| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Sir Albert Sakzewski Virus Research Centre, Clinical Medical Virology Centre, University of Queensland, Royal Children’s Hospital, Herston, Queensland 4029, Australia [T. D., K. A. H., M. D. S., R. W. T.]; McArdle Laboratory for Cancer Research, University of Wisconsin Medical School, Madison, Wisconsin 53706 [P. F. L.]; and Centre for Immunology and Cancer Research University of Queensland, Princess Alexandra Hospital, Brisbane, Queensland 4102, Australia [G. J. P. F.]
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Transgenic mice that express the HPV16 E7 oncogene driven off a K14 promoter only in basal or suprabasal epithelial cells display epithelial hyperplasia and dysplasia with a propensity to papillomatosis and squamous cell carcinoma (5) . These mice provide a model for E7-mediated epithelial cell transformation in humans (6) . Additionally, they allow investigation of the presentation of the E7 oncoprotein expressed uniquely in epithelium to the immune system, and the subsequent immunological outcome. We have reported that E7 expression in keratinocytes is sufficient to peripherally tolerize the E7-directed pCTL repertoire, measured as diminished CTL responses in vitro following specific immunization (7 , 8) . Furthermore, specific immunization of E7 transgenic mice failed to prevent or control E7-associated tumor development, as it did in non-E7 transgenic control mice.
On the basis of these observations, the possibility arises that in cervical carcinoma patients, chronic expression of E7 in transformed cervical epithelial cells during the life of the tumor serves to functionally tolerize E7-directed pCTLs. Indeed, patients with HPV16-associated cervical carcinoma make poor E7-directed CTL responses either to endogenously expressed E7 (9) or following E7 immunization (3) . Thus, the challenge for immunotherapy for cervical cancer may become how to circumvent tolerance to generate an E7-directed CTL response effective in the control of E7-expressing cells.
In the present study, we use the K14-driven E7 transgenic mouse system to further investigate cognate pCTL tolerance induced by E7 expression in peripheral epithelium. We show that E7 is "cross-presented" to the immune system for specific pCTL tolerization by antigen-presenting cells of bone marrow origin. We also show that pCTL tolerization can be induced within 2 weeks of exposure to E7 in epithelial cells and that it can occur in the presence of a coexisting E7-directed Th2-type antibody response. We demonstrate that E7-directed pCTL peripheral tolerance is largely independent of CD4+ T cells and does not require the persistence of the thymus. We show that immunization with peptide-pulsed DCs is sufficient to overcome tolerance and generate E7-directed CTL responses in E7 transgenic mice equivalent to those seen in non-E7 transgenic controls. These results are relevant to the understanding of the immunological consequences of epithelial E7 expression and have implications for the formulation of therapeutic vaccine strategies for cervical dysplasia/neoplasia that target the E7 oncoprotein.
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
Radiation Chimeras.
Radiation chimeras were made as described (8)
. To derive
mice that expressed E7 in peripheral epithelium and A*0201 only in
cells of bone marrow origin, KC57 mice were immunologically ablated by
thymectomy, lethal irradiation, and administration of Thy1-depleting
antibody. These mice were reconstituted with bone marrow cells depleted
of CD4+, CD8+, and
Thy1+ cells from KA(E7+) mouse donors, which were
made to mature through a FA(E7-) neonatal thymus implant under the
kidney capsule. Hematopoietic reconstitution with cells containing the
A2.1Kb transgene was confirmed 12–15 weeks later
by PCR of DNA derived from spleen cells using A*0201 (A2.1)-specific
primers HLA A Ex2 5'
149GTGGATAGAGCAGGAGGGGT167,
HLA A Ex3 5'
110CCAAGAGCGCAGGTCCTCT128.
CD4+ cell and CD8+ cell
reconstitution were confirmed as described (8)
. These mice
are denoted KA
KC57(FA) mice. Control chimeras that expressed A*0201
in both epithelium and the bone marrow compartment were made by
reconstituting immunologically ablated KA mice with KA-derived bone
marrow matured through a FA thymus implant [denoted KAKA(FA)
mice]. KA-, FA-, and KC57- "sham" control mice underwent surgical
manipulation without cell/organ transfers.
KAKA(FA) mice have the phenotype E7+ive epithelium, A*0201+ive
epithelium, A*0201+ive bone marrow-derived cells. KAKC57(FA) mice
have the phenotype E7+ive epithelium, A*0201-ive epithelium,
A*0201+ive bone marrow-derived cells
Cells.
EL4.A2 cells are susceptible to specific CTL lysis through both
H-2b and A*0201 pathways and were
maintained as described (8)
.
Peptides and Epitopes.
Peptides containing H-2b- and HLA
A*0201-restricted CTL epitopes of HPV16 E7
[49RAHYNIVTF57
(11)
and
82LLMGTLGIV90
(10)
, respectively], and HLA A*0201-restricted CTL
epitope of influenza matrix protein
(58GILGFVFTL66; Ref.
12
) were synthesized and used as described
(8)
.
Immunizations.
For induction of Th1 responses (CTL and IFN-
secretion),
groups of three mice were immunized once with 50 µg of an equimolar
peptide mixture of CTL epitopes, 10 µg of Quil A adjuvant, and 2.5
µg of tetanus toxoid (CSL, Melbourne, Australia) as a source
of T-helper epitope(s) in 100 µl of PBS, s.c. at the base of the
tail. Ten days later, splenocytes were harvested and either
restimulated in vitro for 6 days in the presence of 1
µg/ml of individual peptide prior to inclusion in CTL assays or set
up in ELISPOT assays. For induction of Th2-type antibody responses,
groups of three mice were immunized s.c. with 100 µg of HPV16 E7-GST
fusion protein in algammulin adjuvant.
CTL and ELISA Assays.
51Chromium-release CTL assays and antibody ELISA
assays were conducted as described previously (13)
.
IFN- ELISPOT.
Cells secreting IFN- in an antigen-specific manner were detected
using the ELISPOT assay (14)
. In brief, splenocytes from
immunized mice were incubated overnight in the presence of cognate
peptide, in nitrocellulose microtiter plate wells coated with anti
IFN- antibody (PharMingen). After removal of cells and extensive
washing, the wells were reacted with biotin-conjugated anti-IFN-
detection antibody (PharMingen) and developed with avidin-horseradish
peroxidase (Sigma) and metal-enhanced diaminobenzidine
substrate (Sigma). Controls included spleen cells from irrelevantly
immunized mice, and incubation in the absence of cognate peptide.
Adoptive Transfer of Spleen Cells.
Recipient mice (three per group) were whole-body lethally irradiated
(1000 rad) and reconstituted the same day with 5 x 107-108 splenocytes from
donor mice, injected into the surgically exposed spleen. Sham control
mice were not irradiated and underwent surgical procedure without
splenocyte transfer. Fourteen days later, the mice were immunized for
specific CTL response induction with a peptide mixture containing
E7/A*0201, E7/H-2b, and influenza matrix/A*0201
epitopes. Splenocytes from immunized mice were restimulated in
vitro 10 days later with individual peptides, and CTL assays were
conducted as described.
CD4+ive T-Cell Depletion.
Mice were depleted of CD4+ T cells as described
(8)
. This regimen provided >95%
CD4+ cell depletion from at least day 15 (the
earliest time point tested) until the end of the experiment as
confirmed by fluorescence-activated cell-sorting analysis on peripheral
blood mononuclear cells conducted at intervals (8)
.
Immunization with DCs.
DCs were prepared from KA(E7+) mouse bone marrow (femur and tibia).
Briefly, erythrocytes were removed by lysis with ammonium chloride, and
then lymphocytes, granulocytes, and Ia+ cells
were depleted with monoclonal antibodies and a magnetic cell
sorter (MACS), according to manufacturer’s instructions. The
monoclonal antibodies were as follows: 2.43, anti-CD8; GK1.5, anti-CD4;
RA3/3A1/6.1, anti-B220/CD45R; and B21-2, anti-Ia. DC progenitors were
cultured to maturity with granulocyte macrophage colony-stimulating
factor and interleukin-4 (10 ng/ml each) in DMEM containing 10%
FBS for 8–10 days. DCs were washed and resuspended in DMEM containing
10% FBS (2.5 x 106/0.1 ml)
containing 1 µg of peptide (an equimolar mix of E7/A*0201 and
E7/H-2b epitopes) and incubated at 37°C for 60
min. (We determined that a sample of washed, E7 peptide-pulsed DCs did
in fact bear E7 peptide on their surface by showing that they could be
specifically lysed by splenocytes from E7 peptide-immunized mice.)
Experimental mice were then immunized i.v. with 5 x 10 5 peptide-pulsed or nonpulsed DCs. After 3 weeks, spleens were removed. Splenocytes were depleted of APCs as described (15) . APC-depleted splenocytes (2 x 106/ml) were restimulated with E7-expressing EL4.E7 cells (2 x 105/ml; Ref. 8 ) in 6-well culture plates for 6 days, and then used in CTL assay. (This procedure was used in preference to peptide stimulation in the presence of APCs because the latter might recall FBS-directed CTLs primed by powerful presentation of the injected DCs that had been grown in FBS-containing medium.)
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
KC57(FA) mice, which express
A*0201 in bone marrow-derived cells but not in epithelium, and
KAKA(FA) mice, which express A*0201 in bone marrow-derived cells and
epithelium (Fig. 1A
), were immunized twice with an equimolar mix of peptides
containing E7/A*0201, influenza/A*0201, and
E7/H-2b peptide epitopes. Ten days later,
E7-directed activated T-cells were detected in a IFN- release assay
(ELISPOT; Fig. 1B
) and quantified by calculation of
frequency of IFN--secreting cells. KAKC57(FA) mice were
adequately reconstituted for A*0201-restricted responses as evidenced
by their capacity to mount influenza-specific responses comparable to
FA(E7-) and KA(E7+) control mice (Fig. 1B
,
photographs 1, 4, and 7). The
frequency (x 10-4) of A*0201-restricted
E7-directed IFN- secreting cells in splenocytes of KAKC57(FA)
mice that expressed E7 but not A*0201 in skin was significantly
down-regulated compared with non-E7 transgenic FA(E7-) mice [Fig. 1B
, photographs 2 and 5; frequency (x
10-4), 0.05 versus 3.49;
2 =3.4; P < 0.1].
The frequency was similar to the expected down-regulated responses
observed in KAKA(FA) mice [Fig. 1B
, photographs
2 and 11; frequency (x10-4),
0.05 versus 0.04; 2 = 0.0004; not significant] and KA mice [Fig. 1B
,
photographs 2 and 8; frequency
(x10-4), 0.05 versus 0.17;
2 = 0.065; not significant], both
of which express E7 and A*0201 in skin. Responses to the
E7/H-2b epitope, included as an internal control,
were down-regulated in all groups of mice expressing both E7 and
H-2b in skin (not shown), as expected from our
previous studies (7
, 8)
. These data show that
down-regulation of the E7-directed T-cell response to the
E7/A*0201-restricted epitope occurs in mice expressing E7 but not
A*0201 in skin, and they are consistent with the notion that bone
marrow-derived A*0201+ APCs sampled E7 from
epithelial cells for presentation to bone marrow-derived E7-specific
A*0201 T cells for cross-tolerization.
|
irradKA(r). Fourteen days later, the mice were immunized for
CTL responses to the E7/A*0201, E7/H-2b, and
influenza matrix/A*0201 epitopes. In experiments repeated several
times, irradiated FA(E7-) control mice receiving FA splenocytes
[denoted FA(d)irradFA(r)] had restored responses to the influenza
matrix epitope and to both E7 epitopes (Table 1)
. In contrast, FA(d)irradKA(r) mice had restored CTL responses to
the influenza matrix epitope, but had no detectable CTL responses to
either of the E7 epitopes. As expected, KA donor splenocytes (already
tolerized to E7 epitopes; Ref. 7
) restored influenza
matrix CTL responses to irradiated KA(E7+) recipient mice [denoted
KA(d)irradKA(r)] but not CTL responses to either of the E7
epitopes. Together these data indicate that naïve E7 pCTL were
tolerized within 14 days of exposure to the E7-expressing epithelial
environment of KA(E7+) mice.
|
irradFA(r)] but not CTL responses to either of the E7 epitopes
(Table 1)
. This result indicates that E7-directed tolerance persists in
peripheral CTLs for at least 14 days after removal of the E7-expressing
tolerizing epithelial environment.
E7-directed CTL Tolerance Persists in the Near Absence of CD4+ive
Cells.
We wished to ask whether a CD4+ T-cell population
was necessary for the persistence of E7-directed pCTL tolerance
observed in specifically immunized mice expressing E7 in skin
keratinocytes. KA(E7+) mice were depleted of CD4+
T cells, and depletion was maintained for at least 15 days prior to
immunization for CTL response induction with a mixture of peptides
containing the E7/A*0201, E7/H-2b, and influenza
matrix/A*0201 CTL epitopes. Sham depleted KA(E7+) and FA(E7-) control
mice were similarly immunized. Depletion removed >95% of
CD4+ cells (Fig. 2I
).
|
, IB and
IC). The E7-directed CTL responses in CD4-depleted KA(E7+)
mice were down-regulated and comparable to those seen in KA(E7+) sham
mice (Fig. 2
, IA and IB) This result indicates
that the presence of a major peripheral CD4+
T-cell population is not required for the persistence of E7-directed
CTL tolerance observed in mice that express E7 in epithelium.
E7-directed CTL Tolerance Occurs in the Presence of a Coexistent
Th2-Type Antibody Response to E7.
To inquire whether E7-directed pCTL tolerance is influenced by the
presence of a concomitant Th2-type E7 antibody response, groups of
KA(E7+) mice were immunized for antibody with E7 in algammulin adjuvant
before (Fig. 2
, IIA), concurrent with (Fig. 2
,
IIB), or after (Fig. 2
, IIC) immunization for
CTLs with E7 minimal CTL epitope RAHYNIVTF in Quil A adjuvant. [In
general, immunization with protein/peptide antigen in algammulin
induces an antibody response with a predominant Th2 (IgG1) component
but no measurable CTLs].
Regardless of whether KA(E7+) mice had an E7 antibody response or not
at the time of immunization for CTLs, they maintained a down-regulated
E7-directed CTL response (Fig. 2
, IIA) compared with
FA(E7-) mice (Fig. 2
, IID). Similarly, KA(E7+) mice
immunized for E7 antibody at the same time as immunization for E7 CTLs
displayed down-regulated E7 CTL responses (Fig. 2
, IIB), as
did KA(E7+) mice immunized first for E7 CTL induction and later for E7
antibody (Fig. 2
, IIC).
Together these data indicate that maintenance of E7-directed pCTL tolerance occurs in the presence of a coexisting Th2-type antibody response to E7.
Thymus Is Not Necessary for Maintenance of E7-directed CTL
Tolerance.
We have excluded the possibility that E7-directed pCTL tolerance is due
to "central" (i.e., thymus-mediated) rather than
"peripheral" (i.e., skin epithelium-mediated)
tolerization (7)
. It has been suggested, however, that the
distinction between central (thymic) T-cell tolerance and peripheral
T-cell tolerance is not absolute and that intrathymic generation and
release to the periphery of cognate immunoregulatory T cells during
adult life may contribute to the maintenance of self-tolerance to
peripheral antigens (16)
. We wished to ask whether the
maintenance (in contrast to the induction) of peripheral
tolerance to E7 antigen in KA(E7+) mice was dependent on the continued
presence of the thymus.
Neonatally thymectomized KA(E7+) mice and controls were immunized at
8–10 weeks for CTL response induction with a mixture of peptides
containing the E7/A*0201, E7/H-2b, and influenza
matrix/A*0201 CTL epitopes. These mice displayed down-regulation of
E7-directed CTL responses similar to that in sham-thymectomized
KA(E7+) controls and unlike the nontolerized E7-directed responses
displayed by non-E7 transgenic thymectomized or sham-thymectomized
FA(E7-) mice (Fig. 2
III). Responses to the irrelevant
influenza epitope were comparable in all groups of mice, indicating
that neonatal thymectomy did not adversely affect generically the
capacity to mount CTL responses. These data indicate that the
presence of a thymus in adult life is not necessary for the maintenance
of E7-directed pCTL tolerance in mice expressing E7 in peripheral
epithelium.
Immunization with E7 Peptide-pulsed DCs Overcomes E7-directed
CTL Tolerance.
In view of the potent antigen-presenting capacities of DCs, we asked
whether immunization of KA(E7+) mice with DCs pulsed with E7 CTL
peptides would overcome the down-regulated E7-directed CTL responses
observed when KA(E7+) mice were immunized with peptide plus adjuvant.
Restimulated splenocytes from KA(E7+) mice immunized with E7
peptide-pulsed DCs, but not DCs alone, specifically killed EL4.E7
target cells with comparable efficiency to splenocytes from identically
immunized FA(E7-) mice (Fig. 3 and B
) and also to splenocytes from FA(E7-)
mice immunized with E7 peptides in Quil A adjuvant (Fig. 3 and C
). These data indicate that E7 CTL
responses similar to those seen in immunized non-E7 transgenic
(i.e., not tolerant to E7) mice can be induced in mice
expressing E7 in skin (i.e., tolerant to E7), by
immunization with DCs presenting E7 CTL epitope.
|
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
We report that E7 pCTLs recognizing an A*0201-restricted CTL epitope were down-regulated in mice in which A*0201 was expressed solely on cells of bone marrow origin and not on E7-expressing keratinocytes. Because bone marrow-derived cells do not express E7 in this K14 promoter-driven system (reverse transcription-PCR; Ref. 8 ) and therefore cannot present putative endogenous E7 to pCTLs (7) , the data in the present study indicate that E7 in keratinocytes was accessed by bone marrow-derived APCs for processing and presentation to bone marrow-derived E7-directed pCTLs through the A*0201 pathway. These data are in agreement with a prevailing view that peripherally expressed antigens are "sampled" from the periphery by APCs that present processed antigen to specific T cells in the lymph node for activation (i.e., cross-priming) or tolerization (i.e., cross-tolerance; Ref. 19 ). Although the determinants of whether pCTLs are tolerized, (as reported here), remain ignorant (naïve), or are activated in response to neo-antigen are not fully understood, the amount of antigen and its location clearly play significant roles. We previously have argued that the E7-directed peripheral CTL tolerance seen in KA(E7+) mice but not in other lines of transgenic mice expressing E7 in squamous epithelium (e.g., Ref. 18 ) is likely due to higher levels of E7 expression in KA(E7+) mice (7) . Our data do not preclude a role for direct presentation of E7 to the immune system by keratinocytes in addition to the presentation by cells of bone marrow derivation reported here. Processed self-peptides presented at the keratinocyte surface in the context of MHC class 1 but in the absence of appropriate second signal molecules (B7.1/CD28, CTLA) may anergize cognate T cells (20) .
Our results indicate that tolerization of naïve E7-directed pCTLs occurs within 14 days of exposure to the E7-expressing epithelial environment, in agreement with findings for epithelially expressed antigens in other systems (21) . We report that E7 pCTL tolerance persisted after a >95% reduction in CD4+ cells. Our data thus suggest that maintenance of tolerance is independent of the availability of CD4+ cognate help. The possibility remains that CD4+ T-cell depletion removed tolerance but did not return the E7-directed CTL response to normal levels if stimulation (as opposed to tolerization) of E7-specific CTLs required CD4+ T-cell help. This is unlikely, however, because it has been shown that peptide-generated E7-specific CTLs are CD4+ T-cell help independent (i.e., CD4+ cells neither enhanced nor suppressed anti-E7 CTL activity in nontolerized mice; Ref. 22 ). Kurts et al. (23) have shown that provision of OVA-specific CD4+ helper T-cells impaired peripheral CTL tolerance by preventing OVA-specific CD8+ CTL deletion in mice expressing an OVA transgene as a cell membrane-associated protein in pancreatic islets. This suggests a regulatory role for CD4+ cells. The location (pancreas versus epithelium), antigen availability (membrane-bound versus nucleo-cytoplasmic), and numbers of cognate T cells (high versus low) are likely to play roles in the apparent difference between the OVA transgenic system and ours with regard to the effect of CD4+ cells on the maintenance of CTL tolerance.
We asked whether E7-directed pCTL tolerance was influenced by the presence of a concomitant E7-directed antibody response. We show that induction of a Th2-type antibody response either before, concurrent with, or after immunization for CTLs did not modify the down-regulated state of E7 pCTLs in mice expressing E7 constitutively in epithelium.
We have shown in our previous studies (7) that the induction of E7-directed CTL tolerance observed in KA mice is not due to central tolerization by the concomitant expression of E7 in thymic cortical epithelium that occurs in these mice. (Expression of antigen in thymic cortical epithelium transmits a positive, rather than a negative, T-cell selection signal; Ref. 24 ). In the present study, we demonstrate that E7-directed pCTL tolerance persisted in adult KA(E7+) mice thymectomized at birth, indicating that the continued presence of a thymus in adult life is not necessary for the maintenance of E7-directed CTL tolerance. These data suggest that intrathymic generation and release to the periphery of cognate immunoregulatory T-cells as reported in other systems (e.g., Ref. 16 ) does not contribute substantially to the maintenance of peripheral tolerance in mice expressing E7 in the skin. It also suggests that a putative accessing of E7 in thymic cortical epithelium by E7-directed pCTLs or APCs in adult life does not contribute to the maintenance of peripheral tolerance.
By immunizing E7-tolerant (E7 transgenic) mice with DCs pulsed with E7 peptide, we generated CTL responses approaching in magnitude those seen in nontolerant (non-E7 transgenic) mice. Reversal of tolerance to a tumor antigen by DC immunization has been observed in MUC-1 carcinoma transgenic mice (25) . It is not clear from our studies why presentation of epitopes derived from endogenous E7 in skin induces CTL tolerance, whereas presentation of the same epitopes by pulsed DCs used for immunization induces CTL activation. Toes et al. (26) have reported that administration of a given peptide in adjuvant to the immune system may be tolerogenic, whereas administration of the same peptide pulsed onto DCs is stimulatory; together with our result, this emphasizes the importance of the mode of epitope delivery in determining the balance of T-cell tolerization and activation. Reduction in growth of a challenge dose of E7-expressing tumor, but not control tumor, obtained by prior immunization of mice with DCs pulsed with the E7 CTL epitope has been reported (27) .
We argue from our animal models that the chronic expression of E7 in transformed epithelial cells of women with progressive HPV-associated cervical disease may serve to functionally tolerize E7-directed pCTLs in the periphery. The challenge for immunotherapy for cervical cancer becomes how to vaccinate to circumvent E7-directed CTL tolerance. Vaccines comprising DCs presenting cognate antigen have been efficacious in eliciting CTL responses in human clinical trials. Induction of HPV16 E7-specific, A*0201-restricted CTLs by E7-pulsed autologous DCs in patients with HPV-associated cervical cancer recently has been demonstrated (28) , suggesting the validity of the DC approach to the derivation of a therapeutic vaccine for cervical cancer.
Other vaccine strategies known to enhance E7-directed CTLs, e.g., intracellular rerouting of E7 into the MHC class 11 compartment using E7-DNA vaccine encoding the lysosomal-associated membrane protein sorting signal, may be similarly effective in surmounting E7-directed tolerance (29 , 30) . DCs expressing Sig/E7/lysosomal-associated membrane protein induce E7-directed CTLs in immunized mice (30) .
|
Acknowledgments |
|---|
|
FOOTNOTES |
|---|
1 This work was supported by the National Health
and Medical Research Council of Australia, Queensland Cancer Fund, and
the Royal Children’s Hospital Foundation. Contribution No. 118
of the Sir Albert Sakzewski Virus Research Center. 
2 To whom requests for reprints should be
addressed, at Sir Albert Sakzewski Virus Research Centre, Royal
Children’s Hospital, Herston Road, Herston, Qld 4029, Australia.
Phone: 61 7 3636 8716; Fax: 61 7 3636 1401; E-mail: r.tindle{at}mailbox.uq.edu.au
3 The abbreviations used are: HPV16, human
papillomavirus 16; K14, keratin-14; pCTL, CTL precursor; DC, dendritic
cell; FBS, fetal bovine serum; APC, antigen-presenting cell; OVA,
ovalbumin.
Received 11/24/99. Accepted 4/11/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  K. Devaraj, M. L. Gillison, and T.-C. Wu DEVELOPMENT OF HPV VACCINES FOR HPV-ASSOCIATED HEAD AND NECK SQUAMOUS CELL CARCINOMA Critical Reviews in Oral Biology & Medicine, September 1, 2003; 14(5): 345 - 362. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. J. Powell Jr., L. C. Eisenlohr, and J. L. Rothstein A Thyroid Tumor-Specific Antigen Formed by the Fusion of Two Self Proteins J. Immunol., January 15, 2003; 170(2): 861 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. H. Frazer, R. D. Kluyver, G. R. Leggatt, H. Yang Guo, L. Dunn, O. White, C. Harris, A. Liem, and P. Lambert Tolerance or Immunity to a Tumor Antigen Expressed in Somatic Cells Can Be Determined by Systemic Proinflammatory Signals at the Time of First Antigen Exposure J. Immunol., December 1, 2001; 167(11): 6180 - 6187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Sotomayor, I. Borrello, F.-M. Rattis, A. G. Cuenca, J. Abrams, K. Staveley-O'Carroll, and H. I. Levitsky Cross-presentation of tumor antigens by bone marrow-derived antigen-presenting cells is the dominant mechanism in the induction of T-cell tolerance during B-cell lymphoma progression Blood, August 15, 2001; 98(4): 1070 - 1077. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Tindle, K. Herd, T. Doan, G. Bryson, G. R. Leggatt, P. Lambert, I. H. Frazer, and M. Street Nonspecific Down-Regulation of CD8+ T-Cell Responses in Mice Expressing Human Papillomavirus Type 16 E7 Oncoprotein from the Keratin-14 Promoter J. Virol., July 1, 2001; 75(13): 5985 - 5997. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Ferlazzo, C. Semino, G. M. Spaggiari, M. Meta, M. C. Mingari, and G. Melioli Dendritic cells efficiently cross-prime HLA class I-restricted cytolytic T lymphocytes when pulsed with both apoptotic and necrotic cells but not with soluble cell-derived lysates Int. Immunol., December 1, 2000; 12(12): 1741 - 1747. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
-1 and
), E7/H-2b (
), and
influenza matrix/A*0201 (
) epitopes. Spleen cells were restimulated
with individual peptides in vitro, and CTL assays were
conducted. CD4 depletion is shown in insets. Targets
were EL4.A2 cells pulsed with individual peptides. II,
E7-directed pCTL tolerance persists in the presence of a Th2-type E7
antibody response. KA(E7+) mice were immunized with E7.GST in
algammulin or algammulin alone (filled arrows) before
(A), concurrent with (B), or after
(C) immunization with E7/H-2b epitope
(RAHYNIVTF) in Quil A adjuvant (open arrows). Serum was
taken at day 31 (group A) or day 55 (groups B and C) for ELISA, and
splenocytes were harvested for in vitro restimulation
and CTL assay as indicated (CTL). ELISA reactivity to E7
B-epitope is shown in insets (open
symbols, mice immunized with algammulin alone; closed
symbols, mice immunized with E7.GST/algammulin). CTL responses
of splenocytes from mouse groups A, B, and C (A–C), and
of FA(E7-) mice immunized with E7/H-2b peptide
(RAHYNIVTF) in Quil A (D) are shown in
the panels. Splenocytes were restimulated in
vitro with E7/H-2b peptide and reacted against EL4
target cells pulsed with E7/H-2b peptide or expressing the
E7 gene (EL4.E7). III, CTL responses of
splenocytes from neonatally thymectomized (Tx;
A and C) and sham neonatally
thymectomized (Sh-Tx; B and
D) KA(E7+) and FA(E7-) mice (three per group). Mice
were immunized with a mixture of peptides containing E7/A*0201 (