T. Chen, and G. H. Enders Chemoprevention of Mouse Intestinal Tumorigenesis by the Cyclin-Dependent Kinase Inhibitor SNS-032 Cancer Prevention Research, September 1, 2009; 2(9): 800 - 806. [Abstract] [Full Text] [PDF]

				T. TAHARA, T. SHIBATA, T. ARISAWA, M. NAKAMURA, H. YAMASHITA, D. YOSHIOKA, M. OKUBO, N. MARUYAMA, T. KAMANO, Y. KAMIYA, et al. Impact of Catechol-O-methyltransferase (COMT) Gene Polymorphism on Promoter Methylation Status in Gastric Mucosa Anticancer Res, July 1, 2009; 29(7): 2857 - 2861. [Abstract] [Full Text] [PDF]

				J. Xiong and R. J. Epstein Growth inhibition of human cancer cells by 5-aza-2'-deoxycytidine does not correlate with its effects on INK4a/ARF expression or initial promoter methylation status Mol. Cancer Ther., April 1, 2009; 8(4): 779 - 785. [Abstract] [Full Text] [PDF]

				D. E. Freedberg, S. H. Rigas, J. Russak, W. Gai, M. Kaplow, I. Osman, F. Turner, J. A. Randerson-Moor, A. Houghton, K. Busam, et al. Frequent p16-Independent Inactivation of p14ARF in Human Melanoma J Natl Cancer Inst, June 4, 2008; 100(11): 784 - 795. [Abstract] [Full Text] [PDF]

				N B Kiss, J Geli, F Lundberg, C Avci, D Velazquez-Fernandez, J Hashemi, G Weber, A Hoog, T J Ekstrom, M Backdahl, et al. Methylation of the p16INK4A promoter is associated with malignant behavior in abdominal extra-adrenal paragangliomas but not pheochromocytomas Endocr. Relat. Cancer, June 1, 2008; 15(2): 609 - 621. [Abstract] [Full Text] [PDF]

				R. Sailasree, A. Abhilash, K.M. Sathyan, K.R. Nalinakumari, S. Thomas, and S. Kannan Differential Roles of p16INK4A and p14ARF Genes in Prognosis of Oral Carcinoma Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 414 - 420. [Abstract] [Full Text] [PDF]

				A. J. Apicelli, L. B. Maggi Jr., A. C. Hirbe, A. P. Miceli, M. E. Olanich, C. L. Schulte-Winkeler, A. J. Saporita, M. Kuchenreuther, J. Sanchez, K. Weilbaecher, et al. A Non-Tumor Suppressor Role for Basal p19ARF in Maintaining Nucleolar Structure and Function Mol. Cell. Biol., February 1, 2008; 28(3): 1068 - 1080. [Abstract] [Full Text] [PDF]

				H. Zou, J. J. Harrington, A. M. Shire, R. L. Rego, L. Wang, M. E. Campbell, A. L. Oberg, and D. A. Ahlquist Highly Methylated Genes in Colorectal Neoplasia: Implications for Screening Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2686 - 2696. [Abstract] [Full Text] [PDF]

				J. A. Benanti, M. L. Wang, H. E. Myers, K. L. Robinson, C. Grandori, and D. A. Galloway Epigenetic Down-Regulation of ARF Expression Is a Selection Step in Immortalization of Human Fibroblasts by c-Myc Mol. Cancer Res., November 1, 2007; 5(11): 1181 - 1189. [Abstract] [Full Text] [PDF]

				D. Fontijn, A. D. Adema, K. K. Bhakat, H. M. Pinedo, G. J. Peters, and E. Boven O6-Methylguanine-DNA-methyltransferase promoter demethylation is involved in basic fibroblast growth factor induced resistance against temozolomide in human melanoma cells Mol. Cancer Ther., October 1, 2007; 6(10): 2807 - 2815. [Abstract] [Full Text] [PDF]

				C.-S. Chim, R. Liang, T.-K. Fung, C.-L. Choi, and Y.-L. Kwong Epigenetic dysregulation of the death-associated protein kinase/p14/HDM2/p53/Apaf-1 apoptosis pathway in multiple myeloma J. Clin. Pathol., June 1, 2007; 60(6): 664 - 669. [Abstract] [Full Text] [PDF]

				R. W.K. Chiu, S. S.C. Chim, I. H.N. Wong, C. S.C. Wong, W.-S. Lee, K. F. To, J. H.M. Tong, R. K.C. Yuen, A. S.W. Shum, J. K.C. Chan, et al. Hypermethylation of RASSF1A in Human and Rhesus Placentas Am. J. Pathol., March 1, 2007; 170(3): 941 - 950. [Abstract] [Full Text] [PDF]

				M. Wallner, A. Herbst, A. Behrens, A. Crispin, P. Stieber, B. Goke, R. Lamerz, and F. T. Kolligs Methylation of Serum DNA Is an Independent Prognostic Marker in Colorectal Cancer Clin. Cancer Res., December 15, 2006; 12(24): 7347 - 7352. [Abstract] [Full Text] [PDF]

				S. Paliwal, S. Pande, R. C. Kovi, N. E. Sharpless, N. Bardeesy, and S. R. Grossman Targeting of C-Terminal Binding Protein (CtBP) by ARF Results in p53-Independent Apoptosis. Mol. Cell. Biol., March 1, 2006; 26(6): 2360 - 2372. [Abstract] [Full Text] [PDF]

				E. J. Chapman, P. Harnden, P. Chambers, C. Johnston, and M. A. Knowles Comprehensive Analysis of CDKN2A Status in Microdissected Urothelial Cell Carcinoma Reveals Potential Haploinsufficiency, a High Frequency of Homozygous Co-deletion and Associations with Clinical Phenotype Clin. Cancer Res., August 15, 2005; 11(16): 5740 - 5747. [Abstract] [Full Text] [PDF]

				M. Alaminos, V. Davalos, S. Ropero, F. Setien, M. F. Paz, M. Herranz, M. F. Fraga, J. Mora, N.-K. V. Cheung, W. L. Gerald, et al. EMP3, a Myelin-Related Gene Located in the Critical 19q13.3 Region, Is Epigenetically Silenced and Exhibits Features of a Candidate Tumor Suppressor in Glioma and Neuroblastoma Cancer Res., April 1, 2005; 65(7): 2565 - 2571. [Abstract] [Full Text] [PDF]

				H. Matsubayashi, N. Sato, K. Brune, A. L. Blackford, R. H. Hruban, M. Canto, C. J. Yeo, and M. Goggins Age- and Disease-Related Methylation of Multiple Genes in Nonneoplastic Duodenum and in Duodenal Juice Clin. Cancer Res., January 15, 2005; 11(2): 573 - 583. [Abstract] [Full Text] [PDF]

				W.-C. Xue, K. Y.K. Chan, H.-C. Feng, P.-M. Chiu, H. Y.S. Ngan, S.-W. Tsao, and A. N.Y. Cheung Promoter Hypermethylation of Multiple Genes in Hydatidiform Mole and Choriocarcinoma J. Mol. Diagn., November 1, 2004; 6(4): 326 - 334. [Abstract] [Full Text] [PDF]

				J. Roman-Gomez, A. Jimenez-Velasco, J. A. Castillejo, X. Agirre, M. Barrios, G. Navarro, F. J. Molina, M. J. Calasanz, F. Prosper, A. Heiniger, et al. Promoter hypermethylation of cancer-related genes: a strong independent prognostic factor in acute lymphoblastic leukemia Blood, October 15, 2004; 104(8): 2492 - 2498. [Abstract] [Full Text] [PDF]

				I. I. de Caceres, C. Battagli, M. Esteller, J. G. Herman, E. Dulaimi, M. I. Edelson, C. Bergman, H. Ehya, B. L. Eisenberg, and P. Cairns Tumor Cell-Specific BRCA1 and RASSF1A Hypermethylation in Serum, Plasma, and Peritoneal Fluid from Ovarian Cancer Patients Cancer Res., September 15, 2004; 64(18): 6476 - 6481. [Abstract] [Full Text] [PDF]

				A. Datta, A. Nag, W. Pan, N. Hay, A. L. Gartel, O. Colamonici, Y. Mori, and P. Raychaudhuri Myc-ARF (Alternate Reading Frame) Interaction Inhibits the Functions of Myc J. Biol. Chem., August 27, 2004; 279(35): 36698 - 36707. [Abstract] [Full Text] [PDF]

				M. Alaminos, V. Davalos, N.-K. V. Cheung, W. L. Gerald, and M. Esteller Clustering of Gene Hypermethylation Associated With Clinical Risk Groups in Neuroblastoma J Natl Cancer Inst, August 18, 2004; 96(16): 1208 - 1219. [Abstract] [Full Text] [PDF]

				H.-S. Hsu, Y.-C. Wang, R.-C. Tseng, J.-W. Chang, J.-T. Chen, C.-M. Shih, C.-Y. Chen, and Y.-C. Wang CpG Island Methylation Is Responsible for p14ARF Inactivation and Inversely Correlates with p53 Overexpression in Resected Non-Small Cell Lung Cancer Clin. Cancer Res., July 15, 2004; 10(14): 4734 - 4741. [Abstract] [Full Text] [PDF]

				M. Pellise, A. Castells, A. Gines, R. Agrelo, M. Sole, S. Castellvi-Bel, G. Fernandez-Esparrach, J. Llach, M. Esteller, J. M. Bordas, et al. Detection of Lymph Node Micrometastases by Gene Promoter Hypermethylation in Samples Obtained by Endosonography- Guided Fine-Needle Aspiration Biopsy Clin. Cancer Res., July 1, 2004; 10(13): 4444 - 4449. [Abstract] [Full Text] [PDF]

				S.-i. Maruya, J.-P. J. Issa, R. S. Weber, D. I. Rosenthal, J. C. Haviland, R. Lotan, and A. K. El-Naggar Differential Methylation Status of Tumor-Associated Genes in Head and Neck Squamous Carcinoma: Incidence and Potential Implications Clin. Cancer Res., June 1, 2004; 10(11): 3825 - 3830. [Abstract] [Full Text] [PDF]

				R. Tang, C. R. Changchien, M.-C. Wu, C.-W. Fan, K.-W. Liu, J.-S. Chen, H.-T. Chien, and L.-L. Hsieh Colorectal cancer without high microsatellite instability and chromosomal instability--an alternative genetic pathway to human colorectal cancer Carcinogenesis, May 1, 2004; 25(5): 841 - 846. [Abstract] [Full Text] [PDF]

				M.-J. Boucher, D. Jean, A. Vezina, and N. Rivard Dual role of MEK/ERK signaling in senescence and transformation of intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, May 1, 2004; 286(5): G736 - G746. [Abstract] [Full Text] [PDF]

				C V A Wynter, M D Walsh, T Higuchi, B A Leggett, J Young, and J R Jass Methylation patterns define two types of hyperplastic polyp associated with colorectal cancer Gut, April 1, 2004; 53(4): 573 - 580. [Abstract] [Full Text] [PDF]

				E. Dulaimi, R. G. Uzzo, R. E. Greenberg, T. Al-Saleem, and P. Cairns Detection of Bladder Cancer in Urine by a Tumor Suppressor Gene Hypermethylation Panel Clin. Cancer Res., March 15, 2004; 10(6): 1887 - 1893. [Abstract] [Full Text] [PDF]

				C. Battagli, R. G. Uzzo, E. Dulaimi, I. Ibanez de Caceres, R. Krassenstein, T. Al-Saleem, R. E. Greenberg, and P. Cairns Promoter Hypermethylation of Tumor Suppressor Genes in Urine from Kidney Cancer Patients Cancer Res., December 15, 2003; 63(24): 8695 - 8699. [Abstract] [Full Text] [PDF]

				L. Kopelovich, J. A. Crowell, and J. R. Fay The Epigenome as a Target for Cancer Chemoprevention J Natl Cancer Inst, December 3, 2003; 95(23): 1747 - 1757. [Abstract] [Full Text] [PDF]

				J. G. Herman and S. B. Baylin Gene Silencing in Cancer in Association with Promoter Hypermethylation N. Engl. J. Med., November 20, 2003; 349(21): 2042 - 2054. [Full Text] [PDF]

				R. L. Ward, K. Cheong, S.-L. Ku, A. Meagher, T. O'Connor, and N. J. Hawkins Adverse Prognostic Effect of Methylation in Colorectal Cancer Is Reversed by Microsatellite Instability J. Clin. Oncol., October 15, 2003; 21(20): 3729 - 3736. [Abstract] [Full Text] [PDF]

				T. Watanabe, Y. Katayama, A. Yoshino, C. Komine, and T. Yokoyama Deregulation of the TP53/p14ARF Tumor Suppressor Pathway in Low-Grade Diffuse Astrocytomas and Its Influence on Clinical Course Clin. Cancer Res., October 15, 2003; 9(13): 4884 - 4890. [Abstract] [Full Text] [PDF]

				G. H. Kang, H. J. Lee, K. S. Hwang, S. Lee, J.-H. Kim, and J.-S. Kim Aberrant CpG Island Hypermethylation of Chronic Gastritis, in Relation to Aging, Gender, Intestinal Metaplasia, and Chronic Inflammation Am. J. Pathol., October 1, 2003; 163(4): 1551 - 1556. [Abstract] [Full Text] [PDF]

				M. van Rijnsoever, H. Elsaleh, D. Joseph, K. McCaul, and B. Iacopetta CpG Island Methylator Phenotype Is an Independent Predictor of Survival Benefit from 5-Fluorouracil in Stage III Colorectal Cancer Clin. Cancer Res., August 1, 2003; 9(8): 2898 - 2903. [Abstract] [Full Text] [PDF]

				A H Prowse, D C Schultz, S Guo, L Vanderveer, J Dangel, B Bove, P Cairns, M Daly, and A K Godwin Identification of a splice acceptor site mutation in p16INK4A/p14ARF within a breast cancer, melanoma, neurofibroma prone kindred J. Med. Genet., August 1, 2003; 40(8): e102 - 102. [Full Text] [PDF]

				D.-H. Kim, J. S. Kim, Y.-I. Ji, Y. M. Shim, H. Kim, J. Han, and J. Park Hypermethylation of RASSF1A Promoter Is Associated with the Age at Starting Smoking and a Poor Prognosis in Primary Non-Small Cell Lung Cancer Cancer Res., July 1, 2003; 63(13): 3743 - 3746. [Abstract] [Full Text] [PDF]

				M. van Engeland, M. P. Weijenberg, G. M. J. M. Roemen, M. Brink, A. P. de Bruine, R. A. Goldbohm, P. A. van den Brandt, S. B. Baylin, A. F. P. M. de Goeij, and J. G. Herman Effects of Dietary Folate and Alcohol Intake on Promoter Methylation in Sporadic Colorectal Cancer: The Netherlands Cohort Study on Diet and Cancer Cancer Res., June 15, 2003; 63(12): 3133 - 3137. [Abstract] [Full Text] [PDF]

				D. V. Bulavin, O. Kovalsky, M. C. Hollander, and A. J. Fornace Jr. Loss of Oncogenic H-ras-Induced Cell Cycle Arrest and p38 Mitogen-Activated Protein Kinase Activation by Disruption of Gadd45a Mol. Cell. Biol., June 1, 2003; 23(11): 3859 - 3871. [Abstract] [Full Text] [PDF]

				B. P. Whitcomb, D. G. Mutch, T. J. Herzog, J. S. Rader, R. K. Gibb, and P. J. Goodfellow Frequent HOXA11 and THBS2 Promoter Methylation, and a Methylator Phenotype in Endometrial Adenocarcinoma Clin. Cancer Res., June 1, 2003; 9(6): 2277 - 2287. [Abstract] [Full Text] [PDF]

				B. Klump, C.-J. Hsieh, S. Dette, K. Holzmann, R. Kiesslich, M. Jung, U. Sinn, M. Ortner, R. Porschen, and M. Gregor Promoter Methylation of INK4a/ARF As Detected in Bile-Significance for the Differential Diagnosis in Biliary Disease Clin. Cancer Res., May 1, 2003; 9(5): 1773 - 1778. [Abstract] [Full Text] [PDF]

				S. L. Gibson, C. Y. Dai, H.-W. Lee, R. A. DePinho, M. S. Gee, W. M. F. Lee, E. E. Furth, C. Brensinger, and G. H. Enders Inhibition of Colon Tumor Progression and Angiogenesis by the Ink4a/Arf Locus Cancer Res., February 15, 2003; 63(4): 742 - 746. [Abstract] [Full Text] [PDF]

				H. Rizos, E. Diefenbach, P. Badhwar, S. Woodruff, T. M. Becker, R. J. Rooney, and R. F. Kefford Association of p14ARF with the p120E4F Transcriptional Repressor Enhances Cell Cycle Inhibition J. Biol. Chem., February 7, 2003; 278(7): 4981 - 4989. [Abstract] [Full Text] [PDF]

				A. S. Tam, T. R. Devereux, A. C. Patel, J. F. Foley, R. R. Maronpot, and T. E. Massey Perturbations of the Ink4a/Arf gene locus in aflatoxin B1-induced mouse lung tumors Carcinogenesis, January 1, 2003; 24(1): 121 - 132. [Abstract] [Full Text] [PDF]

				J R Jass, M Barker, L Fraser, M D Walsh, V L J Whitehall, B Gabrielli, J Young, and B A Leggett APC mutation and tumour budding in colorectal cancer J. Clin. Pathol., January 1, 2003; 56(1): 69 - 73. [Abstract] [Full Text] [PDF]

				S. Kusy, M. Cividin, N. Sorel, F. Brizard, F. Guilhot, A. Brizard, C. Larsen, and J. Roche p14ARF, p15INK4b, and p16INK4a methylation status in chronic myelogenous leukemia Blood, January 1, 2003; 101(1): 374 - 374. [Full Text] [PDF]

				M van Rijnsoever, F Grieu, H Elsaleh, D Joseph, and B Iacopetta Characterisation of colorectal cancers showing hypermethylation at multiple CpG islands Gut, December 1, 2002; 51(6): 797 - 802. [Abstract] [Full Text] [PDF]

				A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind INK4a-ARF alterations in liver cell adenoma Mol. Pathol., December 1, 2002; 55(6): 379 - 384. [Abstract] [Full Text] [PDF]

				V. L. J. Whitehall, C. V. A. Wynter, M. D. Walsh, L. A. Simms, D. Purdie, N. Pandeya, J. Young, S. J. Meltzer, B. A. Leggett, and J. R. Jass Morphological and Molecular Heterogeneity within Nonmicrosatellite Instability-High Colorectal Cancer Cancer Res., November 1, 2002; 62(21): 6011 - 6014. [Abstract] [Full Text] [PDF]

				K. Ogi, M. Toyota, M. Ohe-Toyota, N. Tanaka, M. Noguchi, T. Sonoda, G. Kohama, and T. Tokino Aberrant Methylation of Multiple Genes and Clinicopathological Features in Oral Squamous Cell Carcinoma Clin. Cancer Res., October 1, 2002; 8(10): 3164 - 3171. [Abstract] [Full Text] [PDF]

				D. Javelaud and F. Besancon Inactivation of p21WAF1Sensitizes Cells to Apoptosis via an Increase of Both p14ARF and p53 Levels and an Alteration of the Bax/Bcl-2 Ratio J. Biol. Chem., September 27, 2002; 277(40): 37949 - 37954. [Abstract] [Full Text] [PDF]

				Q. Tao, H. Huang, T. M. Geiman, C. Y. Lim, L. Fu, G.-H. Qiu, and K. D. Robertson Defective de novo methylation of viral and cellular DNA sequences in ICF syndrome cells Hum. Mol. Genet., September 1, 2002; 11(18): 2091 - 2102. [Abstract] [Full Text] [PDF]

				A Tannapfel, C Busse, F Geissler, H Witzigmann, J Hauss, and C Wittekind INK4a-ARF alterations in liver cell adenoma Gut, August 1, 2002; 51(2): 253 - 258. [Abstract] [Full Text] [PDF]

				A. Gloghini, G. Gaidano, L. M. Larocca, F. Pierconti, A. Cingolani, L. Dal Maso, D. Capello, S. Franceschi, U. Tirelli, M. Libra, et al. Expression of Cyclin-Dependent Kinase Inhibitor p27Kip1 in AIDS-Related Diffuse Large-Cell Lymphomas Is Associated with Epstein-Barr Virus-Encoded Latent Membrane Protein 1 Am. J. Pathol., July 1, 2002; 161(1): 163 - 171. [Abstract] [Full Text] [PDF]

				K. W. Choy, C. P. Pang, K. F. To, C. B. O. Yu, J. S. K. Ng, and D. S. C. Lam Impaired Expression and Promotor Hypermethylation of O6-Methylguanine-DNA Methyltransferase in Retinoblastoma Tissues Invest. Ophthalmol. Vis. Sci., May 1, 2002; 43(5): 1344 - 1349. [Abstract] [Full Text] [PDF]

				J. Smeds, P. Berggren, X. Ma, Z. Xu, K. Hemminki, and R. Kumar Genetic status of cell cycle regulators in squamous cell carcinoma of the oesophagus: the CDKN2A (p16INK4a and p14ARF ) and p53 genes are major targets for inactivation Carcinogenesis, April 1, 2002; 23(4): 645 - 655. [Abstract] [Full Text] [PDF]

				G. Dominguez, J. Carballido, J. Silva, J. M. Silva, J. M. Garcia, J. Menendez, M. Provencio, P. Espana, and F. Bonilla p14ARF Promoter Hypermethylation in Plasma DNA as an Indicator of Disease Recurrence in Bladder Cancer Patients Clin. Cancer Res., April 1, 2002; 8(4): 980 - 985. [Abstract] [Full Text] [PDF]

				N. Konishi, M. Nakamura, M. Kishi, M. Nishimine, E. Ishida, and K. Shimada Heterogeneous Methylation and Deletion Patterns of the INK4a/ARF Locus Within Prostate Carcinomas Am. J. Pathol., April 1, 2002; 160(4): 1207 - 1214. [Abstract] [Full Text] [PDF]

				A. Sanchez-Aguilera, M. Sanchez-Beato, J. F. Garcia, I. Prieto, M. Pollan, and M. A. Piris p14ARF nuclear overexpression in aggressive B-cell lymphomas is a sensor of malfunction of the common tumor suppressor pathways Blood, February 15, 2002; 99(4): 1411 - 1418. [Abstract] [Full Text] [PDF]

				F. Sato, N. Harpaz, D. Shibata, Y. Xu, J. Yin, Y. Mori, T.-T. Zou, S. Wang, K. Desai, A. Leytin, et al. Hypermethylation of the p14ARF Gene in Ulcerative Colitis-associated Colorectal Carcinogenesis Cancer Res., February 1, 2002; 62(4): 1148 - 1151. [Abstract] [Full Text] [PDF]

				J. F. Garcia, R. Villuendas, M. Sanchez-Beato, A. Sanchez-Aguilera, L. Sanchez, I. Prieto, and M. A. Piris Nucleolar p14ARF Overexpression in Reed-Sternberg Cells in Hodgkin's Lymphoma : Absence of p14ARF/Hdm2 Complexes Is Associated with Expression of Alternatively Spliced Hdm2 Transcripts Am. J. Pathol., February 1, 2002; 160(2): 569 - 578. [Abstract] [Full Text] [PDF]

				C. Korgaonkar, L. Zhao, M. Modestou, and D. E. Quelle ARF Function Does Not Require p53 Stabilization or Mdm2 Relocalization Mol. Cell. Biol., January 1, 2002; 22(1): 196 - 206. [Abstract] [Full Text] [PDF]

				J. Kwong, K.-W. Lo, K.-F. To, P. M. L. Teo, P. J. Johnson, and D. P. Huang Promoter Hypermethylation of Multiple Genes in Nasopharyngeal Carcinoma Clin. Cancer Res., January 1, 2002; 8(1): 131 - 137. [Abstract] [Full Text] [PDF]

				T. Ueki, M. Toyota, H. Skinner, K. M. Walter, C. J. Yeo, J.-P. J. Issa, R. H. Hruban, and M. Goggins Identification and Characterization of Differentially Methylated CpG Islands in Pancreatic Carcinoma Cancer Res., December 1, 2001; 61(23): 8540 - 8546. [Abstract] [Full Text] [PDF]

				C. T. Nguyen, F. A. Gonzales, and P. A. Jones Altered chromatin structure associated with methylation-induced gene silencing in cancer cells: correlation of accessibility, methylation, MeCP2 binding and acetylation Nucleic Acids Res., November 15, 2001; 29(22): 4598 - 4606. [Abstract] [Full Text] [PDF]

				D. J. Wong, T. G. Paulson, L. J. Prevo, P. C. Galipeau, G. Longton, P. L. Blount, and B. J. Reid p16INK4a Lesions Are Common, Early Abnormalities that Undergo Clonal Expansion in Barrett's Metaplastic Epithelium Cancer Res., November 1, 2001; 61(22): 8284 - 8289. [Abstract] [Full Text] [PDF]

				M. Nakamura, T. Sakaki, H. Hashimoto, H. Nakase, E. Ishida, K. Shimada, and N. Konishi Frequent Alterations of the p14ARF and p16INK4a Genes in Primary Central Nervous System Lymphomas Cancer Res., September 1, 2001; 61(17): 6335 - 6339. [Abstract] [Full Text] [PDF]

				N. Lubomierski, M. Kersting, T. Bert, K. Muench, U. Wulbrand, M. Schuermann, D. Bartsch, and B. Simon Tumor Suppressor Genes in the 9p21 Gene Cluster Are Selective Targets of Inactivation in Neuroendocrine Gastroenteropancreatic Tumors Cancer Res., August 1, 2001; 61(15): 5905 - 5910. [Abstract] [Full Text] [PDF]

				A. Chakravarti, M. A. Delaney, E. Noll, P. McL. Black, J. S. Loeffler, A. Muzikansky, and N. J. Dyson Prognostic and Pathologic Significance of Quantitative Protein Expression Profiling in Human Gliomas Clin. Cancer Res., August 1, 2001; 7(8): 2387 - 2395. [Abstract] [Full Text] [PDF]

				S. A. Nicholson, N. T. Okby, M. A. Khan, J. A. Welsh, M. G. McMenamin, W. D. Travis, J. R. Jett, H. D. Tazelaar, V. Trastek, P. C. Pairolero, et al. Alterations of p14ARF, p53, and p73 Genes Involved in the E2F-1-mediated Apoptotic Pathways in Non-Small Cell Lung Carcinoma Cancer Res., July 1, 2001; 61(14): 5636 - 5643. [Abstract] [Full Text] [PDF]

				J. F Costello and C. Plass Methylation matters J. Med. Genet., May 1, 2001; 38(5): 285 - 303. [Abstract] [Full Text]

				F. Magdinier and A. P. Wolffe Selective association of the methyl-CpG binding protein MBD2 with the silent p14/p16 locus in human neoplasia PNAS, April 12, 2001; (2001) 101617298. [Abstract] [Full Text]

				S. B. Baylin, M. Esteller, M. R. Rountree, K. E. Bachman, K. Schuebel, and J. G. Herman Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer Hum. Mol. Genet., April 1, 2001; 10(7): 687 - 692. [Abstract] [Full Text] [PDF]

				M. Esteller, C. Cordon-Cardo, P. G. Corn, S. J. Meltzer, K. S. Pohar, D. N. Watkins, G. Capella, M. A. Peinado, X. Matias-Guiu, J. Prat, et al. p14ARF Silencing by Promoter Hypermethylation Mediates Abnormal Intracellular Localization of MDM2 Cancer Res., April 1, 2001; 61(7): 2816 - 2821. [Abstract] [Full Text]

				M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman A Gene Hypermethylation Profile of Human Cancer Cancer Res., April 1, 2001; 61(8): 3225 - 3229. [Abstract] [Full Text]

				C. A. Eads, R. V. Lord, K. Wickramasinghe, T. I. Long, S. K. Kurumboor, L. Bernstein, J. H. Peters, S. R. DeMeester, T. R. DeMeester, K. A. Skinner, et al. Epigenetic Patterns in the Progression of Esophageal Adenocarcinoma Cancer Res., April 1, 2001; 61(8): 3410 - 3418. [Abstract] [Full Text]

				M. Esteller, S. Gonzalez, R. A. Risques, E. Marcuello, R. Mangues, J. R. Germa, J. G. Herman, G. Capella, and M. A. Peinado K-ras and p16 Aberrations Confer Poor Prognosis in Human Colorectal Cancer J. Clin. Oncol., January 15, 2001; 19(2): 299 - 304. [Abstract] [Full Text] [PDF]

				S. Zöchbauer-Müller, K. M. Fong, A. K. Virmani, J. Geradts, A. F. Gazdar, and J. D. Minna Aberrant Promoter Methylation of Multiple Genes in Non-Small Cell Lung Cancers Cancer Res., January 1, 2001; 61(1): 249 - 255. [Abstract] [Full Text]

				M. Esteller, A. Sparks, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, S. Gonzalez, G. Tarafa, D. Sidransky, S. J. Meltzer, et al. Analysis of Adenomatous Polyposis Coli Promoter Hypermethylation in Human Cancer Cancer Res., August 1, 2000; 60(16): 4366 - 4371. [Abstract] [Full Text]

				M. Serrano The INK4a/ARF locus in murine tumorigenesis Carcinogenesis, May 1, 2000; 21(5): 865 - 869. [Abstract] [Full Text] [PDF]

				M. Esteller, M. Toyota, M. Sanchez-Cespedes, G. Capella, M. A. Peinado, D. N. Watkins, J.-P. J. Issa, D. Sidransky, S. B. Baylin, and J. G. Herman Inactivation of the DNA Repair Gene O6-Methylguanine-DNA Methyltransferase by Promoter Hypermethylation Is Associated with G to A Mutations in K-ras in Colorectal Tumorigenesis Cancer Res., May 1, 2000; 60(9): 2368 - 2371. [Abstract] [Full Text]

				F. Magdinier and A. P. Wolffe Selective association of the methyl-CpG binding protein MBD2 with the silent p14/p16 locus in human neoplasia PNAS, April 24, 2001; 98(9): 4990 - 4995. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Esteller, M. Articles by Herman, J. G. Search for Related Content PubMed PubMed Citation Articles by Esteller, M. Articles by Herman, J. G.