Cancer Research SABCS  EMT and Cancer Progression and Treatment
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Midulla, M.
Right arrow Articles by George, A. J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Midulla, M.
Right arrow Articles by George, A. J. T.
[Cancer Research 60, 164-169, January 1, 2000]
© 2000 American Association for Cancer Research


Tumor Biology

Source of Oncofetal ED-B-containing Fibronectin: Implications of Production by Both Tumor and Endothelial Cells1

Marta Midulla2, Rakesh Verma2, Massimo Pignatelli, Mary A. Ritter, Nigel S. Courtenay-Luck and Andrew J. T. George3

Department of Immunology, Division of Medicine [M. M., R. V., M. A. R., N. S. C-L., A. J. T. G.] and Department of Histopathology, Division of Investigative Science [M. P.], Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, United Kingdom; Antisoma plc, West Africa House, Hanger Lane, Ealing, London W5 3QR, United Kingdom [R. V., N. S. C-L.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ED-B fibronectin (FN) is a FN isoform derived from alternative splicing of the primary transcript of a single gene. Its expression on tumor stroma and neoformed tumor vasculature and its absence, with few exceptions, in normal adult tissues imply a prognostic and diagnostic value for ED-B FN. We investigated the location and source of ED-B FN because this will be of importance both in understanding its role in tumor development and in designing strategies to target this molecule. We have confirmed that ED-B FN is expressed in the majority of breast and colorectal carcinoma tissue samples, with strong immunohistochemical staining around the tumor cells and in the tumor stroma. No staining of tumor neovasculature was seen. ED-B FN is produced by a range of tumor and endothelial (both primary and transformed) cell lines, as detected by reverse transcription-PCR, but is not expressed at the plasma membrane. Strong expression of human ED-B FN is seen in tumor xenografts. These data indicate that neoplastic cells can act as the source of ED-B FN in tumors. The lack of cell surface expression on tumor cell lines has clear implications for the design of therapeutic strategies which target this molecule.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
FN4 is a large adhesive glycoprotein and a normal constituent of extracellular fluids, extracellular matrices, most basement membranes, and many cell types. It is implicated in a variety of different biological phenomena such as cell adhesion, establishment and maintenance of normal cell morphology, cell migration, differentiation, transformation, hemostasis, thrombosis, wound healing, oncogenic transformation, and ontogeny (1 , 2) .

Alternative splicing of the primary transcript of a single gene located on human chromosome 2, generates numerous distinct fibronectin transcripts that account for the individual {alpha} and ß chains and for the plasma and cellular isoforms. Fibronectin polymorphism is due to alternative splicing of a 50-kb gene, which contains 50 exons, in three different regions, IIICS, ED-A, and ED-B of the primary transcript, as well as posttranslational modifications (3) . Alternative splicing generates 20 different isoforms that differ in the number of internal repeats (3, 4, 5, 6, 7, 8, 9, 10) .

The alternative splicing of fibronectin pre-mRNA is regulated in a cell-, tissue-, and developmentally specific manner; for example, exon skipping by hepatocytes yields a fibronectin polypeptide that is missing an amino acid sequence that is present in cellular but not in plasma fibronectin. It has been demonstrated that the splicing pattern of FN mRNA is deregulated in transformed cells and in malignancies (3 , 11, 12, 13, 14, 15, 16) .

Different fibronectin isoforms containing IIICS, ED-A, and ED-B repeats are expressed to a greater degree in tumor tissues and transformed human cell lines than in their normal counterparts (17) . ED-B-containing fibronectin, with very few exceptions (superficial synovial cells, intima of some vessels and areas of interstitium of ovary, functional layer of endometrium during the proliferative phase, and isolated areas of basement membrane of celomic epithelium) is reported to be absent in normal adult tissues (3) .

The ED-B domain is encoded by a single exon (complete type III homology) and is composed of 91 amino acids. Existing data indicate that ED-B fibronectin is associated with ontogenesis and oncogenesis, and this suggests a prognostic and diagnostic value of ED-B fibronectin in tumors. Expression of different isoforms of fibronectin has been demonstrated in malignant and other disease conditions. It has been suggested that expression of these isoforms is correlated with remodeling of tissue during wound healing or embryogenesis. The ED-B isoform of fibronectin is of particular interest because of its restricted expression on normal adult tissues and its expression on tumor stroma and neoformed tumor vasculature. This has led to the concept that ED-B is associated with angiogenesis (18) . However, the source of ED-B FN in tumors is unknown, although it has been suggested that the tumor cells themselves could produce the molecule (19) . The association with angiogenesis might point to the endothelial cells. Transformed fibroblasts have been shown to make ED-B FN (16) , but no other ED-B-expressing cell line has been identified.

To come to a fuller understanding of the role of ED-B FN in neoplastic disease, we investigated the location and source of ED-B FN. We used a variety of tumor- and endothelial-derived cell lines, as well as human breast and colorectal carcinoma tissue samples. Finally, we used a human tumor xenograft model to further define possible sources of ED-B FN in tumors.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines and Tissues.
Human colon adenocarcinoma epithelial cells (HT 29; Ref. 20 ), oral epidermoid carcinoma cells (KB; Ref. 21 ), and breast carcinoma cells (MCF 7; Ref. 22 ) were grown in RPMI 1640 (Life Technologies, Paisley, United Kingdom) supplemented with 10% heat inactivated FCS (Globefarm, Surrey, United Kingdom), 100 IU/ml penicillin and 100 µg/ml streptomycin (Life Technologies), 2 mM L-glutamine (Life Technologies), and 1 mM sodium pyruvate (Life Technologies). HUVECs (23) were grown in flasks precoated with 2% bovine gelatin (Sigma, Dorset, United Kingdom) in M199 (Life Technologies) supplemented with 20% heat-inactivated FCS, 100 IU/ml penicillin and 100 µg/ml streptomycin, 2 mM L-glutamine, 12 units/ml preservative-free heparin (CP Pharmaceuticals, Wrexham, United Kingdom), and 100 µg/ml endothelial cell growth supplement (Sigma). Spontaneously transformed HUVECs (ECV 304; Ref. 24 ) and HUVECs fused with a human lung carcinoma cell line (EA hy 926; Ref. 25 ) were grown in the same complete medium as the tumor cell lines but without sodium pyruvate. All of the cells were incubated at 37°C in 4.5% CO2. The cells were split 1:4 weekly using 2 ml of sterile trypsin/cell dissociation solution (Sigma). Ten colorectal and 20 breast carcinomas of mixed histotypes were obtained from patients undergoing surgery for removal of these tumors. Tissue samples were snap frozen in liquid nitrogen shortly after removal and stored at -80°C. To generate a KB tumor xenograft, KB cells were cultured, and 100 µl of the culture, containing 106 cells/ml, were injected s.c. into the flank region of "nu/nu " (nude) 8- to 12-week-old female mice. Tumors were allowed to grow for 4–5 weeks. They were then excised and snap frozen in liquid nitrogen.

Immunohistochemistry.
Indirect immunoperoxidase staining of either cryostat tissue sections (6 µm) or cytospins was performed. The cytospins were prepared using a Cytospin 2 (Shandon, Cheshire, United Kingdom) at 1400 rpm for 4 min. The slides were dried at room temperature. Tissues were fixed in acetone for 10 min, whereas cytospins were fixed in acetone:methanol (1:1, v/v) for 1 min. Tissue sections and cells were incubated with the primary antibody for 1 h at room temperature. The optimal concentrations of all antibodies used were assessed by titration. BC-1 (kindly provided by Dr. L. Zardi; Ref. 26 ) is a mouse IgG1 monoclonal antibody, and was used to detect ED-B FN at a concentration of 24 µg/ml The rabbit antihuman FN (DAKO, Glostrup, Denmark) antibody was also used at 24 µg/ml. After being rinsed in PBS, the slides were incubated with the secondary antibodies. Peroxidase-conjugated swine antirabbit immunoglobulins (DAKO) and rabbit antimouse immunoglobulins (DAKO) were used at concentrations of 26 and 13 µg/ml, respectively. The slides were counter-stained in hematoxylin (Sigma) for 30 s, rinsed in slowly running tap water for 3–4 min, and mounted in water-based mounting agent (Kaiser’s).

RT-PCR.
mRNA extraction and cDNA synthesis were as follows. mRNA was extracted from cell pellets of 1 x 106 to 1 x 107 cells, using a Quick Prep Micro mRNA Purification kit (Pharmacia P-L Biochemicals Inc., Herts, United Kingdom), and stored at -80°C. mRNA was extracted from tissues, following a similar procedure. Tissue samples (up to 0.1 g) were homogenized with 0.4 ml of extraction buffer on dry ice, using a diethyl pyrocarbonate-treated (Sigma) pestle and mortar of 2 cm3 capacity. The RNA was heated for 10 min at 65°C and then chilled on ice. The First-Strand cDNA Synthesis kit (Pharmacia P-L Biochemicals) was used to prepare cDNA. The mixture was incubated for 90 min at 37°C.

Primers.
A pair of primers (ED-B 5'/ED-B 3') were designed and bought from Life Technologies to amplify the ED-B domain. ß-actin was used as positive control, and appropriate primers were bought from Cruachem (Glasgow, United Kingdom).

The sequences of the primers were as follows:

ED-B 5': CCATCATCCCAGAGGTGCCCCAACT

ED-B 3': AGGAGGAACAGCCGTTTGTTGTGTC

ß actin 5': GTGGGGCGCCCCAGGCACCA

ß actin 3': CTCCTTAATGTCACGCACGATTTC

ED-B 5' was designed to contain the last 11 nucleotides of repeat 7 and the first 14 nucleotides of the ED-B exon, whereas ED-B 3' contained the last 13 nucleotides of ED-B and the first 12 of repeat 8.

Reactions.
Fifteen µl of cDNA were diluted to a final volume of 50 µl, which contained 20 pmol of each primer set. "Hot-start" PCR was performed, and 2.5 units of Taq polymerase (Life Technologies) were added in the PCR mixture as soon as tube temperature reached 94°C. Amplification was performed for 35 cycles (94°C for 1 min, 65°C for 1 min, 72°C for 2 min) using an Omnigene thermal cycler (Hybaid Limited, Middlesex, United Kingdom). PCR products were run on 1.5% agarose (Life Technologies) gel together with either a 1-kb or 1-kb plus molecular weight marker (Life Technologies).

For sequencing, the amplified DNA of several PCRs was precipitated using polyethylene glycol solution (26% polyethylene glycol 8000, 6.5 mM MgCl2, 0.6 M sodium acetate, pH 6–7). Sequencing was performed in a 373 DNA sequencer STRETCH (Applied Biosystems, Cheshire, United Kingdom).


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Distribution of ED-B FN Isoform in Malignant Tissue and Tumor Cell Lines.
To study the distribution of ED-B FN, immunohistochemical analysis was performed on cytospins of the breast carcinoma cell line (MCF 7) and the colon adenocarcinoma cell line (HT 29). The BC-1 monoclonal antibody, which recognizes human ED-B-containing FN molecules, was used. ED-B-containing FN was detected in MCF 7 cytospins but not in HT 29 (Fig. 1)Citation . FACS analysis was performed for these cell lines, but no ED-B was detected on cell surfaces (data not shown). Immunohistochemical analysis was also performed for tissue samples of both colorectal and breast tumors of mixed histotypes. Six of the 10 colorectal tumors (mixed histotypes) were positive for ED-B FN. The normal colon did not show any staining. Fig. 2Citation shows a representative colorectal adenocarcinoma. ED-B-containing FN was located in the epithelial cells of the tubular glands lining the intestinal mucosa of the colorectal adenocarcinoma (Fig. 2A)Citation . In contrast, FN lacking the ED-B domain was expressed mostly in the basement membrane and in the stroma surrounding the mucosa but was absent from the epithelial cells of the glands (Fig. 2B)Citation . No staining was seen in the negative control, with the exception of neutrophils containing endogenous peroxidase (Fig. 2C)Citation .



View larger version (136K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. HT 29 and MCF 7 cytospins stained for ED-B FN. Immunoperoxidase staining was performed in HT 29 and MCF 7 cytospins to detect ED-B FN. A, MCF 7 cells stained with BC-1 for ED-B FN (x200). ED-B FN is localized in the cell cytoplasm. B, HT 29 cells stained with BC-1 (x200). ED-B FN is absent from the cytoplasm of HT 29.

 


View larger version (85K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Immunohistochemical analysis of colorectal adenocarcinoma. Indirect immunoperoxidase staining was performed on cryostat sections of colorectal adenocarcinoma to study the expression of ED-B FN by use of the monoclonal antibody BC-1. A, tubular glands stained with BC-1 in colorectal adenocarcinoma (x200). Epithelial cells are strongly positive for ED-B FN, whereas the connective tissue does not react with BC-1. B, colorectal adenocarcinoma stained with an antibody against FN lacking ED-B domain (x200). FN lacking ED-B domain is localized in the basement membrane and in the stroma surrounding the mucosa but is absent from the epithelial cells of the gland. C, negative control (primary antibody omitted), which shows that the area of the tubular gland in colorectal adenocarcinoma is not labeled (x200). Some endogenous peroxidase is seen in neutrophils.

 
Twenty breast tumors of mixed histotypes and grades were tested by immunohistochemistry. ED-B FN was expressed in 19 of 20, representing 95% of the samples. The majority of the tissue sections again showed a predominately intracellular pattern of staining. In addition, in some cases, expression was also seen in the tumor stroma. There was no obvious association between staining intensity/pattern and tumor histotype in this small sample size. We did not observe any staining of blood vessels in any sample. The distribution of ED-B FN in a poorly differentiated infiltrating ductal grade 3 breast carcinoma is shown in Fig. 3ACitation .



View larger version (134K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Immunohistochemical analysis of ductal grade 3 breast carcinoma. Indirect immunohistochemistry was used to detect the presence of ED-B FN in cryostat sections (6 µm thickness) of ductal breast carcinoma. A, ductal grade 3 breast carcinoma stained with BC-1 (x200). ED-B FN is localized mainly in and around the tumor cells. B, negative control (primary antibody omitted) of ductal grade 3 breast carcinoma (x200).

 
RT-PCR Detection of ED-B FN mRNA Isoform in Human Colorectal and Breast Tumor Cell Lines and Tissues.
The presence of ED-B FN mRNA was studied in human tumor tissues and cell lines by means of RT-PCR using oligonucleotide primers. These were designed to contain sequences from both the ED-B FN exon and the appropriate adjacent exons, thus assuring that genomic DNA would not be amplified. This was confirmed in experiments in which reverse transcriptase was omitted (data not shown). Furthermore, we performed experiments with primers based on exons 7 and 8 with similar results (data not shown), although these were complicated by amplification of the ED-B lacking FN sequences. The ~300 bp ED-B sequence was detected in both HT 29 and MCF 7 cells, as shown in Fig. 4ACitation , Lanes 2 and 3, respectively. The presence of mRNA encoding ED-B FN in HT 29 cells coupled with the absence of ED-B staining in these cells indicates either that the message was not translated or that the product was secreted too rapidly to allow detection in the cytoplasm. The ED-B FN mRNA isoform was also detected in both human breast and colorectal adenocarcinoma biopsies (Fig. 4BCitation , Lanes 2 and 3, respectively), but no ED-B FN mRNA was found in normal colon or lymph nodes (data not shown). We were unable to obtain any samples of normal breast. The identity of the amplification products was confirmed by sequencing of the PCR products. The resulting sequence matches the published sequence for ED-B FN (9) .



View larger version (42K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. RT-PCR detection of ED-B FN mRNA isoform. Primers ED-B 5' and ED-B 3' were used to amplify ED-B domain, and the PCR products were run on a 1.5% agarose gel. A, Lane 2, HT 29 cells; Lane 3, MCF 7 cells; Lane 4, ß-actin positive control of MCF 7; Lane 5, negative control. B, Lane 2, breast adenocarcinoma; Lane 3, colorectal adenocarcinoma amplified with ED-B 5' and 3' primers; Lane 4, ß-actin positive control of breast adenocarcinoma; Lane 5, negative control. C, Lanes 2–4, product (~300 bp) from HUVEC, EA hy 926, and ECV 304 cell lines, respectively. Lane 5, positive control of HUVEC; Lane 6, negative control. Lane 1 in all panels, 1-kb DNA ladder. Positive controls were performed for all cell lines and samples, but only one positive is shown in the gels.

 
Expression of ED-B FN mRNA Isoform in Normal and Transformed Endothelial Cell Lines.
The RT-PCR analysis of the ED-B FN mRNA isoform was extended to primary and transformed endothelial cell lines. HUVECs from primary cell culture (Fig. 4CCitation , Lane 2), EA hy 926, a hybridoma made from HUVECs and a human lung carcinoma cell line (Fig. 4CCitation , Lane 3), and ECV 304, a spontaneously transformed HUVEC cell line (Fig. 4CCitation , Lane 4), were shown to express the ED-B FN mRNA isoform by RT-PCR.

Study of ED-B FN in Human Tumor Xenografts.
To study the production of ED-B FN in vivo, we used a tumor xenograft of the KB cell line (human oral epidermoid carcinoma). Immunohistochemistry of KB cytospins and tumor xenograft tissue sections as well as RT-PCR in both cells and tissue were performed. Fig. 5ACitation shows KB cytospins stained with BC-1, with ED-B localized in the cytoplasm and with some faint staining close to the plasma membrane. FACS analysis showed no surface expression of ED-B FN (not shown). In the KB xenograft, there was intense staining around tumor cells and in the tumor stroma (Fig. 5B)Citation . BC-1 antibody detects human but not murine ED-B-containing FN (27) . Therefore, detection of ED-B FN in the tumor xenograft indicates that it was produced by tumor cells. The mRNA encoding ED-B-containing FN was present in both KB cells and the xenograft as detected by RT-PCR (Fig. 5CCitation , Lanes 2 and 3).



View larger version (61K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Study of ED-B FN in tumor xenografts. KB cells and KB tumor xenograft were tested by means of RT-PCR and immunohistochemistry for the presence of ED-B FN. A, KB cytospins stained with BC-1 (x1000). ED-B FN is localized in the cytoplasm and near the cytoplasmic membrane. B, KB tumor xenograft stained with BC-1 (x200). Intense staining can be seen in tumor stroma and around xenograft cells, which is an indication that tumor cells contribute in the accumulation of ED-B FN in the stroma. C, RT-PCR of KB tumor cells and KB tumor xenograft showing the ~300-bp band that corresponds to ED-B-containing FN. The PCR products were run on a 1.5% agarose gel. Lane 1, 1-kb plus DNA ladder; Lane 2, KB tumor cells; Lane 3, KB tumor xenograft; Lane 4, negative control.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The aim of this study was to investigate the source and location of ED-B FN expressed in tumors because this has clear implications for both the development of immunotherapeutic approaches targeting ED-B FN and the development of our understanding of the role of this molecule in tumorigenesis.

The source of ED-B FN in tumors is unknown, although previous workers have speculated that it might be produced by the tumor cells themselves (19 , 28) . Transformed fibroblasts have been shown to express ED-B FN (16) . We analyzed tumor cell lines derived from colorectal (HT 29), breast (MCF 7), and head and neck (KB) carcinomas, and human primary endothelial cells (HUVEC) and endothelial cell lines (EA hy 926 and ECV 304). All of these cells expressed ED-B FN (as determined by RT-PCR), indicating that both tumor and endothelial cells could be the source of ED-B FN in tumors.

To investigate the contribution of neoplastic cells to ED-B FN in tumors, we stained human KB tumor xenografts grown in mice with the BC-1 antibody (which does not recognize murine ED-B FN). Strong staining both around the tumor cells and in the stroma indicates that the tumor cells can act as the source of ED-B FN in tumors, although it does not rule out a possible contribution by endothelial cells.

We have further investigated the cellular location of ED-B FN expression. Staining of cytospins of the cell lines indicated that in some of them ED-B FN could be detected in the cytoplasm. However, no staining was seen on the plasma membrane (as determined by FACS analysis). This indicates that ED-B FN is not expressed on the cell surface but is secreted from the cell. The failure to detect ED-B FN in the cytoplasm of some of the cell lines despite the clear presence of mRNA was presumably due to the rapid secretion of the molecule.

This study was complemented by immunohistochemical analysis of both breast and colorectal carcinomas. The BC-1 antibody stained 95% of the samples with breast carcinoma, which represented a variety of different histotypes. We observed submembranous and membranous staining of tumor cells. Kaczmarek et al. (17) , in a larger study of invasive ductal cell carcinoma, also observed staining of the blood vessels, as has also been seen for glioblastoma multiforme, high-grade astrocytoma, and benign tumors such as ependymoma and breast intraductal papilloma (18) . Our failure to observe similar staining of the vasculature may be a result of the many different tumor histotypes and small sample size we analyzed. In colorectal carcinoma samples, we saw staining associated with both the tumor cells and the tumor stroma in 60% of samples, similar to that reported previously (19) . We observed no staining of the vasculature; expression of ED-B FN by the vessels was not commented on by the authors of the previous study (19) .

These data, when taken together, suggest that tumor cells can act as a major source of ED-B FN in tumors. The cells do not express ED-B FN on their surface, but secrete it. Once secreted, it can contribute to the ED-B FN seen in the tumor stroma. In tumor samples, ED-B FN can be seen closely associated with the tumor cells. This may reflect secreted ED-B FN that forms part of the stroma immediately surrounding the tumor cells. This has implications for the use of ED-B FN in tumor therapy or in vivo diagnosis. Early reports showed ED-B FN expression in the lumen of blood vessels (13 , 18) , which would therefore be highly accessible to antibody-mediated therapy or imaging. Our data and those of others (17) indicate that this is not the case for all types of tumors. This reduces the attractiveness of using IgG antibodies because it will be necessary for these large molecules to penetrate the vasculature. To this end, we have constructed a single-chain Fv version of the antibody (29) , which should show better penetration of solid tissue for tumor imaging and therapy.

Clearly, the lack of surface expression of ED-B FN influences the possible forms of therapy. Thus, immunotoxin therapy, which requires direct binding of the therapeutic agent to the tumor cell, would not be feasible. However, either radioimmunotherapy or antibody-directed enzyme prodrug therapy might be effective with antibodies targeted to stroma rather than the tumor cells.

The lack of staining of endothelial cells in blood vessels is perhaps surprising in light of the detection of ED-B mRNA in HUVEC cells. There are several possible explanations for this. First, HUVEC cells growing in vitro will not represent the tumor-associated endothelium where division will be less; unfortunately, these are not good in vitro models for this situation. Second, the relative rates of production of ED-B FN are not known. Finally, ED-B FN is secreted and may then be laid down in extracellular matrix some distance from the cells producing the molecule.

To date, the role of the ED-B repeat in the fibronectin molecule has been unknown. However, there is evidence to suggest that it might play a role in, or affect, cell adhesion and spreading (30 , 31) . Both cell adhesion and cell spreading are important phenomena in embryogenesis, wound healing, angiogenesis, tumor establishment, and metastasis. No ligand has yet been identified for the ED-B domain. It has been suggested that insertion of ED-B into fibronectin causes conformational changes in the molecule (26) , improving access to the integrin binding sites in the 9th and 10th type III repeats. The finding that both tumor and endothelial cells express ED-B FN is clearly important for the investigations of the role of this molecule in tumor growth, establishment of metastasis, and angiogenesis.


    ACKNOWLEDGMENTS
 
We thank Dr. Luciano Zardi (Laboratory of Cell Biology, Genoa, Italy) for the generous gift of BC-1 (the monoclonal against ED-B FN).


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This study was supported by Antisoma plc, London, United Kingdom. Back

2 Authors M. M. and R. V. contributed equally toward the completion of this work. Back

3 To whom requests for reprints should be addressed, at Department of Immunology, Division of Medicine, Imperial College School of Medicine, Hammersmith Hospital, London, W12 0NN, United Kingdom. Back

4 The abbreviations used are: FN, fibronectin; HUVEC, human umbilical vein endothelial cell; RT-PCR, reverse transcription-PCR; FACS, fluorescence-activated cell sorting. Back

Received 6/15/99. Accepted 11/ 1/99.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alitalo K., Vaheri A. Pericellular matrix in malignant transformation. Adv. Cancer Res., 37: 111-150, 1982.[Medline]
  2. Hynes R. O., Yamada K. M. Fibronectins: multifunctional modular glycoproteins. J. Cell Biol., 95: 369-377, 1982.[Free Full Text]
  3. Zardi L., Carnemolla B., Siri A., Petersen T. E., Paolella G., Sebastio G., Baralle F. E. Transformed human cells produce a new fibronectin isoform by preferential alternative splicing of a previously unobserved exon. EMBO J., 6: 2337-2342, 1987.[Medline]
  4. Schwarzbauer J. E., Tamkun J. W., Lemischka I. R., Hynes R. O. Three different fibronectin mRNAs arise by alternative splicing within the coding region. Cell, 35: 421-431, 1983.[Medline]
  5. Kornblihtt A. R., Vibe-Pedersen K., Baralle F. E. Human fibronectin: molecular cloning evidence for two mRNA species differing by an internal segment coding for a structural domain. EMBO J., 3: 221-226, 1984.[Medline]
  6. Kornblihtt A. R., Vibe-Pedersen K., Baralle F. E. Human fibronectin: cell specific alternative mRNA splicing generates polypeptide chains differing in the number of internal repeats. Nucleic Acids Res., 12: 5853-5868, 1984.[Abstract/Free Full Text]
  7. Tamkun J. W., Schwarzbauer J. E., Hynes R. O. A single rat fibronectin gene generates three different mRNAs by alternative splicing of a complex exon. Proc. Natl. Acad. Sci. USA, 81: 5140-5144, 1984.[Abstract/Free Full Text]
  8. Kornblihtt A. R., Umezawa K., Vibe-Pedersen K., Baralle F. E. Primary structure of human fibronectin: differential splicing may generate at least 10 polypeptides from a single gene. EMBO J., 4: 1755-1759, 1985.[Medline]
  9. Gutman A., Kornblihtt A. R. Identification of a third region of cell-specific alternative splicing in human fibronectin mRNA. Proc. Natl. Acad. Sci. USA, 84: 7179-7182, 1987.[Abstract/Free Full Text]
  10. Schwarzbauer J. E., Patel R. S., Fonda D., Hynes R. O. Multiple sites of alternative splicing of the rat fibronectin gene transcript. EMBO J., 6: 2573-2580, 1987.[Medline]
  11. Castellani P., Siri A., Rosellini C., Infusini E., Borsi L., Zardi L. Transformed human cells release different fibronectin variants than do normal cells. J. Cell Biol., 103: 1671-1677, 1986.[Abstract/Free Full Text]
  12. Borsi L., Carnemolla B., Castellani P., Rosellini C., Vecchio D., Allemanni G., Chang S. E., Taylor-Papadimitriou J., Pande H., Zardi L. Monoclonal antibodies in the analysis of fibronectin isoforms generated by alternative splicing of mRNA precursors in normal and transformed human cells. J. Cell Biol., 104: 595-600, 1987.[Abstract/Free Full Text]
  13. Carnemolla B., Balza E., Siri A., Zardi L., Nicotra M. R., Bigotti A., Natali P. G. A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors. J. Cell Biol., 108: 1139-1148, 1989.[Abstract/Free Full Text]
  14. Oyama F., Hirohashi S., Shimosato Y., Titani K., Sekiguchi K. Deregulation of alternative splicing of fibronectin pre-mRNA in malignant human liver tumors. J. Biol. Chem., 264: 10331-10334, 1989.[Abstract/Free Full Text]
  15. Oyama F., Hirohashi S., Shimosato Y., Titani K., Sekiguchi K. Oncodevelopmental regulation of the alternative splicing of fibronectin pre-messenger RNA in human lung tissues. Cancer Res., 50: 1075-1078, 1990.[Abstract/Free Full Text]
  16. Borsi L., Balza E., Allemanni G., Zardi L. Differential expression of the fibronectin isoform containing the ED-B oncofetal domain in normal human fibroblast cell lines originating from different tissues. Exp. Cell. Res., 199: 98-105, 1992.[Medline]
  17. Kaczmarek J., Castellani P., Nicolo G., Spina B., Allemanni G., Zardi L. Distribution of oncofetal fibronectin isoforms in normal, hyperplastic and neoplastic human breast tissues. Int. J. Cancer, 58: 11-16, 1994.
  18. Castellani P., Viale G., Dorcaratto A., Nicolo G., Kaczmarek J., Querze G., Zardi L. The fibronectin isoform containing the ED-B oncofetal domain: a marker of angiogenesis. Int. J. Cancer, 59: 612-618, 1994.[Medline]
  19. Pujuguet P., Hammann A., Moutet M., Samuel L., Martin F., Martin M. Expression of fibronectin ED-A+ and ED-B+ isoforms by human and experimental colorectal cancer. Am. J. Pathol., 148: 579-592, 1996.[Abstract]
  20. Fogh J., Trempe G. New human tumor cell lines Fogh J. eds. . Human Tumor Cell Lines in Vitro, : 115-159, Plenum Press New York 1975.
  21. Eagle H. Propagation in a fluid medium of a human epidermoid carcinoma, strain KB. Proc. Soc. Exp. Biol. Med., 89: 362-364, 1955.
  22. Brooks S. C., Locke E. R., Soule H. D. Estrogen receptor in a human cell line (MCF-7) from breast carcinoma. J. Biol. Chem., 248: 6251-6253, 1973.[Abstract/Free Full Text]
  23. Jaffe E. A., Nachman R. L., Becker C. G., Minick C. R. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J. Clin. Investig., 52: 2745-2756, 1973.
  24. Takahasi K., Sawasaki Y., Hata J., Mukai K., Goto T. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev. Biol., 26: 265-274, 1990.[Medline]
  25. Edgell C-J. S., McDonald C. C., Graham J. B. Permanent cell line expressing human factor VIII-related antigen established by hybridization. Proc. Natl. Acad. Sci. USA, 80: 3734-3737, 1983.[Abstract/Free Full Text]
  26. Carnemolla B., Leprini A., Allemanni G., Saginati M., Zardi L. The inclusion of the type III repeat ED-B in the fibronectin molecule generates conformational modifications that unmask a cryptic sequence. J. Biol. Chem., 267: 24689-24692, 1992.[Abstract/Free Full Text]
  27. Carnemolla B., Neri D., Castellani P., Leprini A., Neri G., Pini A., Winter G., Zardi L. Phage antibodies with pan-species recognition of the oncofetal angiogenesis marker fibronectin ED-B domain. Int. J. Cancer, 68: 397-405, 1996.[Medline]
  28. Mariani G., Lasku A., Pau A., Villa G., Motta C., Calgano G., Taddei G. Z., Castellani P., Syrigos K., Dorcaratto A., Epenetos A. A., Zardi L., Viale G. A. A pilot pharmacokinetic and immunoscintigraphic study with the technetium-99m-labeled monoclonal antibody BC-1 directed against oncofetal fibronectin in patients with brain tumors. Cancer (Phila.), 80(Suppl.12): 2484-2489, 1997.[Medline]
  29. Verma R., George A. J. T., Courtenay-Luck N. S. Generation of a single-chain Fv (sFv) against an oncofetal antigen associated with tumorigenesis and angiogenesis. J. Int. Soc. Tumor Targeting, 1: 9-21, 1999.
  30. Chen W., Culp L. A. Adhesion mediated by fibronectin’s alternatively spliced EDb (EIIIB) and its neighboring type III repeats. Exp. Cell Res., 223: 9-19, 1996.[Medline]
  31. Hashimoto-Uoshima M., Yan Y. Z., Schneider G., Aukhil I. The alternatively spliced domains EIIIB and EIIIA of human fibronectin affect cell adhesion and spreading. J. Cell Sci., 110: 2271-2280, 1997.[Abstract]



This article has been cited by other articles:


Home page
Genes Dev.Home page
J. Wels, R. N. Kaplan, S. Rafii, and D. Lyden
Migratory neighbors and distant invaders: tumor-associated niche cells
Genes & Dev., March 1, 2008; 22(5): 559 - 574.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Sandal, K. Valyi-Nagy, V. A. Spencer, R. Folberg, M. J. Bissell, and A. J. Maniotis
Epigenetic Reversion of Breast Carcinoma Phenotype Is Accompanied by Changes in DNA Sequestration as Measured by AluI Restriction Enzyme
Am. J. Pathol., May 1, 2007; 170(5): 1739 - 1749.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
Z. A. Khan, M. Cukiernik, J. R. Gonder, and S. Chakrabarti
Oncofetal Fibronectin in Diabetic Retinopathy
Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 287 - 295.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. L. Schor, I. R. Ellis, S. J. Jones, R. Baillie, K. Seneviratne, J. Clausen, K. Motegi, B. Vojtesek, K. Kankova, E. Furrie, et al.
Migration-Stimulating Factor: A Genetically Truncated Onco-Fetal Fibronectin Isoform Expressed by Carcinoma and Tumor-Associated Stromal Cells
Cancer Res., December 15, 2003; 63(24): 8827 - 8836.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Fukuda, N. Yoshida, Y. Kataoka, R.-i. Manabe, Y. Mizuno-Horikawa, M. Sato, K. Kuriyama, N. Yasui, and K. Sekiguchi
Mice Lacking the EDB Segment of Fibronectin Develop Normally but Exhibit Reduced Cell Growth and Fibronectin Matrix Assembly in Vitro
Cancer Res., October 1, 2002; 62(19): 5603 - 5610.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. Gillan, D. Matei, D. A. Fishman, C. S. Gerbin, B. Y. Karlan, and D. D. Chang
Periostin Secreted by Epithelial Ovarian Carcinoma Is a Ligand for {alpha}V{beta}3 and {alpha}V{beta}5 Integrins and Promotes Cell Motility
Cancer Res., September 15, 2002; 62(18): 5358 - 5364.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Midulla, M.
Right arrow Articles by George, A. J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Midulla, M.
Right arrow Articles by George, A. J. T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online