| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Department of Human Genome and Multifactorial Diseases, Istituto di Tecnologie Biomediche Avanzate, Consiglio Nazionale delle Ricerche, 20090 Segrate Milan [M. G. S., E. M. C., A. F., F. A., L. Z., P. V.]; Istituto di Anatomia Patologica Veterinaria e Patologia Aviare [M. C., R. C., E. S.]; and Istituto di Scienze Farmacologiche, Facoltà di Farmacia, Università di Milano, 20133 Milan [G. C.], Italy
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
Most of these results have been obtained on transplantable tumors, i.e., tumoral cell lines cultured in vitro and transplanted in immunocompromised or syngenic mice. Although this approach has greatly benefited basic investigation in tumor biology, it is now being recognized that it is artificial to a great extent and does not recapitulate what really happens in humans (4 , 10, 11, 12) . However, the relevance of the obtained results for the treatment of human spontaneous tumors, which arise from a single cell that must adapt to its microenvironment, compete with similar adjacent cells, escape immune surveillance (if any), grow to a sizeable mass, acquire further genetic changes, and give rise to distant metastases, is unknown. Moreover, to evaluate the effect of the transferred gene, clones of these cells engineered to express a predetermined gene product are often used, and the effect on their growth compared to that of the parental, unmodified cell line, is investigated. This is not representative of what can be done at present in humans, where only a portion of the tumoral cells can be transfected or transduced with the expression vector and in which transgene expression is often shut off with unknown mechanisms. Therefore, it appears that to obtain results that can be transferable to the human situation, the choice of the animal model used is crucial.
Transgenic mice can represent an alternative to transplantable tumors for the evaluation of novel therapeutic strategies. However, thus far, the advantages offered by transgenic mice in this regard have only been exploited by Hanahans and Folkmans groups, who after pioneering the use of this technology for the study of the early step of tumor pathogenesis (13 , 14) , subsequently reported detailed studies on the angiogenesis step involved in the growth of a few tumors and on gene therapy trials targeted to tumor vasculature in these mice (4 , 15) . These groups have very recently reported the first study investigating endogenous angiogenesis inhibitors for tumor therapy in transgenic mice (16) .
With all these considerations in mind, we have investigated the effect of liposome-mediated angiostatin administration on a transgenic model, which we have been using for the last few years for gene therapy approach evaluation. This model, based on MMTV3 -neu transgenic mice bearing an activated rat neu oncogene under the control of the regulatory sequences contained in the long terminal repeat of the MMTV (17) , was chosen for its features that make it relatively similar to its human counterpart (10 , 18, 19, 20, 21, 22) . Female mice develop multiple mammary tumors in 100% of cases, in a very predictable manner, which makes them very useful as providers of homogeneous neoplastic material. Tumors are symmetrical, giving the possibility of comparing the treated tumors on one side to the untreated tumors on the contralateral side, and they have been grown for many generations without modification of tumor growth kinetics, allowing us to meaningfully compare mice treated over the years with different approaches. In this way, the early steps of tumor development can be investigated thoroughly and the stage at which to start the treatment can be easily determined even at the preclinical level. These tumors represent neoplasias arising relatively slowly in an immunocompetent host and involve an oncogene that is known to also play a role in human breast cancer (albeit with an amplification/overexpression mechanism, as opposed to the activating point mutation present in these mice). In addition, these tumors give rise to distant metastases in the 4th or 5th month of age, which are easily detected by histopathological examination.
Exploiting the reproducibility of tumor insurgence in our MMTV-neu model, we targeted liposome-delivered angiostatin to mammary tumors before they become clinically detectable, i.e., at a stage in which this switch is likely to occur. The response obtained with such a protocol was impressive and clearly superior to other approaches previously tested on the same model.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA Construct.
Angiostatin cDNA was obtained by RT-PCR on RNA extracted from
liver of a CD-1 mouse using the following primers: H3KangF,
5'CCAAGCTTCCACCATGGACCATAAGGAAGTAATCC3'; and R1HAangR,
5'CCGAATTCCTAAGCGTAGTCTGGGACGTCGTATGGGTATGTGGGCAATTCCACAACACT3'.
After the denaturation step for 3' at 94°C, PCR was carried out for
35 cycles at 94°C for 20'' (denaturation step), 58°C for 30''
(annealing), and 72°C for 20'' (extension). The product was cloned in
TA cloning and checked for the correct sequence.
Angiostatin cDNA was digested with HindIII/EcoRI and cloned in the HindIII/EcoRI site of MMTV Aneu Neo (20) after the removal of the Aneu sequences contained in an internal HindIII/EcoRI segment. The clone A3/3 was selected, characterized, and used for all of the experiments.
In Vivo Treatments.
A3/3 construct DNA was prepared and added to the DOSPER liposomal
transfection agent (Roche Diagnostics SpA, Monza, Italy) according to
manufacturers instructions, as previously described
(20)
. Fifty µl of the DOSPER/A3/3 mixture, containing 2
µg of DNA, were injected into the mammary glands of 2-month-old
MMTV-neu female mice. In the first set of experiments, both
the right and left breasts were injected every 15 days until the 5th
month of age. In a second group of mice, only the breasts of the right
side were injected monthly, whereas those of the left side were not
injected and used as an internal control. At the end of the 5th month,
the mice were sacrificed, and tumors were removed, weighed, and
subjected to molecular and histopathological analyses.
Statistical Analysis.
Local and systemic effect of angiostatin treatment were tested through
repeated measures ANOVA. In this model, we defined two factors, side
and breast, representing the repeated measures to assess within-subject
(local) effect, and a third factor, angiostatin treatment, to evaluate
between-subject (systemic) effect. Statistical analysis of vessel
density was performed with the Student t test. The
statistical software we used was SPSS for Windows 95.
Analysis of Angiostatin DNA and RNA.
DNA and RNA were extracted from tumors inoculated or not with A3/3 DNA,
and RNAs were retrotranscribed as previously described
(19)
. PCR was performed with the following primers:
Ang338F, 5'GGAACCATGTCCAGGACAAAG and Ang1097R, 5'GGAACTGAGGAATCTGACTGG,
which amplify a fragment of 759 bp.
Histopathological Analysis.
At necropsy, all tissues were examined grossly for lesions. Mammary
tumors, lungs, liver, kidneys and spleen were fixed in 10% neutral
buffered formalin. After fixation, lungs were sectioned in 2-mm thick
slices and processed as a whole, while single, transverse sections of
every mammary tumor and other organs were studied. All tissues were
dehydrated in graded ethanols, embedded in paraffin, sectioned at 5
µm, and stained with H&E according to standard procedures. Metastases
were evaluated in histological sections of the lungs, with careful
examination of all lung sections: they were counted and scored as small
(<10 cells), intermediate (10100 cells), and large (>100 cells).
Vessel Density Evaluation.
Mammary tumors were snap-frozen on liquid nitrogen and sectioned at 6
µm with a cryostat. Sections were mounted on
poly-L-lysine-coated slides, air-dried at room temperature
for 24 h, and fixed at -20 C° for 10 min in acetone. Endogenous
peroxidase activity was blocked by incubating the slides in 0.5%
H2O2 and 0.1% sodium azide
in Tris buffer (pH 7.6) for 20 min at room temperature. The slides were
washed in Tris buffer for 5 min and then exposed for 30 min to 2%
normal rabbit serum. Without washing, the first antibody, rat antimouse
CD-31 (Mec13.3), a specific marker of endothelial cells
(23)
, was applied overnight in a humidity chamber at 4°C
(dilution was 1:50). The slides were incubated with the second
antibody, biotinylated rabbit antirat immunoglobulin G (Vector
Laboratories, Burlingame, CA). The slides were then incubated in
avidin-biotin peroxidase complex according to Hsu et al.
(Ref. 24
; Vectstain elite, Vector Laboratories,
Burlingame, CA). The reaction was revealed by incubating the sections
with 0.05% diaminobenzidine and 0.01%
H2O2 substrate for 1 min.
The slides were washed for 5 min in tap water, counterstained with
hematoxylin, and mounted. Control slides were prepared by replacing the
primary antibody with normal rat serum.
Vascularization was evaluated in the area of tumor containing the most capillaries and small venules by light microscopy. The areas of highest vascularization were found by scanning the tumor sections at low power. In the selected area, vessels were counted on three x100 fields (1 mm2), and the mean was calculated (25 , 26) .
| RESULTS |
|---|
|
|
|---|
As explained before (10 , 19) , this protocol allows the evaluation of both local and systemic effect (if any) because the comparison of treated tumors of treated mice against uninjected (contralateral) tumors of treated mice and tumors of untreated mice gives an estimate of the effect exerted at the local level. In addition, if a systemic effect is also present, the weight of the untreated tumors of treated animals should be less than that of tumors of control (untreated) mice. In the extreme situation in which the locally administrated agent is active independently of the site of administration, there should be no difference among the treated tumors and the contralateral ones. Finally, the effect on metastatic dissemination, either direct or indirect, can be evaluated by careful examination of lungs from treated and control mice.
PCR performed on tumors of treated mice showed that at the moment of
sacrifice, the lipofected angiostatin vector DNA was present in
injected but not in uninjected samples (Fig. 1A
, Lanes 36 and 8). RT-PCR analysis
showed that angiostatin expression was still detectable in injected
tumors (Fig. 1B
, Lane 8), whereas no expression
was detected in uninjected tumors from treated mice (Fig. 1B
, Lane 7) nor in 10 tumors from
MMTV-neu untreated mice (data not shown), suggesting that
these tumors do not have basal expression of this inhibitory molecule.
|
|
|
Comparison with Other Gene Therapy-based Approaches.
The reproducibility of tumor growth in control mice is high, as
demonstrated by a statistical analysis of the controls performed in
previous experiments. When the tumor weights of the eight controls used
in this series were compared to those of eight controls used in
previous experiments sacrificed at the same age, there was no
significant difference. This is in agreement with the reproducibility
of tumor kinetics in MMTV-neu mice and suggests that a
comparison between the results obtained in the present study and those
achieved with previous treatments can be significant. In the past few
years, we have tested various gene therapy approaches on our model:
retrovirally delivered herpes simplex virus thymidine kinase gene (8
mice, sacrificed at 4 months of age), retrovirally delivered IL-4 (13
mice evaluated at 4 months and 11 mice evaluated at 5 months), and
retrovirally delivered connexin 43 (4 mice evaluated at 4 months of
age). These findings are summarized in Table 2
. In all these cases, tumors were individually weighed, with a total of
360 tumors in the treated groups. A total of 25 control mice (250
tumors) were also killed at 4 months of age, whereas 9 mice (90 tumors)
were sacrificed at 3 months (see Table 2
). When the results obtained
with liposome-delivered angiostatin were compared to those found with
all these approaches as well as with the 16 pooled control mice
sacrificed at 5 months, it was clear that the weights of both treated
and untreated tumors in angiostatin-treated mice were significantly
lower than those of treated and untreated tumors from any of these
treatments, with the exception of control mice at 3 months (Table 2)
.
This suggests that angiostatin treatment delays tumor expansion for at
least 2 months, a period which is more than one third of the life of
MMTV-neu mice.
|
|
|
Angiostatin Delivery in MMTV-neu Mice Inhibits
Metastatization.
Lung metastases are a consistent feature of the MMTV-neu
system (an example is given in Fig. 3b
). To determine
whether the delay in tumoral weight also reflects on the ability of
tumoral cells to spread to distant sites, we performed a careful
examination of lungs in the angiostatin-treated and in the control mice
killed at 5 months, an age at which
75% of MMTV-neu mice
bore lung metastases. In addition, lungs from eleven IL-4-treated mice
were also examined at 5 months. No metastases were detected in the 11
mice treated with the two angiostatin protocols. On the other hand,
metastases were present in 6 of 8 control mice in this series, in 6 of
8 historical controls, as well as in four of 11 mice treated with
retrovirally-delivered IL-4 and examined at 5 months of age. (see Table 3
). Taken together, these results show that angiostatin delivered with
this protocol delays both primary tumor growth and metastatic
dissemination.
| DISCUSSION |
|---|
|
|
|---|
Secondly, our system allows the evaluation in a natural setting of the effect of angiogenesis on the metastatization process, which is the leading cause of mortality in human tumoral pathology. When a careful analysis was performed on treated and untreated mice for the presence of pulmonary metastases, 75% of untreated mice had detectable metastases, whereas none of 11 treated mice showed any. This is a very promising finding, which strengthens the putative clinical usefulness of angiostatin treatment in humans. In our model, the inhibition on metastatic growth could be exerted directly at the level of lung microenvironment or could be a consequence of the effect exerted at the level of the primary tumor. We favor the second hypothesis; as in the former case, we would expect small tumor cell clusters to be present in the lungs because it is generally believed that seeding of small metastatic foci does not need new vessel formation. In this context, although the fact that metastatic cells are not usually shed from a primary tumor until this has become neovascularized has long been recognized (1 , 2 , 27) , the present data are the first formal proof of this phenomenon in a quasi-natural setting. Although we were unable to formally distinguish between these two possibilities, which are not mutually exclusive, it is interesting that a relationship between the degree of vessel density and metastatic status has been described in human breast carcinoma patients (25 , 28) .
Thirdly, whereas most previously reported studies with angiostatin and endostatin made use of purified protein, the findings presented here have been obtained with a gene transfer approach. Cao et al. (29) , using cell lines transfected with angiostatin cDNA, demonstrated that the protein can be released in vivo by engineered cells and viral-delivered angiostatin cDNA has been tested in experimental models based on transplantable cell lines (30 , 31) . Very recently, endostatin and/or angiostatin cDNA have been shown to be effective against transplantable tumors (32 , 33) , and our preliminary results showed that i.p. administration of liposome-complexed angiostatin could slow tumor growth also in MMTV-neu mice.5 Gene transfer approaches have the disadvantage that the amount of protein delivered cannot be exactly quantified. On the other hand, the production and purification of these two inhibitory proteins has not yet been fully standardized (34) ; in addition, the availability of purified products could represent a bottleneck in human cancer treatment. These problems could be overcome by gene transfer-based approaches such as the one described here. Liposomes are a vehicle easily prepared, have already been used in gene therapy clinical trials as well as in cosmetics, show little toxicity when administered locally or even parenterally, can be repeatedly administrated, do not raise immunological responses, do not show any danger of recombination with endogenous viral sequences and, in the long run, can be manipulated also by physicians in small peripheral hospitals (35) . The latter consideration could be relevant, should the angiogenesis inhibition approach become a widely used tool for cancer therapy.
We must emphasize that we did not provide a formal proof that angiostatin delivered by liposomes acted only through an antiangiogenic effect. However, our results are compatible with such kind of action because it has been shown that similarly engineered vectors act in this way and that angiostatin has little, if any, effect on the growth rate of tumor cell lines (29 , 33) . Our results are in agreement with those obtained recently with parenterally delivered angiostatin in a SV40 T-antigen-mediated transgenic model of islet cell carcinoma, in which angiostatin was effective mainly when used in the early stages of tumor development (16) . In our study, in which angiostatin was delivered before the appearance of clinically detectable lumps, a delay of at least 2 months in tumor growth and metastasis appearance has been obtained, which represents more than one-third of the life of untreated MMTV-neu mice. In addition, our experiments on mice in which injections were started at 2.5 months of age showed a reduced therapeutic effect. Taken together, these results suggest that angiostatin administration could be useful as an adjuvant treatment after surgery, whereas in large established tumors, protocols based on synthetic or natural inhibitory products combined to conventional treatments are needed (8 , 36) . In this regard, our model could be a useful tool to test all of these combinations.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by an Associazione Italiana Ricerca
sul Cancro Grant (to A. V.) and by P.F. Biotecnologie, Consiglio
Nazionale delle Ricerche (to P. V.). This is manuscript 35 of the
Genoma 2000/Istituto di Tecnologie Biomediche Avanzate Project
funded by Cariplo. ![]()
2 To whom requests for reprints should be
addressed, at Via Fratelli Cervi, 93, 20090 Segrate (MI), Italy. Phone:
39-02-26422638; Fax: 39-02-26422660; E-mail: sacco{at}itba-mi.cnr.it ![]()
3 The abbreviations used are: MMTV, mouse mammary
tumor virus; RT-PCR, reverse transcription-PCR; IL-4, interleukin 4. ![]()
4 M. G. Sacco, unpublished observations. ![]()
5 M. G. Sacco and M. Caniatti, unpublished
observations. ![]()
Received 8/ 9/99. Accepted 3/20/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. E. Daly, A. Makris, M. Reed, and C. E. Lewis Hemostatic Regulators of Tumor Angiogenesis: A Source of Antiangiogenic Agents for Cancer Treatment? J Natl Cancer Inst, November 19, 2003; 95(22): 1660 - 1673. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Turner, A. L. Harris, S. Melmed, and J. A. H. Wass Angiogenesis in Endocrine Tumors Endocr. Rev., October 1, 2003; 24(5): 600 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Scappaticci Mechanisms and Future Directions for Angiogenesis-Based Cancer Therapies J. Clin. Oncol., September 15, 2002; 20(18): 3906 - 3927. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |