| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Experimental Therapeutics |
Laboratorium voor Experimentele Geneeskunde en Endocrinologie, Katholieke Universiteit Leuven, 3000 Leuven [L. V., A. V., M. V. C., S. M., R. B.], and Vakgroep voor Organische Chemie, Universiteit Gent, 9000 Ghent [K. S., X-Y. Z., P. D. C., M. V.], Belgium
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The effects of 1,25(OH)2D3 are mainly mediated through binding to the VDR. Once bound, these nuclear receptors interact with specific DNA sequences as dimeric transcription factors that act as either activators or repressors of target genes (12) . However, the knowledge of the precise molecular mechanism underlying the growth-inhibitory effect of 1,25(OH)2D3 and its analogues remains fragmentary. 1,25(OH)2D3 has a cell cycle-specific effect leading to accumulation of cells in G1. Therefore, regulation of the activity of complexes between cyclins and cdk may be responsible for the antiproliferative effects (2 , 3) . Moreover, 1,25(OH)2D3 is able to up-regulate its own receptor expression, which may contribute to its resulting biological function (13) .
This study presents two 14-epi-analogues of 1,25(OH)2D3 that are able to inhibit the proliferation of ER-positive MCF-7 breast cancer cells at 10-fold lower concentrations than 1,25(OH)2D3. In addition, both analogues are, unlike 1,25(OH)2D3, able to retard the progression of breast tumors in a nude mice model with limited effects on calcemic parameters, pointing to the possible therapeutic application of these analogues in breast cancer. The contribution of programmed cell death to the growth-inhibitory effect of 1,25(OH)2D3 or analogues is only marginal, according to the data presented here. Therefore, gene regulation by these compounds has been studied in more detail.
| MATERIALS AND METHODs |
|---|
|
|
|---|
|
Cell Proliferation Assays.
As a measure of cellular proliferation,
[3H]thymidine incorporation of MCF-7, T47D, and
SK-BR-3 (ATCC, Rockville, MD) and keratinocytes was determined after a
72-h incubation period with various concentrations of
1,25(OH)2D3 or analogues
(14)
.
For cell cycle analysis, cells (106) were trypsinized, washed, fixed, and stained with propidium iodide (Sigma Chemical Co., St. Louis, MO) as described previously (2) . Samples were analyzed with a FACSort flow cytometer (Becton Dickinson, Lincoln Park, NJ) using the CellFIT program.
Cell Differentiation Assays.
Differentiation of HL-60 cells (ATCC) was measured by the nitro blue
tetrazolium reduction assay after a 72-h incubation period in presence
of 1,25(OH)2D3, analogues
or vehicle. Differentiation of MG-63 osteosarcoma cells (ATCC) was
assessed by measuring osteocalcin production with a radioimmunoassay
after a 72-h incubation period (14)
.
Detection of Apoptosis.
Regulation of the expression of apoptosis regulator genes,
bcl-2, bcl-xl, and bax, by
1,25(OH)2D3 or its
analogues was measured using real-time quantitative RT-PCR. Total RNA
was isolated by using the total RNA extraction kit from Roche (Palo
Alto, CA). One µg of RNA was reverse transcribed, and PCR reactions
on the resulting cDNA were performed in the ABI-prism 7700 sequence
detector (Perkin-Elmer/Applied Biosystems, Foster City, CA). PCR
primers and fluorogenic probes (6-carboxy-fluorescein as
reporter and 6-carboxy-tetramethylrhodamine as quencher dye) for
bcl-2, bcl-xl, bax, and ß-actin were purchased
from Perkin-Elmer. Sequences of primers and probes are as indicated
below. For bcl-2, primer sequences were GGTCATGTGTGTGGAGAGCG
and GGTGCCGGTTCAGGTACTCA, and the sequence of the probe was
CCTGGTGGACAACATCGCCCTGT. For bcl-xl, primer sequences were
ACCCCAGGGACAGCATATCA and TGCGATCCGACTCACCAATA, and the sequence of the
probe was TGTGCGTGGAAAGCGTAGACAAGGAGA. For bax, primer
sequences were GATGCGTCCACCAAGAAGCT and CGGCCCCAGTTGAAGTTG, and the
sequence of the probe was TGCAGAGGATGATTGCCGCCG. Expression of
ß-actin was used to normalize expression of bcl-2,
bcl-xl, and bax. For actin, primer sequences
were TCACCCACACTGTGCCCATCTACGA and CAGCGGAACCGCTCATTGCCAATGG, and the
sequence of the probe was ATGCCCCCCCCATGCCATCCTGCGT. External controls
were constructed consisting of plasmid standards for each target gene.
Serial dilutions of these resulting clones were used as standard
curves, each containing a known amount of input copy number.
The activity of caspase-3 was assayed fluorometrically by the CaspACE Assay System (Promega Corp., Madison, MI), following the instructions of the manufacturer. The protein content of these cell lysates was measured (BSA method; Sigma) and was used to normalize the caspase activity.
The proportion of Annexin V-positive cells was measured using flow cytometry, using a commercially available apoptosis detection kit from Clontech (ApoAlert Annexin V Apoptosis kit; Palo Alto, CA).
Induction of DNA strand breaks was investigated using the in situ cell death detection kit from Roche according to the instructions of the manufacturer, and samples were analyzed by flow cytometry.
Morphological features of programmed cell death have been studied on cytospins. Cytospins were made using a cytocentrifuge (Cytospin, Shandon, United Kingdom), and slides were stained with H&E.
Western Blot Analysis.
Western blotting was performed as described previously
(2)
. The primary antibodies mouse anti-cyclin D1 (HD11),
rabbit anti-cdk-4 (H-22), goat anti-p15 (C-20)-G, and rabbit anti-p27
(N-20) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
The mouse monoclonal anti-p21 WAF1 antibody, visualizing p21 protein as
a doublet, was obtained from Oncogene Research Products (Cambridge,
MA). Mouse monoclonal antibodies against bcl-2 and the Rb gene protein
were obtained from Medac Diagnostica (Hamburg, Germany). A mouse
monoclonal anti-p19INK4D antibody and a rabbit
polyclonal antibody against cyclin C were purchased from Biosource
International (Camarillo, CA). Equal loading of proteins was assessed
with a monoclonal anti-ß-actin antibody (Sigma).
Peroxidase-conjugated rabbit antimouse (Dako A/S, Glostrup, Denmark)
and goat antirabbit (Santa Cruz Biotechnology) antibodies were used as
secondary antibodies. Bands were qualified by laser densitometric
scanning (Pharmacia Biotech).
Expression of VDR and ER.
The effect of 1,25(OH)2D3
on the transcription of VDR and ER-
was quantified using real-time
quantitative RT-PCR as described above. For VDR, primer
sequences were TGGCTTTCACTTCAATGCTATGA and CGTCGGTTGTCCTTGGTGAT, and
the sequence of the probe was CGTCGGTTGTCCTTGGTGAT. For
ER-
, primer sequences were AAGAGGGTGCCAGGCTTTG and
TGCGGAACCGAGATGATGTA, and the sequence of the probe was
AGGGAAAATGTGTAGAGGGCATGGTGGAG. The expression of ß-actin
was used to normalize expression of VDR and ER.
Evolution of VDR protein was measured using a rat monoclonal antibody
(MAB 1360; Chemicon, Temecula, CA).
In Vivo Calcemic Activity of
1,25(OH)2D3 and Analogues.
NMRI mice were obtained from the Proefdierencentrum of Leuven (Belgium)
and fed with a vitamin D-replete diet (0.2% calcium, 1%
phosphate, and 2000 units vitamin D/kg; Hope Farms, Woerden, the
Netherlands). The hypercalcemic effect of the analogues was tested by
daily s.c. injections of serial dilutions of
1,25(OH)2D3 or analogues
for 7 consecutive days. Serum and urinary calcium were measured as
calcemic parameters using a commercially available kit (Sigma
Diagnostics).
In Vivo Antiproliferative Activity of
1,25(OH)2D3 and Analogues.
An in vivo breast cancer model was set up by injecting s.c.
a mixture of 5 x 106 MCF-7 cells
and Matrigel (Becton Dickinson) in the flanks of female nude mice,
which were given estrone (10 mg/l; Sigma) in their drinking water.
After 3 months, tumors were cut in small pieces (2
mm3) and could be used for transplantation. Part
of the tumor pieces was used to maintain a continuous in
vivo breast cancer model. For experiments, tumor pieces were
transplanted in 5-week-old female mice, which were given estrone in
their drinking water and kept on a calcium-poor diet (<0.2% calcium).
Treatment with 1,25(OH)2D3
or analogues, diluted in arachis oil, was started 4 days after tumor
transplantation and was given every other day by i.p. injections. Tumor
volume was measured twice weekly using a caliper and calculated using
the formula (ab2)/2 (a,
length of tumor; b, width of tumor). The total number of
tumors evaluated per treatment group was at least 44 (divided over
three independent experiments). The number of mitotic figures present
in tumors from control and treated mice was also determined. Therefore,
tumors were cut into 4-µm slices, which were stained with H&E. Slices
were examined at a 400-fold magnification and overlaid with a raster.
For each slice, the number of mitotic figures was counted in 10
different fields, and the average count was used for statistical
evaluation. At least 10 tumors of each treatment group were analyzed in
this way. The calcemic effects of the compounds were evaluated by
measuring serum and bone calcium content, and body weight was monitored
during the whole treatment period.
Statistics.
Data were first analyzed with the ANOVA for one-way classification,
fixed-effect model. The ANOVA determines whether the variation between
and within groups is such that the groups can be compared, tests the
equality of several population means, and indicates whether the factor
tested was affected by the different treatments. P < 0.05 was accepted as significant. This analysis was followed by
a two-tailed Students t test for unpaired samples,
assuming equal variances (according to the results of ANOVA).
| RESULTS |
|---|
|
|
|---|
Growth Inhibition of Breast Cancer Cells Associated with
G1 Arrest.
Proliferation of the ER-positive MCF-7 breast cancer cells was
dose-dependently inhibited by
1,25(OH)2D3 and was
characterized by an EC50 of approximately
5 x 10-8 M (Fig. 1A
). The EC50 of both 14-epi analogues
was, however, 10 times lower than that of the parent molecule. Cell
cycle analysis revealed that a 72-h treatment with
10-8 M
1,25(OH)2D3 caused a
significant increase in the percentage of cells in the
G1 phase (64% versus 55% in control
cultures; P < 0.01), whereas the proportion
of S-phase cells decreased (14% versus 24% in control
cultures; P < 0.01; Fig. 1B
).
This shift in cell cycle distribution was more pronounced when MCF-7
cells were treated with 10-8
M TX 522 or TX 527; 75% of cells were found in
the G1 phase of the cell cycle
(P < 0.01), and the percentage of actively
proliferating cells was decreased to 6% of the total population
(P < 0.01; Fig. 1B
). A 10-fold
higher analogue concentration (10-7
M) did not induce a further shift in cell cycle
distribution. The cell cycle distribution of MCF-7 cells that were
treated with 10-7 M
1,25(OH)2D3 was similar to
that of cultures that were incubated with 10-7
M TX 522 or TX 527 (data not shown).
|
|
|
(a) In a first approach, no significant alterations in the expression of bcl-2- and bax- related genes were found in MCF-7 cells that were incubated with 1,25(OH)2D3 or analogues (10-7 M) at any time point investigated (24, 48, 72, and 120 h; data not shown).
(b) In a second approach, no induction of the effector caspase-3 could be detected in lysates of MCF-7 cells that were treated with vehicle, 1,25(OH)2D3, or its analogues during different time periods (24, 48, 72, and 120 h; data not shown).
(c) The proportion of Annexin V-positive cells was
slightly increased in MCF-7 cells after a 72-h incubation period with
either 10-7 M
1,25(OH)2D3 or analogues
(Fig. 4
). This increase did not reach significance for treatment with
10-7 M
1,25(OH)2D3, whereas it did
for treatment with 10-7 M
TX 522 and TX 527 (from 3% in control cultures to 7% in cultures
treated with TX 522 or TX 527). The same tendency was observed after a
120-h incubation period.
|
(e) Finally, no significant differences could be found in the number of cells displaying morphological characteristics of programmed cell death. Moreover, no major differences in the degree of programmed cell death could be demonstrated in the tumors from nude mice treated with vehicle, 1,25(OH)2D3, TX 522, or TX 527 (data not shown).
As an internal control for the in vitro apoptosis assays,
MCF-7 cells were treated with a combination of
1,25(OH)2D3
(10-7 M) and TNF-
(10
ng/ml). Caspase activity in lysates of these cells was doubled after
24 h of treatment. Moreover, 20% of MCF-7 cells were Annexin
V-positive at this time point. Typical morphological features of
apoptosis were observed after a 72-h incubation period, and 23% of the
cell population proved to be apoptotic, according to the terminal
deoxynucleotidyl transferase-mediated nick end labeling method (data
not shown).
Protein Levels of Cyclin D1, cdk4, Cyclin C, p15, p19, p21, p27,
and Rb in Breast Cancer Cells after 1,25(OH)2D3
Treatment.
Because 1,25(OH)2D3 and its
analogues caused an accumulation of cells in the
G1 phase of the cell cycle, the expression of a
number of genes mediating the transition from the
G1 to the S phase of the cell cycle has been
monitored (Fig. 5
).
|
Next, changes in the expression of cdk inhibitors were investigated. As
representatives of the INK4 family, protein levels of p15 and p19 have
been monitored. However, no induction of those proteins could be
observed after a 72-h incubation with 10-7
M 1,25(OH)2D3,
TX 522, or TX 527. p21 and p27 protein levels have been studied as
representatives of the CIP/KIP family of inhibitors. The degree of
induction of p21 protein was investigated after 72 h of incubation
in presence of 10-7 M
1,25(OH)2D3 or analogue
(Fig. 5B
). A significant 4- and 6-fold increase in p21
protein production was observed when MCF-7 cells were treated with
1,25(OH)2D3 and TX 522,
respectively (P < 0.01). Surprisingly, the
level of p21 protein after a 72-h treatment with the analogue TX 527
was not significantly different from that in control cultures (1.5-fold
induction compared with control). Therefore, a time course experiment
was set up, and p21 protein levels were measured at different time
points during a 120-h incubation period. The p21 protein level was
approximately constant and never significantly different from that in
control cultures (data not shown). Thereafter, p21 protein levels,
after treatment with
1,25(OH)2D3 or analogues,
were also measured in other cell types to investigate whether the same
discrepancy in induction of p21 was found. A 3-fold up-regulation was
found in normal keratinocytes that had been incubated for 48 h
with 10-7 M
1,25(OH)2D3 and a 4-fold
up-regulation in the ER-negative SK-BR-3 cell line. Both TX 522 and TX
527 enhanced p21 production to the same extent as
1,25(OH)2D3 (data not
shown). Additionally, the evolution of p27 was investigated after
treatment with 1,25(OH)2D3
(Fig. 5B
). p27 protein levels were also significantly
enhanced by a 72-h incubation period with 10-7
M
1,25(OH)2D3 or with TX 527;
however, the degree of induction was lower than that of p21
(P < 0.01). Again, the analogue TX 527 was
not able to induce an enhanced production of p27. Therefore, p27
protein levels were also investigated in the other breast cancer cell
lines. However, no induction of p27 by
1,25(OH)2D3 or any other of
the analogues was found, either in the SK-BR-3 or in the T47D cell line
(data not shown).
Because active complexes between cyclins and cdks phosphorylate the Rb
protein so that transcription factors are released (15
, 16) , protein levels of Rb after incubation with
1,25(OH)2D3 was measured
(Fig. 5C
). After a 72-h incubation period in the presence of
10-7 M
1,25(OH)2D3 or these
14-epi-analogues, the amount of highly phosphorylated Rb (ppRb) was
decreased 5-fold (P < 0.0.1).
Expression of VDR and ER.
The transcription levels of VDR and ER were
investigated using RT-PCR (Fig. 6
). Transcription of VDR was doubled after a 72-h incubation
period with 10-7 M
1,25(OH)2D3
(P < 0.01). The analogues TX 522 and TX 527,
applied at 10-7 M, caused
a 3-fold up-regulation of VDR expression levels in MCF-7
cells [significantly different from control cultures but not from
those treated with
1,25(OH)2D3]. Protein
levels of VDR were found to be up-regulated to the same extent as the
mRNA after treatment with
1,25(OH)2D3 or analogues
(data not shown). Transcription levels of ER were, however,
not altered after a 72-h incubation period in the presence of
1,25(OH)2D3 or analogues
(data not shown).
|
| DISCUSSION |
|---|
|
|
|---|
Cdk-inhibitory proteins can also influence progression through the cell cycle (15 , 16) . As representatives of the Ink4 family, p15 and p19 have been studied, and their protein levels were found to be unchanged by 1,25(OH)2D3 or one of the 14-epi-analogues during a 72-h incubation period. It has been reported earlier that accumulation of cells in the G1 phase of the cell cycle after stimulation with 1,25(OH)2D3 occurs, chronologically consistent with the up-regulation of p21 and p27, which belong to the Cip/Kip family of inhibitors (2 , 3) . Therefore, it was investigated if p21 and p27 protein levels were equally enhanced by the 14-epi-analogues. The analogue TX 522 up-regulated p21 and p27 to the same extent as the parent hormone. Most surprisingly, the analogue TX 527, which only differs from TX 522 by the stereochemistry of C20, was not able to enhance the protein levels of p21 or p27 at any investigated time point (0120 h after stimulation). However, this inability to up-regulate these cdk inhibitors seemed to be cell specific because the analogue TX 527 did enhance p21 protein levels in the T47D and SK-BR-3 breast cancer cells and in normal keratinocytes. This observation illustrates the analogue and cell type specificity of the regulation of cell cycle-related genes. Analogue specificity may be partially explained at the biochemical level. Because VDR conformation alters upon binding of the ligand, it is conceivable that interaction with its heterodimerization partner retinoid X receptor and subsequently with coactivators and corepressors will change (12 , 25) . This can then finally lead to differences in gene transcription. In support of this hypothesis, it is demonstrated via limited protease digestion (data not shown) that the analogue TX 522 induced a less stable VDR conformation compared with 1,25(OH)2D3 and TX 527. The cell specificity might essentially be explained in the same way. It may be hypothesized that different coactivator or corepressor molecules prevail in different cell types. The mutual proportion of these different molecules may then influence the composition of the preinitiation complex and affect the regulation of gene transcription. The inability of the analogue TX 527 to enhance protein levels of p21 also questions the critical role of p21 in the growth inhibition caused by 1,25(OH)2D3 and its analogues. In a previous report, it is already described that a simultaneous treatment of MCF-7 cells with 1,25(OH)2D3 and transforming growth factor-ß neutralizing antibodies completely abolishes the induction of p21, whereas proliferation of these cells is still inhibited (2) . Moreover, growth inhibition of squamous cell carcinoma by 1,25(OH)2D3 is reported to be accompanied by a decrease of p21 protein levels both in vitro and in vivo (26) . The importance of the p27 protein may also be questioned, because this inhibitor is not enhanced in T47D or in SK-BR-3 cells. It is generally accepted that the ultimate goal of activated cdks is the phosphorylation of the Rb protein, which upon phosphorylation releases transcription factors required for progression to the S phase of the cell cycle (15 , 16) . The amount of hyperphosphorylated Rb was markedly decreased by 1,25(OH)2D3 and both 14-epi analogues, suggesting the existence of redundant pathways for phosphorylation of Rb and subsequent growth control.
Programmed cell death may also be involved in growth inhibition by 1,25(OH)2D3 and has been reported to occur in MCF-7 breast cancer cells (4) . In this study, a number of approaches were used to investigate the induction of apoptosis at different chronological stages of the process. No significant changes were found in the transcription of the pro-apoptotic gene bax and the antiapoptotic genes bcl-2 and bcl-xl. Proteins of these apoptosis-related genes can interfere with the release of cytochrome c, which is believed to precede the activation of the caspases (27 , 28) . Activity of caspase-3, generally involved in the process of apoptotic cell death, was not altered upon treatment with 1,25(OH)2D3 at any of the time points investigated (24, 48, 72, and 120 h after stimulation). There is also no proof for the fragmentation of DNA in MCF-7 cells after stimulation with 1,25(OH)2D3 or any of the 14-epi analogues. A marginal increase in the number of cells expressing Annexin V is observed in MCF-7 cells that are incubated in the presence of TX 522 or TX 527. Therefore, it is suggested that the contribution of programmed cell death to the growth-inhibitory effects of 1,25(OH)2D3 and the investigated 14-epi-analogues is only marginal.
In conclusion, the 14-epi-analogues TX 522 and TX 527 are potent inhibitors of breast cancer proliferation both in vitro and in vivo. Their selectivity profile based on data obtained in vitro on MCF-7 cells and in vivo calcemic effect (mouse serum calcium levels) exceeds severalfold that of the best analogues of 1,25(OH)2D3 yet published when measured with the same methods in the same laboratory. Therefore, these compounds have the ideal profile to be tested as therapeutic agents for benign (e.g., psoriasis) and malignant (e.g., breast cancer) hyperproliferative diseases.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 This work was supported by Grant G.0233.97 from
the Flemish Fund for Scientific Research and by Théramex S. A. ![]()
2 Equal contribution of both authors. ![]()
3 To whom requests for reprints should be
addressed, at LEGENDO Onderwijs en Navorsing, Gasthuisberg, 3000
Leuven, Belgium. Phone: (32)016/345970; Fax: (32)016/345934; E-mail: roger.bouillon{at}med.kuleuven.ac.be ![]()
4 The abbreviations used are:
1,25(OH)2D3, 1
,25-dihydroxyvitamin
D3; VDR, vitamin D receptor; cdk, cyclin-dependent kinase;
KS 532, 19-nor-14-epi-1,25(OH)2D3; SDB 112/TX
522, 19-nor-14-epi-23-yne-1,25(OH)2D3; ZXY
1106/TX 527,
19-nor-14,20-bisepi-23-yne-1,25(OH)2D3; DBP,
vitamin D binding protein; ATCC, American Type Culture
Collection; ER, estrogen receptor; Rb, retinoblastoma; RT-PCR, reverse
transcriptase-PCR. ![]()
Received 8/26/99. Accepted 3/22/00.
| REFERENCES |
|---|
|
|
|---|
,25-dihydroxyvitamin D3 and related analogues. J. Org. Chem., 57: 3214-3217, 1992.
,25-dihydroxyvitamin D3. Bioorg. Med. Chem. Lett., 3: 1855-1858, 1993.
,25-dihydroxyvitamin D3 and its analogs. J. Bone Miner. Res., 9: 1277-1288, 1994.[Medline]
,25-dihydroxy-vitamin D3: synthesis, isomerisation to previtamins, and biological studies. Med. Chem., 37: 2387-2393, 1994.
-hydroxyvitamin D3 and 1
,25-dihydroxyvitamin D3 of colon carcinogenesis induced by azoxymethane in Wistar rats. Int. J. Cancer, 81: 730-733, 1999.[Medline]
This article has been cited by other articles:
![]() |
M. S. K. Wong, R. Delansorne, R. Y. K. Man, and P. M. Vanhoutte Vitamin D derivatives acutely reduce endothelium-dependent contractions in the aorta of the spontaneously hypertensive rat Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H289 - H296. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Mullin and A. Dobs Vitamin D and Its Role in Cancer and Immunity: A Prescription for Sunlight Nutr Clin Pract, June 1, 2007; 22(3): 305 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Masuda and G. Jones Promise of vitamin D analogues in the treatment of hyperproliferative conditions. Mol. Cancer Ther., April 1, 2006; 5(4): 797 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Khadzkou, P. Buchwald, G. Westin, H. Dralle, G. Akerstrom, and P. Hellman 25-Hydroxyvitamin D3 1{alpha}-Hydroxylase and Vitamin D Receptor Expression in Papillary Thyroid Carcinoma J. Histochem. Cytochem., March 1, 2006; 54(3): 355 - 361. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Verlinden, G. Eelen, I. Beullens, M. Van Camp, P. Van Hummelen, K. Engelen, R. Van Hellemont, K. Marchal, B. De Moor, F. Foijer, et al. Characterization of the Condensin Component Cnap1 and Protein Kinase Melk as Novel E2F Target Genes Down-regulated by 1,25-Dihydroxyvitamin D3 J. Biol. Chem., November 11, 2005; 280(45): 37319 - 37330. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Eelen, L. Verlinden, N. Rochel, F. Claessens, P. De Clercq, M. Vandewalle, G. Tocchini-Valentini, D. Moras, R. Bouillon, and A. Verstuyf Superagonistic Action of 14-epi-Analogs of 1,25-Dihydroxyvitamin D Explained by Vitamin D Receptor-Coactivator Interaction Mol. Pharmacol., May 1, 2005; 67(5): 1566 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. G.S. van Halteren, E. van Etten, E. C. de Jong, R. Bouillon, B. O. Roep, and C. Mathieu Redirection of Human Autoreactive T-Cells Upon Interaction With Dendritic Cells Modulated by TX527, an Analog of 1,25 Dihydroxyvitamin D3 Diabetes, July 1, 2002; 51(7): 2119 - 2125. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, S. L. Asa, I. G. Fantus, P. G. Walfish, and S. Ezzat Vitamin D Arrests Thyroid Carcinoma Cell Growth and Induces p27 Dephosphorylation and Accumulation through PTEN/Akt-Dependent and -Independent Pathways Am. J. Pathol., February 1, 2002; 160(2): 511 - 519. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Scaglione-Sewell, M. Bissonnette, S. Skarosi, C. Abraham, and T. A. Brasitus A Vitamin D3 Analog Induces a G1-Phase Arrest in CaCo-2 Cells by Inhibiting Cdk2 and Cdk6: Roles of Cyclin E, p21Waf1, and p27Kip1 Endocrinology, November 1, 2000; 141(11): 3931 - 3939. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. McGuire, D. L. Trump, and C. S. Johnson Vitamin D3-induced Apoptosis of Murine Squamous Cell Carcinoma Cells. SELECTIVE INDUCTION OF CASPASE-DEPENDENT MEK CLEAVAGE AND UP-REGULATION OF MEKK-1 J. Biol. Chem., July 6, 2001; 276(28): 26365 - 26373. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS |