
[Cancer Research 60, 164-169, January 1, 2000]
© 2000 American Association for Cancer Research
Source of Oncofetal ED-B-containing Fibronectin: Implications of Production by Both Tumor and Endothelial Cells1
Marta Midulla2,
Rakesh Verma2,
Massimo Pignatelli,
Mary A. Ritter,
Nigel S. Courtenay-Luck and
Andrew J. T. George3
Department of Immunology, Division of Medicine [M. M., R. V., M. A. R., N. S. C-L., A. J. T. G.] and Department of Histopathology, Division of Investigative Science [M. P.], Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, United Kingdom; Antisoma plc, West Africa House, Hanger Lane, Ealing, London W5 3QR, United Kingdom [R. V., N. S. C-L.]
 |
ABSTRACT
|
|---|
ED-B fibronectin (FN) is a FN isoform derived from alternative splicing
of the primary transcript of a single gene. Its expression on tumor
stroma and neoformed tumor vasculature and its absence, with few
exceptions, in normal adult tissues imply a prognostic and diagnostic
value for ED-B FN. We investigated the location and source of ED-B FN
because this will be of importance both in understanding its role in
tumor development and in designing strategies to target this molecule.
We have confirmed that ED-B FN is expressed in the majority of breast
and colorectal carcinoma tissue samples, with strong
immunohistochemical staining around the tumor cells and in the tumor
stroma. No staining of tumor neovasculature was seen. ED-B FN is
produced by a range of tumor and endothelial (both primary and
transformed) cell lines, as detected by reverse transcription-PCR, but
is not expressed at the plasma membrane. Strong expression of human
ED-B FN is seen in tumor xenografts. These data indicate that
neoplastic cells can act as the source of ED-B FN in tumors. The lack
of cell surface expression on tumor cell lines has clear implications
for the design of therapeutic strategies which target this molecule.
 |
INTRODUCTION
|
|---|
FN4
is a large adhesive glycoprotein and a normal constituent of
extracellular fluids, extracellular matrices, most basement membranes,
and many cell types. It is implicated in a variety of different
biological phenomena such as cell adhesion, establishment and
maintenance of normal cell morphology, cell migration, differentiation,
transformation, hemostasis, thrombosis, wound healing, oncogenic
transformation, and ontogeny (1
, 2)
.
Alternative splicing of the primary transcript of a single gene located
on human chromosome 2, generates numerous distinct fibronectin
transcripts that account for the individual
and ß chains and for
the plasma and cellular isoforms. Fibronectin polymorphism is due to
alternative splicing of a 50-kb gene, which contains 50 exons, in three
different regions, IIICS, ED-A, and
ED-B of the primary transcript, as well as posttranslational
modifications (3)
. Alternative splicing generates 20
different isoforms that differ in the number of internal repeats
(3, 4, 5, 6, 7, 8, 9, 10)
.
The alternative splicing of fibronectin pre-mRNA is regulated in a
cell-, tissue-, and developmentally specific manner; for example, exon
skipping by hepatocytes yields a fibronectin polypeptide that is
missing an amino acid sequence that is present in cellular but not in
plasma fibronectin. It has been demonstrated that the splicing pattern
of FN mRNA is deregulated in transformed cells and in malignancies
(3
, 11, 12, 13, 14, 15, 16)
.
Different fibronectin isoforms containing IIICS, ED-A, and ED-B repeats
are expressed to a greater degree in tumor tissues and transformed
human cell lines than in their normal counterparts (17)
.
ED-B-containing fibronectin, with very few exceptions (superficial
synovial cells, intima of some vessels and areas of interstitium of
ovary, functional layer of endometrium during the proliferative phase,
and isolated areas of basement membrane of celomic epithelium) is
reported to be absent in normal adult tissues (3)
.
The ED-B domain is encoded by a single exon (complete type III
homology) and is composed of 91 amino acids. Existing data indicate
that ED-B fibronectin is associated with ontogenesis and oncogenesis,
and this suggests a prognostic and diagnostic value of ED-B fibronectin
in tumors. Expression of different isoforms of fibronectin has been
demonstrated in malignant and other disease conditions. It has been
suggested that expression of these isoforms is correlated with
remodeling of tissue during wound healing or embryogenesis. The ED-B
isoform of fibronectin is of particular interest because of its
restricted expression on normal adult tissues and its expression on
tumor stroma and neoformed tumor vasculature. This has led to the
concept that ED-B is associated with angiogenesis (18)
.
However, the source of ED-B FN in tumors is unknown, although it has
been suggested that the tumor cells themselves could produce the
molecule (19)
. The association with angiogenesis might
point to the endothelial cells. Transformed fibroblasts have been shown
to make ED-B FN (16)
, but no other ED-B-expressing cell
line has been identified.
To come to a fuller understanding of the role of ED-B FN in neoplastic
disease, we investigated the location and source of ED-B FN. We used a
variety of tumor- and endothelial-derived cell lines, as well as human
breast and colorectal carcinoma tissue samples. Finally, we used a
human tumor xenograft model to further define possible sources of ED-B
FN in tumors.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines and Tissues.
Human colon adenocarcinoma epithelial cells (HT 29; Ref.
20
), oral epidermoid carcinoma cells (KB; Ref.
21
), and breast carcinoma cells (MCF 7; Ref.
22
) were grown in RPMI 1640 (Life Technologies, Paisley,
United Kingdom) supplemented with 10% heat inactivated FCS
(Globefarm, Surrey, United Kingdom), 100 IU/ml penicillin and 100
µg/ml streptomycin (Life Technologies), 2 mM
L-glutamine (Life Technologies), and 1
mM sodium pyruvate (Life Technologies). HUVECs
(23)
were grown in flasks precoated with 2% bovine
gelatin (Sigma, Dorset, United Kingdom) in M199 (Life Technologies)
supplemented with 20% heat-inactivated FCS, 100 IU/ml penicillin and
100 µg/ml streptomycin, 2 mM L-glutamine, 12
units/ml preservative-free heparin (CP Pharmaceuticals, Wrexham, United
Kingdom), and 100 µg/ml endothelial cell growth supplement (Sigma).
Spontaneously transformed HUVECs (ECV 304; Ref. 24
) and
HUVECs fused with a human lung carcinoma cell line (EA hy 926; Ref.
25
) were grown in the same complete medium as the tumor
cell lines but without sodium pyruvate. All of the cells were incubated
at 37°C in 4.5% CO2. The cells were split 1:4
weekly using 2 ml of sterile trypsin/cell dissociation solution
(Sigma). Ten colorectal and 20 breast carcinomas of mixed histotypes
were obtained from patients undergoing surgery for removal of these
tumors. Tissue samples were snap frozen in liquid nitrogen shortly
after removal and stored at -80°C. To generate a KB tumor xenograft,
KB cells were cultured, and 100 µl of the culture, containing
106 cells/ml, were injected s.c. into the flank
region of "nu/nu " (nude) 8- to 12-week-old
female mice. Tumors were allowed to grow for 45 weeks. They were then
excised and snap frozen in liquid nitrogen.
Immunohistochemistry.
Indirect immunoperoxidase staining of either cryostat tissue sections
(6 µm) or cytospins was performed. The cytospins were prepared using
a Cytospin 2 (Shandon, Cheshire, United Kingdom) at 1400 rpm for 4 min.
The slides were dried at room temperature. Tissues were fixed in
acetone for 10 min, whereas cytospins were fixed in acetone:methanol
(1:1, v/v) for 1 min. Tissue sections and cells were incubated with the
primary antibody for 1 h at room temperature. The optimal
concentrations of all antibodies used were assessed by titration. BC-1
(kindly provided by Dr. L. Zardi; Ref. 26
) is a mouse IgG1
monoclonal antibody, and was used to detect ED-B FN at a concentration
of 24 µg/ml The rabbit antihuman FN (DAKO, Glostrup, Denmark)
antibody was also used at 24 µg/ml. After being rinsed in PBS, the
slides were incubated with the secondary antibodies.
Peroxidase-conjugated swine antirabbit immunoglobulins (DAKO) and
rabbit antimouse immunoglobulins (DAKO) were used at concentrations of
26 and 13 µg/ml, respectively. The slides were counter-stained in
hematoxylin (Sigma) for 30 s, rinsed in slowly running tap water
for 34 min, and mounted in water-based mounting agent (Kaisers).
RT-PCR.
mRNA extraction and cDNA synthesis were as follows. mRNA was extracted
from cell pellets of 1 x 106 to
1 x 107 cells, using a Quick Prep
Micro mRNA Purification kit (Pharmacia P-L Biochemicals Inc., Herts,
United Kingdom), and stored at -80°C. mRNA was extracted from
tissues, following a similar procedure. Tissue samples (up to 0.1 g) were homogenized with 0.4 ml of extraction buffer on dry ice, using
a diethyl pyrocarbonate-treated (Sigma) pestle and mortar of 2
cm3 capacity. The RNA was heated for 10 min at
65°C and then chilled on ice. The First-Strand cDNA Synthesis kit
(Pharmacia P-L Biochemicals) was used to prepare cDNA. The mixture was
incubated for 90 min at 37°C.
Primers.
A pair of primers (ED-B 5'/ED-B 3') were designed and bought from Life
Technologies to amplify the ED-B domain. ß-actin was used
as positive control, and appropriate primers were bought from Cruachem
(Glasgow, United Kingdom).
The sequences of the primers were as follows:
ED-B 5': CCATCATCCCAGAGGTGCCCCAACT
ED-B 3': AGGAGGAACAGCCGTTTGTTGTGTC
ß actin 5': GTGGGGCGCCCCAGGCACCA
ß actin 3': CTCCTTAATGTCACGCACGATTTC
ED-B 5' was designed to contain the last 11 nucleotides of repeat 7 and
the first 14 nucleotides of the ED-B exon, whereas ED-B 3'
contained the last 13 nucleotides of ED-B and the first 12
of repeat 8.
Reactions.
Fifteen µl of cDNA were diluted to a final volume of 50 µl, which
contained 20 pmol of each primer set. "Hot-start" PCR was
performed, and 2.5 units of Taq polymerase (Life Technologies) were
added in the PCR mixture as soon as tube temperature reached 94°C.
Amplification was performed for 35 cycles (94°C for 1 min, 65°C for
1 min, 72°C for 2 min) using an Omnigene thermal cycler (Hybaid
Limited, Middlesex, United Kingdom). PCR products were run on 1.5%
agarose (Life Technologies) gel together with either a 1-kb or 1-kb
plus molecular weight marker (Life Technologies).
For sequencing, the amplified DNA of several PCRs was precipitated
using polyethylene glycol solution (26% polyethylene glycol
8000, 6.5 mM MgCl2, 0.6 M
sodium acetate, pH 67). Sequencing was performed in a 373 DNA
sequencer STRETCH (Applied Biosystems, Cheshire, United Kingdom).
 |
RESULTS
|
|---|
Distribution of ED-B FN Isoform in Malignant Tissue and Tumor Cell
Lines.
To study the distribution of ED-B FN, immunohistochemical analysis was
performed on cytospins of the breast carcinoma cell line (MCF 7) and
the colon adenocarcinoma cell line (HT 29). The BC-1 monoclonal
antibody, which recognizes human ED-B-containing FN molecules, was
used. ED-B-containing FN was detected in MCF 7 cytospins but not in HT
29 (Fig. 1)
. FACS analysis was performed for these cell lines, but no ED-B
was detected on cell surfaces (data not shown). Immunohistochemical
analysis was also performed for tissue samples of both colorectal and
breast tumors of mixed histotypes. Six of the 10 colorectal tumors
(mixed histotypes) were positive for ED-B FN. The normal colon did not
show any staining. Fig. 2
shows a representative colorectal adenocarcinoma. ED-B-containing FN
was located in the epithelial cells of the tubular glands lining the
intestinal mucosa of the colorectal adenocarcinoma (Fig. 2A)
. In contrast, FN lacking the ED-B domain was expressed
mostly in the basement membrane and in the stroma surrounding the
mucosa but was absent from the epithelial cells of the glands (Fig. 2B)
. No staining was seen in the negative control, with the
exception of neutrophils containing endogenous peroxidase (Fig. 2C)
.

View larger version (136K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. HT 29 and MCF 7 cytospins stained for ED-B FN.
Immunoperoxidase staining was performed in HT 29 and MCF 7 cytospins to
detect ED-B FN. A, MCF 7 cells stained with BC-1 for
ED-B FN (x200). ED-B FN is localized in the cell cytoplasm.
B, HT 29 cells stained with BC-1 (x200). ED-B FN is
absent from the cytoplasm of HT 29.
|
|

View larger version (85K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Immunohistochemical analysis of colorectal adenocarcinoma.
Indirect immunoperoxidase staining was performed on cryostat sections
of colorectal adenocarcinoma to study the expression of ED-B FN by use
of the monoclonal antibody BC-1. A, tubular glands
stained with BC-1 in colorectal adenocarcinoma (x200). Epithelial
cells are strongly positive for ED-B FN, whereas the connective tissue
does not react with BC-1. B, colorectal adenocarcinoma
stained with an antibody against FN lacking ED-B domain (x200). FN
lacking ED-B domain is localized in the basement membrane and in the
stroma surrounding the mucosa but is absent from the epithelial cells
of the gland. C, negative control (primary antibody
omitted), which shows that the area of the tubular gland in colorectal
adenocarcinoma is not labeled (x200). Some endogenous peroxidase is
seen in neutrophils.
|
|
Twenty breast tumors of mixed histotypes and grades were tested by
immunohistochemistry. ED-B FN was expressed in 19 of 20, representing
95% of the samples. The majority of the tissue sections again showed a
predominately intracellular pattern of staining. In addition, in some
cases, expression was also seen in the tumor stroma. There was no
obvious association between staining intensity/pattern and tumor
histotype in this small sample size. We did not observe any staining of
blood vessels in any sample. The distribution of ED-B FN in a poorly
differentiated infiltrating ductal grade 3 breast carcinoma is shown in
Fig. 3A
.

View larger version (134K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Immunohistochemical analysis of ductal grade 3 breast
carcinoma. Indirect immunohistochemistry was used to detect the
presence of ED-B FN in cryostat sections (6 µm thickness) of ductal
breast carcinoma. A, ductal grade 3 breast carcinoma
stained with BC-1 (x200). ED-B FN is localized mainly in and around
the tumor cells. B, negative control (primary antibody
omitted) of ductal grade 3 breast carcinoma (x200).
|
|
RT-PCR Detection of ED-B FN mRNA Isoform in Human
Colorectal and Breast Tumor Cell Lines and Tissues.
The presence of ED-B FN mRNA was studied in human tumor
tissues and cell lines by means of RT-PCR using oligonucleotide
primers. These were designed to contain sequences from both the
ED-B FN exon and the appropriate adjacent exons, thus
assuring that genomic DNA would not be amplified. This was confirmed in
experiments in which reverse transcriptase was omitted (data not
shown). Furthermore, we performed experiments with primers based on
exons 7 and 8 with similar results (data not shown), although these
were complicated by amplification of the ED-B lacking FN
sequences. The
300 bp ED-B sequence was detected in both
HT 29 and MCF 7 cells, as shown in Fig. 4A
, Lanes 2 and 3, respectively. The
presence of mRNA encoding ED-B FN in HT 29 cells coupled with the
absence of ED-B staining in these cells indicates either that the
message was not translated or that the product was secreted too rapidly
to allow detection in the cytoplasm. The ED-B FN mRNA
isoform was also detected in both human breast and colorectal
adenocarcinoma biopsies (Fig. 4B
, Lanes 2 and
3, respectively), but no ED-B FN mRNA was found
in normal colon or lymph nodes (data not shown). We were unable to
obtain any samples of normal breast. The identity of the amplification
products was confirmed by sequencing of the PCR products. The resulting
sequence matches the published sequence for ED-B FN
(9)
.

View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. RT-PCR detection of ED-B FN mRNA isoform.
Primers ED-B 5' and ED-B 3' were used to amplify ED-B
domain, and the PCR products were run on a 1.5% agarose gel.
A, Lane 2, HT 29 cells; Lane
3, MCF 7 cells; Lane 4, ß-actin positive
control of MCF 7; Lane 5, negative control.
B, Lane 2, breast adenocarcinoma;
Lane 3, colorectal adenocarcinoma amplified with ED-B 5'
and 3' primers; Lane 4, ß-actin positive control of
breast adenocarcinoma; Lane 5, negative control.
C, Lanes 24, product ( 300 bp) from
HUVEC, EA hy 926, and ECV 304 cell lines, respectively. Lane
5, positive control of HUVEC; Lane 6, negative
control. Lane 1 in all panels, 1-kb DNA ladder. Positive
controls were performed for all cell lines and samples, but only one
positive is shown in the gels.
|
|
Expression of ED-B FN mRNA Isoform in Normal and
Transformed Endothelial Cell Lines.
The RT-PCR analysis of the ED-B FN mRNA isoform was extended
to primary and transformed endothelial cell lines. HUVECs from primary
cell culture (Fig. 4C
, Lane 2), EA hy 926, a
hybridoma made from HUVECs and a human lung carcinoma cell line (Fig. 4C
, Lane 3), and ECV 304, a spontaneously
transformed HUVEC cell line (Fig. 4C
, Lane 4),
were shown to express the ED-B FN mRNA isoform by RT-PCR.
Study of ED-B FN in Human Tumor Xenografts.
To study the production of ED-B FN in vivo, we used a tumor
xenograft of the KB cell line (human oral epidermoid carcinoma).
Immunohistochemistry of KB cytospins and tumor xenograft tissue
sections as well as RT-PCR in both cells and tissue were performed.
Fig. 5A
shows KB cytospins stained with BC-1, with ED-B localized
in the cytoplasm and with some faint staining close to the plasma
membrane. FACS analysis showed no surface expression of ED-B FN (not
shown). In the KB xenograft, there was intense staining around tumor
cells and in the tumor stroma (Fig. 5B)
. BC-1 antibody
detects human but not murine ED-B-containing FN (27)
.
Therefore, detection of ED-B FN in the tumor xenograft indicates that
it was produced by tumor cells. The mRNA encoding ED-B-containing FN
was present in both KB cells and the xenograft as detected by RT-PCR
(Fig. 5C
, Lanes 2 and 3).

View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Study of ED-B FN in tumor xenografts. KB cells and KB
tumor xenograft were tested by means of RT-PCR and immunohistochemistry
for the presence of ED-B FN. A, KB cytospins stained
with BC-1 (x1000). ED-B FN is localized in the cytoplasm and near the
cytoplasmic membrane. B, KB tumor xenograft stained with
BC-1 (x200). Intense staining can be seen in tumor stroma and around
xenograft cells, which is an indication that tumor cells contribute in
the accumulation of ED-B FN in the stroma. C, RT-PCR of
KB tumor cells and KB tumor xenograft showing the 300-bp band that
corresponds to ED-B-containing FN. The PCR products were
run on a 1.5% agarose gel. Lane 1, 1-kb plus DNA
ladder; Lane 2, KB tumor cells; Lane 3,
KB tumor xenograft; Lane 4, negative control.
|
|
 |
DISCUSSION
|
|---|
The aim of this study was to investigate the source and location
of ED-B FN expressed in tumors because this has clear implications for
both the development of immunotherapeutic approaches targeting ED-B FN
and the development of our understanding of the role of this molecule
in tumorigenesis.
The source of ED-B FN in tumors is unknown, although previous workers
have speculated that it might be produced by the tumor cells themselves
(19
, 28)
. Transformed fibroblasts have been shown to
express ED-B FN (16)
. We analyzed tumor cell lines derived
from colorectal (HT 29), breast (MCF 7), and head and neck (KB)
carcinomas, and human primary endothelial cells (HUVEC) and endothelial
cell lines (EA hy 926 and ECV 304). All of these cells expressed ED-B
FN (as determined by RT-PCR), indicating that both tumor and
endothelial cells could be the source of ED-B FN in tumors.
To investigate the contribution of neoplastic cells to ED-B FN in
tumors, we stained human KB tumor xenografts grown in mice with the
BC-1 antibody (which does not recognize murine ED-B FN). Strong
staining both around the tumor cells and in the stroma indicates that
the tumor cells can act as the source of ED-B FN in tumors, although it
does not rule out a possible contribution by endothelial cells.
We have further investigated the cellular location of ED-B FN
expression. Staining of cytospins of the cell lines indicated that in
some of them ED-B FN could be detected in the cytoplasm. However, no
staining was seen on the plasma membrane (as determined by FACS
analysis). This indicates that ED-B FN is not expressed on the cell
surface but is secreted from the cell. The failure to detect ED-B FN in
the cytoplasm of some of the cell lines despite the clear presence of
mRNA was presumably due to the rapid secretion of the molecule.
This study was complemented by immunohistochemical analysis of both
breast and colorectal carcinomas. The BC-1 antibody stained 95% of the
samples with breast carcinoma, which represented a variety of different
histotypes. We observed submembranous and membranous staining of tumor
cells. Kaczmarek et al. (17)
, in a larger study
of invasive ductal cell carcinoma, also observed staining of the blood
vessels, as has also been seen for glioblastoma multiforme, high-grade
astrocytoma, and benign tumors such as ependymoma and breast
intraductal papilloma (18)
. Our failure to observe similar
staining of the vasculature may be a result of the many different tumor
histotypes and small sample size we analyzed. In colorectal carcinoma
samples, we saw staining associated with both the tumor cells and the
tumor stroma in 60% of samples, similar to that reported previously
(19)
. We observed no staining of the vasculature;
expression of ED-B FN by the vessels was not commented on by the
authors of the previous study (19)
.
These data, when taken together, suggest that tumor cells can act as a
major source of ED-B FN in tumors. The cells do not express ED-B FN on
their surface, but secrete it. Once secreted, it can contribute to the
ED-B FN seen in the tumor stroma. In tumor samples, ED-B FN can be seen
closely associated with the tumor cells. This may reflect secreted ED-B
FN that forms part of the stroma immediately surrounding the tumor
cells. This has implications for the use of ED-B FN in tumor therapy or
in vivo diagnosis. Early reports showed ED-B FN expression
in the lumen of blood vessels (13
, 18)
, which would
therefore be highly accessible to antibody-mediated therapy or imaging.
Our data and those of others (17)
indicate that this is
not the case for all types of tumors. This reduces the attractiveness
of using IgG antibodies because it will be necessary for these large
molecules to penetrate the vasculature. To this end, we have
constructed a single-chain Fv version of the antibody
(29)
, which should show better penetration of solid tissue
for tumor imaging and therapy.
Clearly, the lack of surface expression of ED-B FN influences the
possible forms of therapy. Thus, immunotoxin therapy, which requires
direct binding of the therapeutic agent to the tumor cell, would not be
feasible. However, either radioimmunotherapy or antibody-directed
enzyme prodrug therapy might be effective with antibodies
targeted to stroma rather than the tumor cells.
The lack of staining of endothelial cells in blood vessels is perhaps
surprising in light of the detection of ED-B mRNA in HUVEC
cells. There are several possible explanations for this. First, HUVEC
cells growing in vitro will not represent the
tumor-associated endothelium where division will be less;
unfortunately, these are not good in vitro models for this
situation. Second, the relative rates of production of ED-B FN are not
known. Finally, ED-B FN is secreted and may then be laid down in
extracellular matrix some distance from the cells producing the
molecule.
To date, the role of the ED-B repeat in the fibronectin molecule has
been unknown. However, there is evidence to suggest that it might play
a role in, or affect, cell adhesion and spreading (30
, 31)
. Both cell adhesion and cell spreading are important
phenomena in embryogenesis, wound healing, angiogenesis, tumor
establishment, and metastasis. No ligand has yet been identified for
the ED-B domain. It has been suggested that insertion of ED-B into
fibronectin causes conformational changes in the molecule
(26)
, improving access to the integrin binding sites in
the 9th and 10th type III
repeats. The finding that both tumor and endothelial cells express ED-B
FN is clearly important for the investigations of the role of this
molecule in tumor growth, establishment of metastasis, and
angiogenesis.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Dr. Luciano Zardi (Laboratory of Cell Biology, Genoa,
Italy) for the generous gift of BC-1 (the monoclonal against ED-B FN).
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This study was supported by Antisoma plc,
London, United Kingdom. 
2 Authors M. M. and R. V. contributed
equally toward the completion of this work. 
3 To whom requests for reprints should be
addressed, at Department of Immunology, Division of Medicine, Imperial
College School of Medicine, Hammersmith Hospital, London, W12 0NN,
United Kingdom. 
4 The abbreviations used are: FN, fibronectin;
HUVEC, human umbilical vein endothelial cell; RT-PCR, reverse
transcription-PCR; FACS, fluorescence-activated cell sorting. 
Received 6/15/99.
Accepted 11/ 1/99.
 |
REFERENCES
|
|---|
-
Alitalo K., Vaheri A. Pericellular matrix in malignant transformation. Adv. Cancer Res., 37: 111-150, 1982.[Medline]
-
Hynes R. O., Yamada K. M. Fibronectins: multifunctional modular glycoproteins. J. Cell Biol., 95: 369-377, 1982.[Free Full Text]
-
Zardi L., Carnemolla B., Siri A., Petersen T. E., Paolella G., Sebastio G., Baralle F. E. Transformed human cells produce a new fibronectin isoform by preferential alternative splicing of a previously unobserved exon. EMBO J., 6: 2337-2342, 1987.[Medline]
-
Schwarzbauer J. E., Tamkun J. W., Lemischka I. R., Hynes R. O. Three different fibronectin mRNAs arise by alternative splicing within the coding region. Cell, 35: 421-431, 1983.[Medline]
-
Kornblihtt A. R., Vibe-Pedersen K., Baralle F. E. Human fibronectin: molecular cloning evidence for two mRNA species differing by an internal segment coding for a structural domain. EMBO J., 3: 221-226, 1984.[Medline]
-
Kornblihtt A. R., Vibe-Pedersen K., Baralle F. E. Human fibronectin: cell specific alternative mRNA splicing generates polypeptide chains differing in the number of internal repeats. Nucleic Acids Res., 12: 5853-5868, 1984.[Abstract/Free Full Text]
-
Tamkun J. W., Schwarzbauer J. E., Hynes R. O. A single rat fibronectin gene generates three different mRNAs by alternative splicing of a complex exon. Proc. Natl. Acad. Sci. USA, 81: 5140-5144, 1984.[Abstract/Free Full Text]
-
Kornblihtt A. R., Umezawa K., Vibe-Pedersen K., Baralle F. E. Primary structure of human fibronectin: differential splicing may generate at least 10 polypeptides from a single gene. EMBO J., 4: 1755-1759, 1985.[Medline]
-
Gutman A., Kornblihtt A. R. Identification of a third region of cell-specific alternative splicing in human fibronectin mRNA. Proc. Natl. Acad. Sci. USA, 84: 7179-7182, 1987.[Abstract/Free Full Text]
-
Schwarzbauer J. E., Patel R. S., Fonda D., Hynes R. O. Multiple sites of alternative splicing of the rat fibronectin gene transcript. EMBO J., 6: 2573-2580, 1987.[Medline]
-
Castellani P., Siri A., Rosellini C., Infusini E., Borsi L., Zardi L. Transformed human cells release different fibronectin variants than do normal cells. J. Cell Biol., 103: 1671-1677, 1986.[Abstract/Free Full Text]
-
Borsi L., Carnemolla B., Castellani P., Rosellini C., Vecchio D., Allemanni G., Chang S. E., Taylor-Papadimitriou J., Pande H., Zardi L. Monoclonal antibodies in the analysis of fibronectin isoforms generated by alternative splicing of mRNA precursors in normal and transformed human cells. J. Cell Biol., 104: 595-600, 1987.[Abstract/Free Full Text]
-
Carnemolla B., Balza E., Siri A., Zardi L., Nicotra M. R., Bigotti A., Natali P. G. A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors. J. Cell Biol., 108: 1139-1148, 1989.[Abstract/Free Full Text]
-
Oyama F., Hirohashi S., Shimosato Y., Titani K., Sekiguchi K. Deregulation of alternative splicing of fibronectin pre-mRNA in malignant human liver tumors. J. Biol. Chem., 264: 10331-10334, 1989.[Abstract/Free Full Text]
-
Oyama F., Hirohashi S., Shimosato Y., Titani K., Sekiguchi K. Oncodevelopmental regulation of the alternative splicing of fibronectin pre-messenger RNA in human lung tissues. Cancer Res., 50: 1075-1078, 1990.[Abstract/Free Full Text]
-
Borsi L., Balza E., Allemanni G., Zardi L. Differential expression of the fibronectin isoform containing the ED-B oncofetal domain in normal human fibroblast cell lines originating from different tissues. Exp. Cell. Res., 199: 98-105, 1992.[Medline]
-
Kaczmarek J., Castellani P., Nicolo G., Spina B., Allemanni G., Zardi L. Distribution of oncofetal fibronectin isoforms in normal, hyperplastic and neoplastic human breast tissues. Int. J. Cancer, 58: 11-16, 1994.
-
Castellani P., Viale G., Dorcaratto A., Nicolo G., Kaczmarek J., Querze G., Zardi L. The fibronectin isoform containing the ED-B oncofetal domain: a marker of angiogenesis. Int. J. Cancer, 59: 612-618, 1994.[Medline]
-
Pujuguet P., Hammann A., Moutet M., Samuel L., Martin F., Martin M. Expression of fibronectin ED-A+ and ED-B+ isoforms by human and experimental colorectal cancer. Am. J. Pathol., 148: 579-592, 1996.[Abstract]
-
Fogh J., Trempe G. New human tumor cell lines Fogh J. eds. . Human Tumor Cell Lines in Vitro, : 115-159, Plenum Press New York 1975.
-
Eagle H. Propagation in a fluid medium of a human epidermoid carcinoma, strain KB. Proc. Soc. Exp. Biol. Med., 89: 362-364, 1955.
-
Brooks S. C., Locke E. R., Soule H. D. Estrogen receptor in a human cell line (MCF-7) from breast carcinoma. J. Biol. Chem., 248: 6251-6253, 1973.[Abstract/Free Full Text]
-
Jaffe E. A., Nachman R. L., Becker C. G., Minick C. R. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J. Clin. Investig., 52: 2745-2756, 1973.
-
Takahasi K., Sawasaki Y., Hata J., Mukai K., Goto T. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev. Biol., 26: 265-274, 1990.[Medline]
-
Edgell C-J. S., McDonald C. C., Graham J. B. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc. Natl. Acad. Sci. USA, 80: 3734-3737, 1983.[Abstract/Free Full Text]
-
Carnemolla B., Leprini A., Allemanni G., Saginati M., Zardi L. The inclusion of the type III repeat ED-B in the fibronectin molecule generates conformational modifications that unmask a cryptic sequence. J. Biol. Chem., 267: 24689-24692, 1992.[Abstract/Free Full Text]
-
Carnemolla B., Neri D., Castellani P., Leprini A., Neri G., Pini A., Winter G., Zardi L. Phage antibodies with pan-species recognition of the oncofetal angiogenesis marker fibronectin ED-B domain. Int. J. Cancer, 68: 397-405, 1996.[Medline]
-
Mariani G., Lasku A., Pau A., Villa G., Motta C., Calgano G., Taddei G. Z., Castellani P., Syrigos K., Dorcaratto A., Epenetos A. A., Zardi L., Viale G. A. A pilot pharmacokinetic and immunoscintigraphic study with the technetium-99m-labeled monoclonal antibody BC-1 directed against oncofetal fibronectin in patients with brain tumors. Cancer (Phila.), 80(Suppl.12): 2484-2489, 1997.[Medline]
-
Verma R., George A. J. T., Courtenay-Luck N. S. Generation of a single-chain Fv (sFv) against an oncofetal antigen associated with tumorigenesis and angiogenesis. J. Int. Soc. Tumor Targeting, 1: 9-21, 1999.
-
Chen W., Culp L. A. Adhesion mediated by fibronectins alternatively spliced EDb (EIIIB) and its neighboring type III repeats. Exp. Cell Res., 223: 9-19, 1996.[Medline]
-
Hashimoto-Uoshima M., Yan Y. Z., Schneider G., Aukhil I. The alternatively spliced domains EIIIB and EIIIA of human fibronectin affect cell adhesion and spreading. J. Cell Sci., 110: 2271-2280, 1997.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
J. Wels, R. N. Kaplan, S. Rafii, and D. Lyden
Migratory neighbors and distant invaders: tumor-associated niche cells
Genes & Dev.,
March 1, 2008;
22(5):
559 - 574.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sandal, K. Valyi-Nagy, V. A. Spencer, R. Folberg, M. J. Bissell, and A. J. Maniotis
Epigenetic Reversion of Breast Carcinoma Phenotype Is Accompanied by Changes in DNA Sequestration as Measured by AluI Restriction Enzyme
Am. J. Pathol.,
May 1, 2007;
170(5):
1739 - 1749.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. A. Khan, M. Cukiernik, J. R. Gonder, and S. Chakrabarti
Oncofetal Fibronectin in Diabetic Retinopathy
Invest. Ophthalmol. Vis. Sci.,
January 1, 2004;
45(1):
287 - 295.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Schor, I. R. Ellis, S. J. Jones, R. Baillie, K. Seneviratne, J. Clausen, K. Motegi, B. Vojtesek, K. Kankova, E. Furrie, et al.
Migration-Stimulating Factor: A Genetically Truncated Onco-Fetal Fibronectin Isoform Expressed by Carcinoma and Tumor-Associated Stromal Cells
Cancer Res.,
December 15, 2003;
63(24):
8827 - 8836.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Fukuda, N. Yoshida, Y. Kataoka, R.-i. Manabe, Y. Mizuno-Horikawa, M. Sato, K. Kuriyama, N. Yasui, and K. Sekiguchi
Mice Lacking the EDB Segment of Fibronectin Develop Normally but Exhibit Reduced Cell Growth and Fibronectin Matrix Assembly in Vitro
Cancer Res.,
October 1, 2002;
62(19):
5603 - 5610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Gillan, D. Matei, D. A. Fishman, C. S. Gerbin, B. Y. Karlan, and D. D. Chang
Periostin Secreted by Epithelial Ovarian Carcinoma Is a Ligand for {alpha}V{beta}3 and {alpha}V{beta}5 Integrins and Promotes Cell Motility
Cancer Res.,
September 15, 2002;
62(18):
5358 - 5364.
[Abstract]
[Full Text]
[PDF]
|
 |
|