Cancer Research Aziza Shad  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hausen, A. z.
Right arrow Articles by van den Brule, A. J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hausen, A. z.
Right arrow Articles by van den Brule, A. J. C.
[Cancer Research 60, 2745-2748, May 15, 2000]
© 2000 American Association for Cancer Research


Virology

Unique Transcription Pattern of Epstein-Barr Virus (EBV) in EBV-carrying Gastric Adenocarcinomas: Expression of the Transforming BARF1 Gene1

Axel zur Hausen, Antoinette A. T. P. Brink, Mikael E. Craanen, Jaap M. Middeldorp, Chris J. L. M. Meijer and Adriaan J. C. van den Brule2

Department of Pathology, Section Molecular Pathology [A. z. H., A. A. T. P. B, J. M. M., C. J. L. M. M., A. J. C. v. d. B.], and Department of Gastroenterology [M. E. C.], University Hospital Vrije Universiteit, 1007 MB Amsterdam, the Netherlands


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Approximately 10% of gastric adenocarcinomas worldwide are associated with human EBV. These carcinomas generally do not express the latent membrane protein 1 (LMP1), the major known EBV oncogene.

Recently, another EBV gene [i.e., BARF1 (BamHI A rightward open reading frame)] was shown to have transforming and immortalizing capacities. Therefore, in this study, we investigated the expression of BARF1 in EBV-carrying gastric adenocarcinomas in relation to the expression of other latent EBV transcripts.

In the present study, 10 of 132 gastric adenocarcinomas tested positive for EBV using EBER1/2-RNA in situ hybridization. We demonstrate BARF1 gene transcription in nine EBV-carrying gastric adenocarcinomas (with sufficient RNA quality) using the BARF1-specific nucleic acid sequence-based amplification assay. In addition, we also detected other latent EBV transcripts (i.e., BARF0-, LMP2A-, and Q/K-driven EBNA1 transcripts in these carcinomas using reverse transcription-PCR analysis. No expression of LMP1, EBNA2, and ZEBRA (either at transcription or protein level) was found. In addition, two cases were positive for BHRF1 transcripts, the viral bcl-2 homologue. Thus, together with BARF1 transcription, a unique and distinct EBV latency type has been found in EBV-associated gastric adenocarcinomas.

Because BARF1 exerts immortalizing effects on human epithelial cells in vitro and EBV-carrying gastric adenocarcinomas lack the expression of LMP1, the BARF1 gene might act as the viral oncogene in EBV-carrying gastric carcinomas. The BARF1 gene offers an alternative way for EBV-mediated oncogenesis other than LMP1.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Gastric cancer is the second leading cause of cancer-related mortality worldwide, and clinical prognosis is very poor. Apart from the accepted role of Helicobacter pylori in the pathogenesis of gastric carcinomas, the human {gamma}-herpesvirus EBV is present in ~10% (range, 2–16%) of human gastric adenocarcinomas worldwide (1, 2, 3) . Furthermore, EBV is associated with 80–100% of the rare lymphoepithelioma-like gastric carcinomas (4) and is also present in ~35% of the gastric stump carcinomas (5) . The pathogenic role of EBV in gastric adenocarcinomas remains still undefined. The latency type of EBV in gastric adenocarcinomas is distinct from the known EBV latency types (e.g., in Burkitt’s lymphomas and nasopharyngeal carcinomas; Ref. 6 ). This is mainly due to the expression of LMP2A3 and the absence of LMP1 expression in gastric adenocarcinomas. EBV-carrying gastric adenocarcinomas generally do not express the major EBV oncogene LMP1 (7) , although LMP1 expression has been occasionally reported (8 , 9) .

Apart from LMP1, another EBV gene (i.e., BARF1) has recently been determined as a transforming and immortalizing EBV gene (10 , 11) . The BARF1 open reading frame is located within a 40-kb fragment of the EBV genome and encodes a Mr 33,000 protein. This 40-kb fragment encompasses the BamHI D to BamHI A regions of the EBV genome and is able to immortalize primary monkey and human epithelial cells in vitro (12 , 13) . Wei et al. (11) recently demonstrated that BARF1 is involved in the immortalization of primary monkey epithelial kidney cells. Furthermore, it has been demonstrated that transfection of BARF1 into the rodent fibroblast cell line BALB/c 3T3 or in the EBV-negative B cell line Louckes resulted in tumorigenic transformation (10 , 14) . Injection of the transfected murine fibroblasts into newborn rats led to the development of aggressive BARF1-expressing tumors, whereas injection of the transfected Louckes cell line induced only small tumors that disappeared 3 weeks after injection.

Recently, Strockbine et al. (15) reported that BARF1 is a functional homologue of the human CSF receptor. The CSF receptor is the gene product of the human proto-oncogene c-fms. This homology between BARF1 and c-fms is especially interesting in the context that c-fms and CSF1 have been suggested to modulate neoplastic mammary epithelial cell proliferation (16) .

Because LMP1 is generally not expressed in EBV-carrying gastric adenocarcinomas, we studied here the expression of BARF1 as an alternative way for EBV-mediated oncogenesis in relation to the expression of other latent EBV genes.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines.
The EBV-positive lymphoblastoid B cell line JY was used as a positive control for the expression of the EBV transcripts.

The EBV-negative Louckes cell line, Louckes1–5, transfected with a BARF1 expression construct (14) , was kindly provided by Dr. T. Ooka (Laboratoire de Virologie Moléculaire, Centre National de la Recherche Scientifique, Lyon, France). The EBV-positive C15 tumor cell line derived from a nasopharyngeal carcinoma was kindly provided by Dr. B. Griffin (Imperial College School of Medicine, London, United Kingdom; Ref. 17 ).

Clinical Material.
Paraffin-embedded gastric adenocarcinomas (n = 132), of which also frozen material was available, collected at the Department of Pathology of the University Hospital Vrije Universiteit (Amsterdam, the Netherlands), were tested by EBER1/2-RISH for the presence of EBV. Corresponding snap-frozen material of these EBV-positive gastric carcinomas and 10 gastric control tissues, including 5 EBV-negative gastric carcinomas and 5 specimens of normal gastric epithelium, were used for the RNA EBV-transcript analysis. Before RNA isolation, the sandwich frozen sections (of this material) were H&E stained and microscopically checked for the presence of tumor cells.

EBER1/2-RISH.
Paraffin-embedded tissue from 132 gastric carcinomas was subjected to a nonradioactive EBER1/2-RISH using the Digoxygenin-labeled antisense and sense EBER1/2 probe, as described previously (18) .

Oligonucleotide Primers and Probes.
All EBV-specific primers (i.e., EBNA1, EBNA2, BARF0, LMP1, LMP2A, BHRF1, and ZEBRA; Ref. 19 ) and primers specific for the U1 small nuclear ribonucleoprotein-specific A protein (20) have been described previously.

The primers for the BARF1-NASBA assay were: primer 1.2, GGCTGTCACCGCTTTCTTGG (nt. 165560–16579); and primer 2.1, T7-AGGTGTTGGCACTTCTGTGG (nt. 165762–165743). As probe, the oligonucleotide CTGGTTTAAACTGGGCCCAGGAGAGGAGCA (nt. 165644–165673) was used. A detailed protocol has been described recently (21) . NASBA primers were polyacrylamide purified to guarantee pure, full-length primers.

RNA Isolation and RT-PCR.
RNA was isolated from twelve 5-µm thick cryosections using 1 ml of the guadinium-phenol-based RNAzol reagent (Cinna Biotecx, Houston, TX). The purity and concentration of the isolated RNA were determined spectrophotometrically; the integrity of the RNA was determined by agarose gel electrophoresis, the presence of 18S/28S rRNA bands being an index for good RNA quality. The isolated RNA was stored as isopropanol precipitates at -80°C. Before the RT reaction, an amount of the precipitate equivalent to 1 µg of RNA was centrifuged for 15 min, washed with 70% ethanol, and air dried. RT and subsequent PCR were performed as described previously (22) , and PCR products were analyzed on 1.5% agarose gels, transferred to nylon filters by alkaline Southern blotting, and hybridized to specific {gamma} 32P-ATP-labeled oligonucleotide probes to determine their specificity.

BARF1-NASBA.
The NASBA assay (23) is an isothermal in vitro amplification method with simultaneous activity of reverse transcriptase, T7-RNA-polymerase, and RNase H, which enables a reliable and sensitive detection of target RNA in the presence of DNA independent of splice sites (21) .

The BARF1-NASBA reaction was carried out as described previously (21) . Briefly, 100 ng of total RNA per reaction was amplified at 41°C in 20-µl reaction volumes containing 4 pmol of either primer, 15% DMSO, 40 mM TRIS-HCL (pH 8.5), 12 mM MgCl2, 70 mM KCl, 4 mM DTT, 1 mM of each dNTP, 2 mM rATP, rUTP, rCTP, 1.5 mM rGTP, and 0.5 mM ITP. Reagents were kindly supplied by Organon Teknika (Boxtel, the Netherlands).

Reaction products were evaluated by gel electrophoresis using 1.5% agarose in Tris-borate EDTA, transferred from the gels to the nylon filters (Qiabrane; Qiagen, Chatsworth, CA) via capillary blotting in 10* SSC, and hybridized to specific {gamma} 32P-ATP end-labeled oligonucleotide probes.

The absolute sensitivity of the BARF1-NASBA assay was determined to detect 10–100 RNA templates.

IHC.
To detect EBV-specific proteins, monoclonal antibodies against LMP1 [CS1–4 (DAKO) and S12 (Organon Teknika)] and ZEBRA (DAKO) were used. The antibodies were visualized with an avidin-biotin-horseradish peroxidase complex and diaminobenzidine/H2O2 staining method, as described previously (24) .

EBNA1 expression was detected in paraffin-embedded tissues with a recently generated anti-EBNA1-specific rat monoclonal antibody, 2B4–1 (25) . To increase sensitivity, a few adjustments were made. Before incubation with the anti-EBNA1 antibody, tissues were boiled for 15 min in a citrate buffer [0.1 M/l (pH 6.0)]. Incubation with the antibody was done overnight at room temperature with a 1:50 diluted antibody (final concentration, 44 µg/ml). Detection of the antibody was performed with an avidin-biotin-horseradish peroxidase complex. The peroxidase was visualized by incubation for 3 min in 0.2 mg/ml diaminobenzidine, 0.003% H2O2, and 0.12% NickelAmmoniumsulphate in 50 mmol/L Tris-HCl (pH 7.6), followed by silver enhancement of the diaminobenzidine-nickel precipitate, as described previously (26) .


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
EBER1/2-RISH.
Ten (7.6%) of 132 gastric adenocarcinomas tested positive for EBV by EBER1/2-RISH. Using the EBER1/2 antisense probe, nuclear EBER1/2 expression was detected in the majority of, if not all, neoplastic cells of these gastric adenocarcinomas (Fig. 1Citation ). Nuclear staining was also found in the positive controls used (i.e., JY cell line and one EBV-positive Hodgkin’s lymphoma). No expression was seen using the EBER1/2 sense probe.



View larger version (157K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. EBER1/2-RISH in a gastric adenocarcinoma. EBER1/2 signals (antisense Dig-labeled riboprobes) are located in the nuclei of the carcinoma cells.

 
Assessment of RNA Quality.
Of the corresponding snap-frozen tissues of the 10 EBV-positive gastric adenocarcinomas, 9 revealed a sufficient RNA quality for further transcript analysis (summarized in Table 1Citation ) as was shown by clearly visible 18S and 28S rRNA bands and U1 small nuclear ribonucleoprotein-specific A protein mRNA RT-PCR.


View this table:
[in this window]
[in a new window]

 
Table 1 Summary of results in nine EBV-positive gastric carcinomas

 
BARF1 Transcription by NASBA.
The nine remaining EBV-positive gastric adenocarcinomas were tested for BARF1 transcription using the NASBA (i.e., an alternative RNA amplification method that enables a reliable and sensitive detection of target RNA in the presence of DNA independent of splice sites). Indeed, all nine EBV-positive gastric adenocarcinomas did show expression of BARF1-RNA using the sensitive BARF1-NASBA assay, revealing a 203-bp fragment (Fig. 2aCitation ). In contrast, EBV-negative gastric adenocarcinomas (Fig. 2bCitation ) and normal gastric control tissue (data not shown) did not show transcription of BARF1. As shown in Fig. 2, a and bCitation , the positive controls (i.e., Loukes1–5 cell line and C15 tumor cell line) showed BARF1 transcripts, whereas the negative control (distilled water) was negative.



View larger version (56K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Northern blot analysis of the BARF1-NASBA products. a, BARF1 transcription in EBV-positive gastric adenocarcinomas. The EBV-negative Louckes cell line transfected with BARF1 served as positve control and revealed a band at the expected size (203 bp). b, BARF1-NASBA results in EBV-negative gastric adenocarcinomas. The EBV-positive NPC cell line C15 was used as positive control.

 
EBV Transcript Analyses by RT-PCR.
Using RT-PCR all nine carcinomas expressed BARF0 transcripts. Furthermore, we found Q-promoter-driven EBNA1 transcription in eight of the nine cases. In contrast, no Cp/Wp-promoter-driven EBNA1 transcripts could be demonstrated. In accordance with previously published results, no LMP1 and EBNA2 transcripts were found, whereas seven of nine cases displayed LMP2A expression at the RNA level (shown in Fig. 3Citation ). Two cases actually displayed BHRF1 transcripts driven by the H2/HF-promoter (data not shown). In contrast, no Cp/Wp-promoter-driven BHRF1 transcripts were found and no expression of ZEBRA transcripts. All RT-PCR and NASBA results are summarized in Table 1Citation .



View larger version (72K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Southern blot analysis of EBV RT-PCR products in EBV-positive gastric adenocarcinomas. The EBV-positive LCL JY cell line served as positive control. Transcription of Q-promoter-driven EBNA1 (236 bp), BARF0 (240 bp), and LMP2A (280 bp) and the absence of LMP1 (240 bp) transcription characterize the EBV latency type in EBV-associated gastric carcinomas. Bottom, U1A RT-PCR as RNA quality control.

 
IHC.
EBV-carrying gastric adenocarcinomas were tested immunohistochemically for EBNA1, LMP1, and ZEBRA. Using the anti-EBNA1-specific rat monoclonal antibody 2B4–1, 5 of 10 carcinomas showed protein expression of EBNA1. Interestingly, one gastric carcinoma that was tested negative by RT-PCR for EBNA1 did show protein expression using the 2B4–1 anti-EBNA1 antibody. None of the 10 carcinomas revealed staining for LMP1 or ZEBRA. Data are summarized in Table 1Citation . EBV-positive control (i.e., JY cell line) tested positive for EBNA1, LMP1, and ZEBRA.


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In the present study, we demonstrate a novel EBV latency pattern in EBV-carrying gastric adenocarcinomas (Table 2)Citation predominantly based on the presence of BARF1 transcripts and the absence of LMP1 expression. This is the first time that transcription of the transforming BARF1 gene has been demonstrated in EBV-carrying gastric adenocarcinomas. The novel latency pattern is characterized by transcription of the transforming BARF1 gene, EBER1/2, Q-promoter-driven EBNA1, BARF0, LMP2A, and the absence of LMP1 and EBNA2 transcription. Although BARF1 is designated as an early gene in lytic infection in B-lymphocytes, the transforming BARF1 is exclusively transcribed as a latent gene in EBV-associated epithelial maligancies (i.e., NPC; Refs. 21 and 27 ) and gastric carcinomas (this study). Sbih-Lammali et al. (27) previously demonstrated weak BARF1 transcription in two of five North African NPCs using a reverse Northern blotting technique. In addition, Brink et al. (21) and Hayes et al. (28) used a more sensitive technique (i.e., NASBA) and found BARF1 expressed in almost all NPCs and not in lymphoid malignancies or productive EBV infection (oral hairy leukoplakia).


View this table:
[in this window]
[in a new window]

 
Table 2 Expression of EBV genes in different EBV-associated diseases

 
Additional IHC studies using BARF1-specific monoclonal antibodies are needed to show expression at the protein level in EBV-carrying gastric adenocarcinomas.

Because gastric adenocarcinomas generally do not express LMP1—until now the major EBV oncogene—BARF1 expression in EBV-carrying gastric carcinomas may be an alternative way for EBV-mediated gastric carcinogenesis. BARF1 has recently been determined as a transforming gene in rodent fibroblasts and as an immortalizing gene in primary monkey epithelial cells (10 , 11) . In this context, it is interesting that Strockbine et al. (15) recently demonstrated that the BARF1 gene encodes a novel CSF-1 receptor. BARF1 shares a subtle, highly localized region of homology with several members of the tyrosine kinase receptor family, including the cellular proto-oncogene c-fms, which encodes the CSF-1 receptor. CSF-1 and c-fms expression have been suggested to be involved in the modulation of neoplastic mammary epithelial cell proliferation (16) . According to Storga et al. (29) , c-fms is expressed in gastric adenocarcinomas, but the role of c-fms in gastric carcinogenesis has not been further elucidated. Theoretically, BARF1 might act as a homologue of c-fms proto-oncogene in immortalizing gastric epithelium, but additional studies concerning the role of c-fms and BARF1 in gastric carcinomas need to support this hypothesis. Only recently, Cohen and Lekstrom (30) demonstrated that BARF1 is dispensable for B-cell transformation and interacts with the cellular IFN production. However, the recombinant EBV mutant used by Cohen and Lekstrom (29) still contained the transforming domain of BARF1 (AA 1–54), which was recently determined (31) , and this might have influenced their results. As shown by the in vitro immortalizing and transforming capacities in epithelial cells (Ref. 11 ; and supported by our data in vivo), we suggest that BARF1 exerts different functions in lymphoid and epithelial cells: in the latter BARF1 might be involved in the lytic cycle, acting as an early protein, whereas in epithelial cells BARF1 has immortalizing/transforming capacities.

In this study, we found EBV in 7.6% of the gastric adenocarcinomas investigated. This is within the worldwide reported frequency of EBV-carrying gastric carcinomas, which is approximately 10% (1, 2, 3) .

In contrast to the absence of LMP1 and ZEBRA protein tested by IHC, four of nine EBV-carrying gastric carcinomas expressed EBNA1 protein using the 2B4–1 anti-EBNA1 antibody. One gastric carcinoma that did show EBNA1 protein expression tested negative in RT-PCR for EBNA1. This result might reflect nonspecific binding of this antibody, as has been described and discussed extensively recently by Cruz et al. (32) . The EBNA1 protein expression in EBV-carrying gastric adenocarcinomas has also been demonstrated previously by other groups using IHC (33 , 34) . The absence of LMP1 (either at the transcription and protein level) and the presence of BARF0 is in line with recently published data of Suguira et al. (6) . The absence of LMP1 in these carcinomas distinguishes this novel EBV latency type from the EBV latency type seen in NPCs, which is another EBV-associated epithelial malignancy. Interestingly, we also found BHRF1, the viral bcl-2 homologue, in two cases. The meaning of this remains to be determined.

In conclusion, in this study we showed that a novel EBV latency pattern in EBV-carrying gastric adenocarcinomas is present, especially characterized by BARF1 transcript expression and the absence of LMP1 (either at the RNA and protein level). BARF1 might act as the viral oncogene in the development of EBV-carrying gastric adenocarcinomas. Additional studies are needed, including the development of BARF1-specific antibodies and the application of morphological techniques like RISH and IHC. Functional assays with BARF1 are necessary to determine its role in (gastric) carcinogenesis. BARF1 might be a novel therapeutic target for EBV-carrying gastric adenocarcinomas.


    ACKNOWLEDGMENTS
 
We thank A. Groothuis and M. Vervaart for excellent technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grant VU-99-1990 from the Dutch Cancer Society. Back

2 To whom requests for reprints should be addressed, at Department of Pathology, Section Molecular Pathology, University Hospital Vrije Universiteit, P.O. Box 7057, 1007 MB Amsterdam, the Netherlands. Phone: 31-20-4440503/4023; Fax: 31-20-4442964; E-mail: vandenbrule{at}azvu.nl Back

3 The abbreviations used are: LMP2A, latent membrane protein 2A; LMP1, LMP 1; NASBA, nucleic acid sequence-based amplification; RT-PCR, reverse transcription PCR; RISH, RNA in situ hybridization; BARF1, BamH1 A rightward open reading frame; CSF, colony-stimulating factor; IHC, immunohistochemistry; NPC, nasopharyngeal carcinoma. Back

Received 10/ 8/99. Accepted 3/21/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Takano Y., Kato Y., Saegusa M., Mori S., Shiota M., Masuda M., Mikami T., Okayasu I. The role of the Epstein-Barr virus in the oncogenesis of EBV(+) gastric carcinomas. Virchows Arch., 434: 17-22, 1999.[Medline]
  2. Rowlands D. C., Ito M., Mangham D. C., Reynolds G., Herbst H., Hallissey M. T., Fielding J. W., Newbold K. M., Jones E. L., Young L. S. Epstein-Barr virus and carcinomas: rare association of the virus with gastric adenocarcinomas. Br. J. Cancer, 68: 1014-1019, 1993.[Medline]
  3. Shibata D., Weiss L. M. Epstein-Barr virus-associated gastric adenocarcinoma. Am. J. Pathol., 140: 769-774, 1992.[Abstract]
  4. Nakamura S., Ueki T., Yao T., Ueyama T., Tsuneyoshi M. Epstein-Barr virus in gastric carcinoma with lymphoid stroma. Special reference to its detection by the polymerase chain reaction and in situ hybridization in 99 tumors, including a morphologic analysis. . Cancer (Phila.), 73: 2239-2249, 1994.[Medline]
  5. Baas I. O., van Rees B. P., Musler A., Craanen M. E., Tytgat G. N., van den Berg F. M., Offerhaus G. J. Helicobacter pylori and Epstein-Barr virus infection and the p53 tumor suppressor pathway in gastric stump cancer compared with carcinoma in the non-operated stomach. J. Clin. Pathol., 51: 662-666, 1998.[Abstract]
  6. Sugiura M., Imai S., Tokunaga M., Koizumi S., Uchizawa M., Okamoto K., Osato T. Transcriptional analysis of Epstein-Barr virus gene expression in EBV-positive gastric carcinoma: unique viral latency in the tumour cells. Br. J. Cancer, 74: 625-631, 1996.[Medline]
  7. Osato T., Imai S. Epstein-Barr virus and gastric carcinoma. Semin. Cancer Biol., 7: 175-182, 1996.[Medline]
  8. Gulley M. L., Pulitzer D. R., Eagan P. A., Schneider B. G. Epstein-Barr virus infection is an early event in gastric carcinogenesis and is independent of bcl-2 expression and p53 accumulation. Hum. Pathol., 27: 20-27, 1996.[Medline]
  9. Kida Y., Miyauchi K., Takano Y. Gastric adenocarcinoma with differentiation to sarcomatous components associated with monoclonal Epstein-Barr virus infection and LMP-1 expression. Virchows Arch. A Pathol. Anat. Histopathol., 423: 383-387, 1993.[Medline]
  10. Wei M. X., Ooka T. A transforming function of the BARF1 gene encoded by Epstein-Barr virus. EMBO J., 8: 2897-2903, 1989.[Medline]
  11. Wei M. X., de Turenne-Tessier M., Decaussin G., Benet G., Ooka T. Establishment of a monkey kidney epithelial cell line with the BARF1 open reading frame from Epstein-Barr virus. Oncogene, 14: 3073-3081, 1997.[Medline]
  12. Griffin B. E., Karran L. Immortalization of monkey epithelial cells by specific fragments of Epstein-Barr virus DNA. Nature (Lond.), 309: 78-82, 1984.[Medline]
  13. Karran L., Teo C. G., King D., Hitt M. M., Gao Y. N., Wedderburn N., Griffin B. E. Establishment of immortalized primate epithelial cells with subgenomic EBV DNA. Int. J. Cancer, 45: 763-772, 1990.[Medline]
  14. Wei M. X., Moulin J. C., Decaussin G., Berger F., Ooka T. Expression and tumorigenicity of the Epstein-Barr virus BARF1 gene in human Louckes B-lymphocyte cell line. Cancer Res., 54: 1843-1848, 1994.[Abstract/Free Full Text]
  15. Strockbine L. D., Cohen J. I., Farrah T., Lyman S. D., Wagener F., DuBose R. F., Armitage R. J., Spriggs M. K. The Epstein-Barr virus BARF1 gene encodes a novel, soluble colony-stimulating factor-1 receptor. J. Virol., 72: 4015-4021, 1998.[Abstract/Free Full Text]
  16. Sapi E., Flick M. B., Gilmore-Hebert M., Rodov S., Kacinski B. M. Transcriptional regulation of the c-fms (CSF-1R) proto-oncogene in human breast carcinoma cells by glucocorticoids. Oncogene, 10: 529-542, 1995.[Medline]
  17. Hitt M. M., Allday M. J., Hara T., Karran L., Jones M. D., Busson P., Tursz T., Ernberg I., Griffin B. E. EBV gene expression in an NPC-related tumour. EMBO J., 8: 2639-2651, 1989.[Medline]
  18. Jiwa N. M., Kanavaros P., van der Valk P., Walboomers J. M., Horstman A., Vos W., Mullink H., Meijer C. J. L. M. Expression of c-myc and bcl-2 oncogene products in Reed-Sternberg cells independent of presence of Epstein-Barr virus. J. Clin. Pathol., 46: 211-217, 1993.[Abstract/Free Full Text]
  19. Oudejans J. J., Jiwa M., van den Brule A. J. C., Grässer F. A., Horstman A., Vos W., Kluin P. M., van der Valk P., Walboomers J. M., Meijer C. J. L. M. Detection of heterogeneous Epstein-Barr virus gene expression patterns within individual post-transplantation lymphoproliferative disorders. Am. J. Pathol., 147: 923-933, 1995.[Abstract]
  20. Bijl J., van Oostveen J. W., Kreike M., Rieger E., van der Raaij-Helmer L. M., Walboomers J. M., Corte G., Boncinelli E., van den Brule A. J. C., Meijer C. J. L. M. Expression of HOXC4, HOXC5, and HOXC6 in human lymphoid cell lines, leukemias, and benign and malignant lymphoid tissue. Blood, 87: 1737-1745, 1996.[Abstract/Free Full Text]
  21. Brink, A. A., Vervoort, M. B., Middeldorp, J. M., Meijer, C. J. L. M., and van den Brule, A. J. C. Nucleic acid sequence-based amplification, a new method for analysis of spliced and unspliced Epstein-Barr virus latent transcripts, and its comparison with reverse transcriptase PCR. J. Clin. Microbiol., 36: 3164–3169, 1998. (Published erratum appears in J. Clin. Microbiol., 37: 3788, 1999.)
  22. Brink A. A., Oudejans J. J., Jiwa M., Walboomers J. M., Meijer C. J., van den Brule A. J. C. Multiprimed cDNA synthesis followed by PCR is the most suitable method for Epstein-Barr virus transcript analysis in small lymphoma biopsies. Mol. Cell. Probes, 11: 39-47, 1997.[Medline]
  23. Kievits T., van Gemen B., van Strijp D., Schukkink R., Dircks M., Adriaanse H., Malek L., Sooknanan R., Lens P. NASBA isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J. Virol. Methods, 35: 273-286, 1991.[Medline]
  24. Jiwa N. M., Oudejans J. J., Dukers D. F., Vos W., Horstman A., van der Valk P., Middledorp J. M., Walboomers J. M., Meijer C. J. L. M. Immunohistochemical demonstration of different latent membrane protein-1 epitopes of Epstein-Barr virus in lymphoproliferative diseases. J. Clin. Pathol., 48: 438-442, 1995.[Abstract/Free Full Text]
  25. Grässer F. A., Murray P. G., Kremmer E., Klein K., Remberger K., Feiden W., Reynolds G., Niedobitek G., Young L. S., Mueller-Lantzsch N. Monoclonal antibodies directed against the Epstein-Barr virus-encoded nuclear antigen 1 (EBNA1): immunohistologic detection of EBNA1 in the malignant cells of Hodgkin’s disease. Blood, 84: 3792-3798, 1994.[Abstract/Free Full Text]
  26. Jiwa N. M., Kanavaros P., De Bruin P. C., van der Valk P., Horstman A., Vos W., Mullink H., Walboomers J. M., Meijer C. J. L. M. Presence of Epstein-Barr virus harbouring small and intermediate-sized cells in Hodgkin’s disease. Is there a relationship with Reed-Sternberg cells?. J. Pathol., 170: 129-136, 1993.[Medline]
  27. Sbih-Lammali F., Djennaoui D., Belaoui H., Bouguermouh A., Decaussin G., Ooka T. Transcriptional expression of Epstein-Barr virus genes and proto-oncogenes in north African nasopharyngeal carcinoma. J. Med. Virol., 49: 7-14, 1996.[Medline]
  28. Hayes D. P., Brink A. A., Vervoort M. B., Middeldorp J. M., Meijer C. J. L. M., van den Brule A. J. C. Expression of Epstein-Barr virus (EBV) transcripts encoding homologues to important human proteins in diverse EBV associated diseases. Mol. Pathol., 52: 97-103, 1999.[Abstract]
  29. Storga D., Pecina-Slaus N., Pavelic J., Pavelic Z. P., Pavelic K. c-fms is present in primary tumors as well as in their metastases in bone marrow. Int. J. Exp. Pathol., 73: 527-533, 1992.[Medline]
  30. Cohen J. I., Lekstrom K. Epstein-Barr virus BARF1 protein is dispensable for B-cell transformation and inhibits {alpha} interferon secretion from mononuclear cells. J. Virol., 73: 7627-7632, 1999.[Abstract/Free Full Text]
  31. Sheng, W., and Ooka T. Oncogene encoded by Epstein-Barr virus. Presented at the 24th International Herpesvirus Workshop, Abstract 16025, July 17–23, 1999.
  32. Cruz I., van den Brule A. J. C., Brink A. A., Snijders P. J. F., Walboomers J. M. M., van der Waal I., Meijer C. J. L. M. No direct role for Epstein-Barr Virus in oral carcinogenesis: a study at the DNA, RNA and protein levels. Int. J. Cancer, 86: 356-361, 2000.[Medline]
  33. Imai S., Koizumi S., Sugiura M., Tokunaga M., Uemura Y., Yamamoto N., Tanaka S., Sato E., Osato T. Gastric carcinoma: monoclonal epithelial malignant cells expressing Epstein-Barr virus latent infection protein. Proc. Natl. Acad. Sci. USA, 91: 9131-9135, 1994.[Abstract/Free Full Text]
  34. Murray P. G., Niedobitek G., Kremmer E., Grässer F., Reynolds G. M., Cruchley A., Williams D. M., Müller-Lantzsch N., Young L. S. In situ detection of the Epstein-Barr virus-encoded nuclear antigen 1 in oral hairy leukoplakia and virus-associated carcinomas. J. Pathol., 178: 44-47, 1996.[Medline]



This article has been cited by other articles:


Home page
J. Mol. Diagn.Home page
M. L. Gulley and W. Tang
Laboratory Assays for Epstein-Barr Virus-Related Disease
J. Mol. Diagn., July 1, 2008; 10(4): 279 - 292.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Hino, H. Uozaki, Y. Inoue, Y. Shintani, T. Ushiku, T. Sakatani, K. Takada, and M. Fukayama
Survival Advantage of EBV-Associated Gastric Carcinoma: Survivin Up-regulation by Viral Latent Membrane Protein 2A
Cancer Res., March 1, 2008; 68(5): 1427 - 1435.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
H-J Delecluse, R Feederle, B O'Sullivan, and P Taniere
Epstein Barr virus-associated tumours: an update for the attention of the working pathologist
J. Clin. Pathol., December 1, 2007; 60(12): 1358 - 1364.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. de Turenne-Tessier and T. Ooka
Post-translational modifications of Epstein Barr virus BARF1 oncogene-encoded polypeptide
J. Gen. Virol., October 1, 2007; 88(10): 2656 - 2661.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
K. Houali, X. Wang, Y. Shimizu, D. Djennaoui, J. Nicholls, S. Fiorini, A. Bouguermouh, and T. Ooka
A New Diagnostic Marker for Secreted Epstein-Barr Virus Encoded LMP1 and BARF1 Oncoproteins in the Serum and Saliva of Patients with Nasopharyngeal Carcinoma
Clin. Cancer Res., September 1, 2007; 13(17): 4993 - 5000.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Microbiol.Home page
S. J. C. Stevens, S. A. W. M. Verkuijlen, B. Hariwiyanto, Harijadi, J. Fachiroh, D. K. Paramita, I. B. Tan, S. M. Haryana, and J. M. Middeldorp
Diagnostic Value of Measuring Epstein-Barr Virus (EBV) DNA Load and Carcinoma-Specific Viral mRNA in Relation to Anti-EBV Immunoglobulin A (IgA) and IgG Antibody Levels in Blood of Nasopharyngeal Carcinoma Patients from Indonesia
J. Clin. Microbiol., July 1, 2005; 43(7): 3066 - 3073.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
A zur Hausen, B P van Rees, J van Beek, M E Craanen, E Bloemena, G J A Offerhaus, C J L M Meijer, and A J C van den Brule
Epstein-Barr virus in gastric carcinomas and gastric stump carcinomas: a late event in gastric carcinogenesis
J. Clin. Pathol., May 1, 2004; 57(5): 487 - 491.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. van Beek, A. zur Hausen, E. Klein Kranenbarg, C. J.H. van de Velde, J. M. Middeldorp, A. J.C. van den Brule, C. J.L.M. Meijer, and E. Bloemena
EBV-Positive Gastric Adenocarcinomas: A Distinct Clinicopathologic Entity With a Low Frequency of Lymph Node Involvement
J. Clin. Oncol., February 15, 2004; 22(4): 664 - 670.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. zur Hausen, J. van Beek, E. Bloemena, F. J. ten Kate, C. J. L. M. Meijer, and A. J. C. van den Brule
No role for Epstein-Barr virus in Dutch hepatocellular carcinoma: a study at the DNA, RNA and protein levels
J. Gen. Virol., July 1, 2003; 84(7): 1863 - 1869.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. P. van Rees, E. Caspers, A. zur Hausen, A. van den Brule, P. Drillenburg, M. A. J. Weterman, and G. J. A. Offerhaus
Different Pattern of Allelic Loss in Epstein-Barr Virus-Positive Gastric Cancer with Emphasis on the p53 Tumor Suppressor Pathway
Am. J. Pathol., October 1, 2002; 161(4): 1207 - 1213.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
Q N Vo, J Geradts, M L Gulley, D A Boudreau, J C Bravo, and B G Schneider
Epstein-Barr virus in gastric adenocarcinomas: association with ethnicity and CDKN2A promoter methylation
J. Clin. Pathol., September 1, 2002; 55(9): 669 - 675.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
M. L. Gulley
Molecular Diagnosis of Epstein-Barr Virus-Related Diseases
J. Mol. Diagn., February 1, 2001; 3(1): 1 - 10.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
G. Winberg, L. Matskova, F. Chen, P. Plant, D. Rotin, G. Gish, R. Ingham, I. Ernberg, and T. Pawson
Latent Membrane Protein 2A of Epstein-Barr Virus Binds WW Domain E3 Protein-Ubiquitin Ligases That Ubiquitinate B-Cell Tyrosine Kinases
Mol. Cell. Biol., November 15, 2000; 20(22): 8526 - 8535.
[Abstract] [Full Text]


Home page
Mol. Pathol.Home page
K Takada
Epstein-Barr virus and gastric carcinoma
Mol. Pathol., October 1, 2000; 53(5): 255 - 261.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hausen, A. z.
Right arrow Articles by van den Brule, A. J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hausen, A. z.
Right arrow Articles by van den Brule, A. J. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online