Cancer Research Prevention Award  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mach, N.
Right arrow Articles by Dranoff, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mach, N.
Right arrow Articles by Dranoff, G.
[Cancer Research 60, 3239-3246, June 15, 2000]
© 2000 American Association for Cancer Research


Immunology

Differences in Dendritic Cells Stimulated in Vivo by Tumors Engineered to Secrete Granulocyte-Macrophage Colony-stimulating Factor or Flt3-Ligand1

Nicolas Mach2, Silke Gillessen2, S. Brian Wilson, Christine Sheehan, Martin Mihm and Glenn Dranoff3

Departments of Adult Oncology [N. M., S. G., G. D.] and Cancer Immunology and AIDS [S. B. W.], Dana-Farber Cancer Institute, and Department of Medicine [N. M., S. G., G. D.], Harvard Medical School, Boston, Massachusetts 02115; Department of Pathology and Laboratory Medicine, Albany Medical College, Albany, New York 12208 [C. S.]; and Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts 02114 [M. M.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Both granulocyte-macrophage colony-stimulating factor (GM-CSF) and flt3-ligand (FL) induce the development of dendritic cells (DCs). To compare the functional properties of DCs stimulated by these cytokines in vivo, we used retroviral-mediated gene transfer to generate murine tumor cells secreting high levels of each molecule. Injection of tumor cells expressing either GM-CSF or FL resulted in the dramatic increase of CD11c+ cells in the spleen and tumor infiltrate. However, vaccination with irradiated, GM-CSF-secreting tumor cells stimulated more potent antitumor immunity than vaccination with irradiated, FL-secreting tumor cells. The superior antitumor immunity elicited by GM-CSF involved a broad T cell cytokine response, in contrast to the limited Th1 response elicited by FL. DCs generated by GM-CSF were CD8{alpha}- and expressed higher levels of B7–1 and CD1d than DCs cells generated by FL. Injection sites of metastatic melanoma patients vaccinated with irradiated, autologous tumor cells engineered to secrete GM-CSF demonstrated similar, dense infiltrates of DCs expressing high levels of B7–1. These findings reveal critical differences in the abilities of GM-CSF and FL to enhance the function of DCs in vivo and have important implications for the crafting of tumor vaccines.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
There is compelling evidence that DCs4 play a decisive role in the priming of immune responses (1) . DCs acquire antigens in peripheral tissues and migrate to organized lymphoid structures to stimulate antigen-specific CD4- and CD8-positive T lymphocytes and B cells. DCs are specialized to initiate immunity because of their abilities to process antigens efficiently into both MHC class I and II pathways and their high level expression of costimulatory molecules (2) .

The central importance of DCs in priming immune responses has generated substantial interest in manipulating these cells for the induction of antitumor immunity. The development of in vitro methods to propagate large numbers of DCs from hemopoietic progenitors (3, 4, 5, 6) has led to several studies that indicate that DCs can dramatically enhance antitumor immunity (7) . DCs pulsed with tumor antigen-derived peptides or whole tumor cell lysates and DCs genetically modified to express tumor antigens elicit striking antitumor effects in murine model systems (8, 9, 10, 11) . Initial clinical testing of DC-based vaccines has revealed the induction of tumor destruction in cancer patients as well, although the underlying effector mechanisms remain to be clarified (12 , 13) .

In contrast to these cancer vaccination strategies that involve the ex vivo manipulation of DCs, other approaches attempt to enhance DC function in vivo. The systemic administration of recombinant FL protein results in the marked expansion of both myeloid- and lymphoid-type DCs in many tissues (14, 15, 16, 17) and induces impressive antitumor effects in several murine models (18 , 19) . Tumor cells engineered to secrete FL also demonstrate reduced tumorigenicity (20) . These studies suggest that DCs can infiltrate implanted tumors and initiate processing of tumor antigens; however, nonspecific mechanisms are induced by FL as well, because antitumor effects are only partially compromised in SCID mice (18) .

We have demonstrated that vaccination with irradiated tumor cells engineered to secrete GM-CSF stimulates potent, specific, and long-lasting antitumor immunity in multiple murine tumor models (21) . Recently, we have extended these findings to patients with metastatic melanoma; as a consequence of vaccination, patients consistently develop intense CD4- and CD8-positive T lymphocyte and plasma cell infiltrates in metastatic lesions (22) . These reactions result in extensive tumor necrosis, fibrosis, and edema. Pathological analysis of the vaccination sites reveals a dense infiltrate of DCs, macrophages, eosinophils, and T lymphocytes in the dermis and s.c. tissues.

The abilities of several vaccination strategies involving DCs to enhance antitumor immunity raises the intriguing question of whether distinct or overlapping mechanisms underly the various approaches. To begin to address this issue, we used the poorly immunogenic B16 melanoma model to compare the effects of GM-CSF and FL on DC function and the concomitant induction of antitumor immunity. Although B16 cells engineered to secrete either cytokine stimulated the marked expansion of CD11c+ DCs both locally and systemically, GM-CSF-expressing cells were more effective in eliciting systemic antitumor immunity. The superior vaccination activity triggered by GM-CSF involved the high level expression of B7–1 and CD1d on CD8{alpha}- DCs.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mice.
Adult female C57Bl/6 and BALB/c mice, 8–12 weeks of age, were purchased from Taconic Farms Inc. (Germantown, NY). All mouse experiments were approved by the AAALAC-accredited Dana-Farber Cancer Institute IACUC.

Recombinant Retroviruses.
Total RNA was obtained from C57Bl/6 spleens using TRIZOL (Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s instructions. cDNA was synthesized using oligo-dT primers and MMLV reverse transcriptase (Life Technologies, Inc.). A PCR was performed to obtain cDNA encoding murine FL. The primers used were: sense strand 5' CATATCATGACAGTGCTGGCGCCAGCC and antisense strand 5' GTAAGGATCCTAGGGATGGGAGGGGAGG, derived from the published sequence (23) . The sense strand primer incorporates a BspHI restriction site upstream of the initiator ATG, and the antisense primer incorporates a BamHI restriction site downstream of the termination codon. The conditions of the PCR were: 30 cycles of 96°C for 30 s, 50°C for 50 s, and 72°C for 3 min. The 711-bp amplified fragment was sequenced to confirm the integrity of the cDNA, digested with BspHI and BamHI, and subcloned into pMFG, as described previously (21) . The pMFG vector uses the MMLV long terminal repeat sequences to generate both a full-length viral RNA (for encapsidation into viral particles) and a subgenomic RNA that is responsible for expression of inserted sequences. pMFG-FL and pMFG-murine GM-CSF (21) vectors were transfected into 293GPG cells to generate high titer stocks of concentrated recombinant MMLV particles that have incorporated the vesicular stomatitis virus G protein (24) .

Tumor Models.
B16-F10 melanoma cells (syngeneic to C57Bl/6 mice) were maintained in DMEM containing 10% (vol/vol) FCS and penicillin/streptomycin. B16 cells were infected in the presence of polybrene (Sigma Chemical Co.), and unselected populations were used for study, as described previously (21) . The proportion of tumor cells transduced with the retroviral vector (which contains no selectable marker) was determined by Southern analysis. GM-CSF secretion was determined by ELISA, as described (21) . No replication competent retrovirus is generated in this system, as determined by the histidine mobilization assay (25) . For tumorigenicity experiments, 5 x 105 live, wild-type, or cytokine-secreting B16 cells were injected s.c. in Hank’s balanced saline solution (Life Technologies, Inc.); mice were sacrificed when tumors reached 1.5–2 cm in longest diameter. For vaccination experiments, mice were immunized s.c. on the abdominal wall with 5 x 105 irradiated (3500 rads), cytokine-secreting B16 cells and 7 days later were challenged with 1 x 106 live, wild-type B16 cells injected s.c. on the back.

Antibodies.
Fluorescence-activated cell sorting of splenocyte populations (depleted of erythrocytes with ammonium chloride) were performed using FITC- or phycoerythrin-conjugated monoclonal antibodies to CD11c, CD11b, I-Ab, CD8{alpha}, CD1d, CD3{epsilon}, CD4, NK1.1, B7–1, B7–2, and CD40 in the presence of blocking antibodies against the Fc{gamma}III/II receptors (PharMingen).

Cellular Assays.
Mixed leukocyte reactions were performed by culturing 2 x 104 irradiated splenocytes (harvested 14 days after injection of live, cytokine-secreting tumor cells and depleted of erythrocytes) with 2 x 104 nylon wool purified BALB/c T cells in RPMI supplemented with 10% FCS, 2 mM L-glutamine, 10 mM HEPES, 1% penicillin/streptomycin, 0.1 mM nonessential amino acids, 1% sodium pyruvate, and 5 x 10-5 M 2-mercaptoethanol (complete medium). After 4 days, [3H]thymidine was added to the culture and incorporation was measured after 8 h with liquid scintillation counting. For the measurement of tumor-induced T cell cytokine production, splenocytes were harvested 7 days after vaccination with irradiated, cytokine-producing tumor cells, depleted of erythrocytes, and cultured (1 x 106 cells) with irradiated (10,000 rads) B16 cells (2 x 104 ) in 2 ml of complete medium supplemented with 10 units/ml of IL-2. Supernatants were harvested after 5 days and assayed for GM-CSF, IL-4, IL-5, and IFN-{gamma} by ELISA using the appropriate monoclonal antibodies (Endogen; PharMingen).

Histology.
Tissues for pathological examination were fixed in 10% neutral buffered formalin, processed to paraffin embedment, and stained with H&E. In some cases, tissues were snap-frozen in liquid nitrogen and sections were immunostained for protein expression using monoclonal antibodies to CD11c, B7–1, CD3, and CD1a (PharMingen; DAKO). Isotype-matched controls were included for each primary antibody. Briefly, 4-µm sections were air-dried overnight and fixed in acetone at 4°C. After incubation with hydrogen peroxide, biotin, and Fc receptor blocking reagents, appropriate primary or isotype-matched control antibodies were applied. The peroxidase- and alkaline phosphatase-labeled streptavidin-biotin indirect methods were combined with the appropriate substrate-chromogen, resulting in either a brown or red precipitate at the antigen site. Finally, sections were counterstained with hematoxylin and evaluated using light microscopy. Human samples were obtained from vaccinated metastatic melanoma patients, as reported previously (22) .


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Generation of Cytokine-secreting Tumor Cells.
To study the effects of GM-CSF and FL on DC function in vivo, we used retroviral-mediated gene transfer to engineer B16 melanoma cells to secrete high levels of each cytokine. High titer replication-defective viral stocks were prepared using the MFG retroviral vector and 293GPG packaging cells. B16 cells were infected with these viral stocks, resulting in 1.5 proviral copies per infected cell as determined by Southern analysis (data not shown).

Bioactivity of Cytokine-secreting Tumor Cells.
GM-CSF-secreting B16 cells generated approximately 300 ng/106 cells/48 h of bioactive protein, as determined by ELISA (21) . Because monoclonal antibodies to FL were not available to us, we evaluated the production of bioactive FL protein by analyzing the stimulation of hematopoiesis in C57Bl/6 mice that received injections of live, FL-secreting B16 cells.

Although the injection of wild-type B16 cells into C57Bl/6 mice resulted in only minimal changes in peripheral blood counts and splenocyte populations (data not shown), the injection of FL-secreting B16 cells produced dramatic alterations in hematopoiesis. FL-secreting B16 cells displayed only modest reductions in tumorigenicity (likely due to the poor immunogenicity of this tumor model) and, thus, constitutively released FL into the circulation. This cytokine production stimulated a marked leukocytosis, with total WBC counts reaching up to 17,000 (x10-3/ml) by day 14 after injection, similar to effects previously described with administration of recombinant human FL protein (26) . FL-secreting B16 cells also elicited marked generalized lymphadenopathy and splenomegaly. Pathological analysis of the splenic architecture revealed marked expansion of the marginal zones and periarteriolar T cell-rich regions and blurring of the red/white pulp boundaries (data not shown), alterations similarly induced by recombinant human FL protein (15) .

To determine whether FL-secreting B16 cells stimulated the expansion of DCs systemically, as has been reported with recombinant FL protein (14) , we analyzed splenocyte populations for cells expressing high levels of CD11c and MHC class II molecules. As shown in Fig. 1ACitation , by 14 days after injection, FL-secreting B16 cells produced a marked increase in cells staining positive for both markers, with an average of 25% positive cells per spleen. Cytospin preparations revealed substantial numbers of cells with dendritic morphology (data not shown). In contrast, injection of wild-type B16 cells did not alter spleen cellularity or DC numbers (data not shown). Because injection of FL-secreting B16 cells led to a 3–4-fold increase in total spleen cellularity, overall this tumor line induced a nearly 100-fold increase in DC numbers. Moreover, these DCs functioned efficiently as stimulators in mixed leukocyte reactions (data not shown). Together, these findings demonstrate that FL-secreting B16 cells elicit comparable effects on hematopoietic populations as the injections of recombinant FL protein (14) .



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. GM-CSF and FL increase splenic DCs. Fourteen days after injection of live, GM-CSF- or FL-secreting B16 tumor cells, splenocytes were harvested and stained for CD11c and MHC II. Injection of wild-type B16 cells did not increase splenic DCs (data not shown). A, FL. B, GM-CSF.

 
GM-CSF-secreting B16 Cells Stimulate DC Expansion in Vivo.
GM-CSF-secreting B16 cells were shown previously to induce a profound leukocytosis (WBC counts of 100,000 x 10-3/ml) and splenomegaly in syngeneic C57Bl/6 mice (21) . To evaluate whether GM-CSF-secreting B16 cells also stimulated DC production, we again analyzed splenocyte populations for cells expressing high levels of both CD11c and MHC class II molecules. As shown in Fig. 1BCitation , by 14 days after injection, GM-CSF-secreting B16 cells also induced a marked increase in cells staining positive for both markers, with an average of 15% positive cells per spleen. Cytospin preparations revealed substantial numbers of cells with dendritic morphology (data not shown). Since the total spleen cellularity increased by 3-fold, this represented a ~40-fold increase in DC numbers. Moreover, these cells functioned efficiently as stimulators in mixed leukocyte reactions as well (data not shown). These results demonstrate that both GM-CSF and FL stimulate DC expansion in vivo.

Irradiated, Cytokine-secreting Tumor Cells Elicit Local DC Accumulation.
Because both GM-CSF- and FL-secreting B16 cells formed tumors in syngeneic hosts, we also examined the consequences of injecting irradiated, cytokine-secreting tumor cells. Although irradiation induces cell cycle arrest, it fails to inhibit cytokine production in vitro for at least 7 days (21) . Whereas implantation of irradiated, wild-type B16 cells evoked only a scant infiltrate (data not shown), implantation of irradiated, FL-secreting B16 cells elicited an intense local reaction composed primarily of lymphocytes and DCs (Fig. 2ACitation ). Strong staining for CD11c was demonstrable in these infiltrates (Fig. 2CCitation ).



View larger version (129K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. GM-CSF and FL increase tumor-infiltrating DCs. Vaccination sites were examined 5 days after the injection of irradiated, GM-CSF- or FL-secreting B16 cells. Injection of irradiated, wild-type B16 cells elicited minimal infiltrates (data not shown). A, FL (H&E stain, x200). B, GM-CSF (H&E stain, x200). C, FL (CD11c stain, x400). D, GM-CSF (CD11c stain, x400).

 
Injection of irradiated, GM-CSF-secreting B16 cells elicited a striking local reaction as well, which was characterized by an admixture of DCs, eosinophils, neutrophils, and macrophages (Fig. 2BCitation ). Strong staining for CD11c was also evident in these infiltrates (Fig. 2DCitation ). Together, these findings indicate that both FL- and GM-CSF-secreting B16 cells markedly increase DC numbers locally.

Generation of Protective Antitumor Immunity.
Because GM-CSF- and FL-secreting B16 cells both stimulated the generation of DCs in vivo, we compared the relative abilities of these cytokines to enhance the generation of antitumor immunity. For these experiments, mice received immunizations s.c. with irradiated, GM-CSF- or FL-secreting B16 cells and were challenged 1 week later with live, wild-type B16 cells. As shown in Fig. 3Citation , vaccination with irradiated, GM-CSF-secreting B16 cells stimulated higher levels of protective antitumor immunity than vaccination with irradiated, FL-secreting B16 cells. Similar results were found in five independent experiments.



View larger version (15K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. GM-CSF stimulates more potent antitumor immunity than FL. C57Bl/6 mice were immunized s.c. with 5 x 105 irradiated, GM-CSF- or FL-secreting B16 cells and were challenged 1 week later s.c. with 1 x 106 live, wild-type B16 cells (four mice per group). Vaccination with irradiated, wild-type B16 cells (or B16 cells infected with a ß-galactosidase-expressing vector) failed to elicit any tumor protection (data not shown). Similar results were found in five independent experiments. The difference observed between GM-CSF and FL was highly significant: P < 0.0001 using the Fisher’s exact test.

 
Metastatic melanoma patients vaccinated with irradiated, autologous melanoma cells engineered to secrete GM-CSF develop tumor-infiltrating lymphocytes that secrete a broad range of cytokines, including IL-5, IFN-{gamma}, and GM-CSF (22) . To compare the relative abilities of irradiated, GM-CSF- or FL-secreting B16 cells to induce tumor-specific cytokine production in the mouse, we harvested splenocytes 7 days after vaccination, cultured them for 5 days with IFN-{gamma}-treated, irradiated B16 cells, and analyzed the supernatants by ELISA. As shown in Fig. 4Citation , mice that received immunizations of irradiated, GM-CSF-secreting B16 cells developed T lymphocytes that produced high levels of IL-5, IFN-{gamma}, and GM-CSF. In contrast, vaccination with irradiated, FL-secreting B16 cells resulted in weaker production of IFN-{gamma} and GM-CSF and minimal amounts of IL-5. IL-4 was not detected in either group.



View larger version (30K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Tumor-specific cytokine production stimulated by GM-CSF or FL. Splenocytes (two mice per group) were harvested 1 week after vaccination, cocultured with irradiated, IFN-{gamma}-treated B16 cells for 5 days, and supernatants analyzed by ELISA. Similar results were found in four independent experiments.

 
GM-CSF-secreting B16 Cells Stimulate the Functional Maturation of Splenic DCs.
To explore the mechanism underlying the different abilities of GM-CSF and FL to stimulate antitumor immunity, we characterized the DCs stimulated by GM-CSF and FL in more detail. As shown in Fig. 5, A and CCitation , GM-CSF-secreting B16 cells produced DCs almost exclusively of the myeloid type, which expressed high levels of CD11b and did not express CD8{alpha} (15 , 27) . In contrast, FL-secreting tumor cells produced the expansion of both lymphoid- (CD8{alpha}+, CD11b-) and myeloid-type DCs (Fig. 5, B and DCitation ), as was reported following the administration of recombinant human FL protein (14 , 15) . No differences were observed in the DC expression of CD4 following injection of GM-CSF- or FL-secreting B16 cells (data not shown).



View larger version (64K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. GM-CSF stimulates myeloid-type DCs, whereas FL stimulates myeloid- and lymphoid-type DCs. Splenocytes were harvested 14 days after injection of live, GM-CSF- or FL-secreting B16 cells and stained for CD11c, CD11b, and CD8{alpha}. A, GM-CSF, CD11b. B, FL, CD11b. C, GM-CSF, CD8{alpha}. D, FL, CD8{alpha}.

 
DCs have been shown to undergo functional maturation in vitro characterized by the increased expression of costimulatory molecules and the down-regulation of phagocytic capacities (28) . To compare the functional maturation of DCs stimulated in vivo by either GM-CSF- or FL-secreting B16 cells, we examined the expression of critical costimulatory molecules on CD11c+ splenocytes. The level of B7–1 expression was dramatically increased on DCs stimulated by GM-CSF as compared with FL (Fig. 6, A and BCitation ). GM-CSF also stimulated more uniform, high level expression of B7–2, CD40, and MHC class II molecules than FL, although these differences were less striking (Fig. 6, C—FCitation , and Fig. 1, A and BCitation ).



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. GM-CSF stimulates the functional maturation of DCs. Splenocytes were harvested 14 days after injection of live, GM-CSF- or FL-secreting B16 cells and stained for CD11c, B7–1, B7–2, CD40, and CD1d. A, GM-CSF, B7–1. B, FL, B7–1. C, GM-CSF, B7–2. D, FL, B7–2. E, GM-CSF, CD40. F, FL, CD40. G, GM-CSF, CD1d. H, FL, CD1d.

 
A critical role for NKT cells in the generation of antitumor immunity recently has been delineated (29) . Because NKT cells respond to glycolipid antigens presented by CD1d molecules (30 , 31) , we examined the expression of CD1d on CD11c+ cells stimulated by the cytokine-secreting B16 cells. The level of CD1d expression was dramatically increased on DCs elicited by GM-CSF as compared with FL (Fig. 6, G and HCitation ). Although previous studies using recombinant FL protein had suggested that CD1d expression was restricted to CD8{alpha}+ DCs (15) , these findings reveal that GM-CSF induces the expression of this molecule on CD8{alpha}- DCs.

GM-CSF Activates DCs Locally.
To test whether the differences observed between GM-CSF- and FL-activated DCs in the spleen were also demonstable locally, we compared the expression of B7–1 in the infiltrates elicited by irradiated, cytokine-secreting B16 cells. As shown in Fig. 7ACitation , GM-CSF-secreting B16 cells induced a high level of B7–1 staining at the immunization site, whereas little B7–1 staining was found in the FL-elicited infiltrate (Fig. 7BCitation ).



View larger version (151K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. GM-CSF stimulates B7–1 expression on DCs infiltrating vaccination sites in mice and humans. A and B, vaccination sites were examined 5 days after the injection of irradiated GM-CSF- or FL-secreting B16 cells. A, GM-CSF (B7–1 stain, x400). B, FL (B7–1 stain, x400). C, vaccination site of a patient receiving irradiated, autologous melanoma cells engineered to secrete GM-CSF (H&E stain, x400). D, CD1a stain (x400). E, B7–1 stain (x400).

 
To examine whether GM-CSF stimulates the functional maturation of DCs in humans as well, we studied the vaccination sites of metastatic melanoma patients treated with irradiated, autologous, GM-CSF-secreting melanoma cells. This immunization strategy consistently generates tumor-specific CD4- and CD8-positive T cells and plasma cells that mediate extensive tumor destruction without the induction of autoimmunity (22) . Vaccination reactions were composed of dense admixtures of DCs, macrophages, and eosinophils (Fig. 7CCitation ), similar to those observed in the murine studies (Fig. 2BCitation ). Abundant CD1a staining of cells with dendritic morphology was evident (Fig. 7DCitation ), and these DCs expressed high levels of B7–1 (Fig. 7ECitation ).


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The studies presented here demonstrate that tumor cells engineered to secrete GM-CSF stimulate the in vivo expansion and maturation of DCs. Because DCs play pivotal roles in the initiation of antigen-specific T- and B-cell immunity (1) , our findings imply that the ability of GM-CSF to generate CD8{alpha}- DCs that express high levels of B7–1 and CD1d is critical to the potent antitumor activity of this cancer vaccination strategy in mice and humans.

Although many investigations have established that GM-CSF can induce DC development from hemopoietic progenitors in vitro (3, 4, 5, 6) , the capacity of this cytokine to enhance DC development in vivo has been less clearly defined. The systemic administration of recombinant murine GM-CSF protein elicted only minimal effects on splenic DC populations (14) , and GM-CSF transgenic mice did not manifest increased numbers of lymphoid tissue DCs (32) . The intradermal administration of recombinant GM-CSF protein to patients with leprosy also evoked only moderate, local DC accumulation (33) .

In contrast to these findings, our studies illustrate that the injection of GM-CSF-secreting tumor cells results in a dramatic expansion of DCs both locally and systemically. This stimulation likely reflects the efficient and stable production of GM-CSF protein by the MFG retroviral vector. Similar effects have been achieved recently with polyethylene glycol-modified recombinant GM-CSF protein (17) . Despite the impressive increase in DCs elicited by the pharmacological delivery of GM-CSF, we and others demonstrated that GM-CSF is dispensable for steady-state DC generation in vivo (34 , 35) .

Although several stimuli for DC activation in vitro have been identified, including GM-CSF, monocyte-conditioned medium, tumor necrosis factor, and CD40 ligand (36, 37, 38, 39) , less is known concerning the signals necessary for DC activation in vivo. Injection of lipopolysaccharide or extracts of Toxoplasma gondii has been shown, however, to evoke DC migration and maturation (40 , 41) , in part through the induction of IL-12, tumor necrosis factor, IL-1, and secondary lymphoid organ chemokine (42 , 43) . The experiments presented here establish that GM-CSF is a critical regulator of DC activation in vivo as well.

Because tumor cells secreting GM-CSF or FL both induce the marked expansion of DCs in vivo, our system rendered it possible to compare the functions of these cells in the development of antitumor immunity. Although other experiments indicate that both recombinant FL and GM-CSF protein can serve as effective adjuvants for soluble proteins antigens (17 , 44, 45, 46, 47) , the data presented here reveal that vaccination with irradiated tumor cells secreting GM-CSF is more potent than vaccination with irradiated tumor cells secreting FL.

The superior antitumor immunity stimulated by GM-CSF was associated with the induction of a broad T cell cytokine response, in contrast to the limited Th1 response induced by FL. Previously, we found similar, broad cytokine profiles in tumor-infiltrating lymphocytes derived from melanoma patients vaccinated with irradiated, autologous tumor cells engineered to secrete GM-CSF (22) . These observations, taken together with studies examining the efficacy of GM-CSF-based tumor vaccines in cytokine-deficient mice (48) , reveal important roles for both Th1 and Th2 cytokines in mediating tumor rejection.

The exclusive generation of myeloid-type DCs (CD8{alpha}- and CD11b+) by GM-CSF-secreting tumors, in contrast to the generation of both lymphoid- (CD8{alpha}+ and CD11b-) and myeloid-type DCs by FL-secreting tumors, helps to explain the greater vaccination activity associated with GM-CSF in two ways. First, recent studies indicate that myeloid-type DCs elicit a broad cytokine response, whereas lymphoid-type DCs elicit a Th1 response (17 , 49) , perhaps via antigen transfer (50) . Second, because antigen presentation stimulated by GM-CSF-based tumor cell vaccines involves cross-priming by bone marrow-derived cells (51) , the capacity of DCs to phagocytose-irradiated cells (52, 53, 54) is particularly relevant; the capture of apoptotic bodies by DCs infiltrating tumor cells coexpressing GM-CSF and CD40 ligand has been demonstrated (55) . In this context, CD8{alpha}- DCs seem to be much more effective in the ingestion of particulate antigens than CD8{alpha}+ DCs (15 , 56) .

The comparison of DCs generated in vivo by GM-CSF and FL also revealed a striking difference in B7–1 expression. Whereas earlier work documented the capacity of GM-CSF to up-regulate B7–1 on cultured DCs (57) , the findings presented here illustrate that GM-CSF is more powerful than FL in augmenting B7–1 expression in vivo. This increase in B7–1 is likely to be important for the development of antitumor immunity, because recent work using T-cell clones has indicated that high level B7–1 expression markedly reduces the amount of antigen necessary to trigger T-cell proliferation and expands the diversity of cytokines released (58) . Experiments delineating the efficacy of GM-CSF-based tumor cell vaccines in B7–1 knockout mice (59) will help test this idea more thoroughly. A requirement for costimulatory function in antitumor immunity already has been established by demonstrating that vaccination with irradiated, GM-CSF-secreting tumor cells fails to induce protection against tumor challenge in CD40-deficient mice (60) .

Our comparative analysis also revealed a dramatic difference between GM-CSF- and FL-generated DCs in the expression of CD1d. Although previous studies suggested that CD1d was largely restricted to the CD8{alpha}+ population (15) , the experiments presented here show that CD1d can be expressed at very high levels by CD8{alpha}- DCs. Concomitant with the induction of CD1d in animals injected with GM-CSF-secreting tumors was a significant increase in the numbers of splenic NKT cells (date not shown). Because activated NKT cells release large amounts of cytokines (61) , their stimulation by CD1d+ DCs may be essential for amplifying the nascent antitumor immune response and establishing the broad T cell cytokine profile. Indeed, other work has shown that NKT cells are essential for the antitumor effects of IL-12 (29) . Experiments testing the activities of GM-CSF-based vaccines in CD1d knockout mice (62, 63, 64) should further clarify the role of NKT cells in antitumor immunity.

Lastly, our identification of a DC phenotype that results in the generation of potent antitumor immunity in vivo has important implications for the use of DCs in cancer vaccination strategies. It is of interest that many protocols involving the ex vivo expansion of DCs rely on the addition of monocyte-conditioned medium to produce functionally mature DCs (65) ; this requirement stems, in part, from the prior depletion of monocytes and granulocytes from the culture. An intriguing question raised by these observations is why hematopoietic progenitors capable of giving rise to granulocytes, macrophages, and DCs exist at all (66) . Examination of the vaccination sites of GM-CSF-secreting tumor cells reveals the marked accumulation of each of these cell types. It is, thus, tempting to speculate that the coordinated activation of DCs, macrophages, and granulocytes by GM-CSF is intricately linked to the development and differentiation of DCs in vivo; this culminates in the efficient priming of antigen-specific immune responses. This perspective suggests that appropriate pharmacological delivery of GM-CSF may have broad use for vaccination strategies.


    ACKNOWLEDGMENTS
 
We thank Esther Brisson (Albany Medical College, Albany, NY) for excellent help with the histological specimens, Susan Lazo-Kallanian and John Daley for excellent help with the fluorescence-activated cell-sorting studies, Patricia Bernardo for excellent help with the statistics, and the staff of the Redstone Animal Facility (Dana-Farber Cancer Institute, Boston, MA) for excellent help with maintenance of the mouse colony.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Swiss National Science Foundation (to N. M. and S. G.), the Swiss Cancer League (to S. G.), NIH Grant AI45051 (to S. B. W.), the Cancer Research Institute/Partridge Foundation, and National Cancer Institute Grant CA74886 (to G. D.). Back

2 Equal first authors. Back

3 To whom requests for reprints should be addressed, at Dana-Farber Cancer Institute, Dana 510E, 44 Binney Street, Boston, MA 02115. Phone: (617) 632-5051; Fax: (617) 632-5167; E-mail: glenn_dranoff{at}dfci.harvard.edu Back

4 The abbreviations used are: DC, dendritic cell; GM-CSF, granulocyte-macrophage colony-stimulating factor; FL, Flt3-ligand; MMLV, Moloney murine leukemia virus; IL, interleukin. Back

Received 12/21/99. Accepted 4/14/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Steinman R. M. The dendritic cell system and its role in immunogenicity. Ann. Rev. Immunol., 9: 271-296, 1991.[Medline]
  2. Banchereau J., Steinman R. Dendritic cells and the control of immunity. Nature (Lond.), 392: 245-252, 1998.[Medline]
  3. Caux C., Dezutter-Dambuyant C., Schmitt D., Banchereau J. GM-CSF and TNF-{alpha} cooperate in the generation of dendritic Langerhans cells. Nature (Lond.), 360: 258-261, 1992.[Medline]
  4. Inaba K., Steinman R., Witmer Pack M., Aya H., Inaba M., Sudo T., Wolpe S., Schuler G. Identification of proliferating dendritic cell precursors in mouse blood. J. Exp. Med., 175: 1157-1167, 1992.[Abstract/Free Full Text]
  5. Reid C., Stackpoole A., Meager A., Tikerpae J. Interactions of tumor necrosis factor with granulocyte-macrophage colony-stimulating factor and other cytokines in the regulation of dendritic cell growth in vitro from early bipotent CD34+ progenitors in human bone marrow. J. Immunol., 149: 2681-2688, 1992.[Abstract]
  6. Scheicher C., Mehlig M., Zecher R., Reske K. Dendritic cells from mouse bone marrow: in vitro differentiation using low doses of recombinant granulocyte-macrophage colony-stimulating factor. J. Immunol. Methods, 154: 253-264, 1992.[Medline]
  7. Young J. W., Inaba K. Dendritic cells as adjuvants for class I major histocompatibility complex-restricted antitumor immunity. J. Exp. Med., 183: 7-11, 1996.[Free Full Text]
  8. Mayordomo J. T., Zorina T., Storkus W. J., Zitvogel L., Celluzzi C., Falo L. D., Melief C. J., Ildstad S. T., Kast W. M., DeLeo A. B., Lotze M. T. Bone marrow derived dendritic cells pulsed with synthetic tumor peptides elicit protective and therapeutic anti-tumor immunity. Nat. Med., 1: 1297-1302, 1995.[Medline]
  9. Zitvogel L., Mayordomo J. I., Tjandrawan T., Deleo A. B., Clarke M. R., Lotze M. T., Storkus W. J. Therapy of murine tumors with tumor peptide-pulsed dendritic cells—dependence on T cells, B7 costimulation, and T helper cell 1-associated cytokines. J. Exp. Med., 183: 87-97, 1996.[Abstract/Free Full Text]
  10. Paglia P., Chiodoni C., Rodolfo M., Colombo M. P. Murine dendritic cells loaded in vitro with soluble protein prime cytotoxic T lymphocytes against tumor antigen in vivo. J. Exp. Med., 183: 317-322, 1996.[Abstract/Free Full Text]
  11. Boczkowski D., Nair S. K., Snyder D., Gilboa E. Dendritic cells pulsed with RNA are potent antigen-presenting cells in vitro and in vivo. J. Exp. Med., 184: 465-472, 1996.[Abstract/Free Full Text]
  12. Hsu F., Benike C., Fagnoni F., Liles T., Czerwinski D., Taidi B., Engleman E., Levy R. Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat. Med., 2: 52-58, 1996.[Medline]
  13. Nestle F., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
  14. Maraskovsky E., Brasel K., Teepe M., Roux E., Lyman S., Shortman K., McKenna H. Dramatic increase in the numbers of functionally mature dendritic cells in Flt3 ligand-treated mice: multiple dendritic cell subpopulations identified. J. Exp. Med., 184: 1953-1961, 1996.[Abstract/Free Full Text]
  15. Pulendran B., Lingappa J., Kennedy M., Smith J., Teepe M., Rudensky A., Maliszewski C., Maraskovsky E. Developmental pathways of dendritic cells in vivo. Distinct function, phenotype, and localization of dendritic cell subsets in flt3 ligand-treated mice. J. Immunol., 159: 2222-2231, 1997.[Abstract/Free Full Text]
  16. Shurin M., Pandharipande P., Zorina T., Haluszczak C., Subbotin V., Hunter O., Brumfield A., Storkus W., Maraskovsky E., Lotze M. Flt3 ligand induces the generation of functionally active dendritic cells in mice. Cell. Immunol., 179: 174-184, 1997.[Medline]
  17. Pulendran B., Smith J., Caspary G., Brasel K., Pettit D., Maraskovsky E., Maliszewski C. Distinct dendritic cell subsets differentially regulate the class of immune response in vivo. Proc. Natl. Acad. Sci. USA, 96: 1036-1041, 1999.[Abstract/Free Full Text]
  18. Lynch D., Andreasen A., Maraskovsky E., Whitmore J., Miller R., Schuh J. Flt3 ligand induces tumor regression and antitumor immune responses in vivo. Nat. Med., 3: 625-631, 1997.[Medline]
  19. Esche C., Subbotin V., Maliszewski C., Lotze M., Shurin M. Flt3 ligand administration inhibits tumor growth in murine melanoma and lymphoma. Cancer Res., 58: 380-383, 1998.[Abstract/Free Full Text]
  20. Chen K., Braun S., Lyman S., Fan Y., Traycoff C., Wiebke E., Gaddy J., Sledge G., Broxmeyer H., Cornetta K. Antitumor activity and immunotherapeutic properties of Flt3-ligand in a murine breast cancer model. Cancer Res., 57: 3511-3516, 1997.[Abstract/Free Full Text]
  21. Dranoff G., Jaffee E., Lazenby A., Golumbek P., Levitsky H., Brose K., Jackson V., Hamada H., Pardoll D., Mulligan R. C. Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimulates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA, 90: 3539-3543, 1993.[Abstract/Free Full Text]
  22. Soiffer R., Lynch T., Mihm M., Jung K., Rhuda C., Schmollinger J., Hodi F., Liebster L., Lam P., Mentzer S., Singer S., Tanabe K., Cosimi A., Duda R., Sober A., Bhan A., Daley J., Neuberg D., Parry G., Rokovich J., Richards L., Drayer J., Berns A., Clift S., Cohen L., Mulligan R., Dranoff G. Vaccination with irradiated, autologous melanoma cells engineered to secrete human granulocyte-macrophage colony stimulating factor generates potent anti-tumor immunity in patients with metastatic melanoma. Proc. Natl. Acad. Sci. USA, 95: 13141-13146, 1998.[Abstract/Free Full Text]
  23. Lyman S. D., James L., Bos T. V., de Vries P., Brasel K., Gliniak B., Hollingsworth L. T., Picha K. S., McKenna H. J., Splett R. R., Fletcher F. A., Maraskovsky E., Farrah T., Foxworthe D., Williams D. E., Beckmann M. P. Molecular cloning of a ligand for the flt3/flk-2 tyrosine kinase receptor: a proliferative factor for primitive hematopoietic cells. Cell, 75: 1157-1167, 1993.[Medline]
  24. Ory D. S., Neugeboren B. A., Mulligan R. C. A stable human-derived packaging cell line for production of high titer retrovirus/vesicular stomatitis virus G pseudotypes. Proc. Natl. Acad. Sci. USA, 93: 11400-11406, 1996.[Abstract/Free Full Text]
  25. Hartman S. C., Mulligan R. C. Two dominant-acting selectable markers for gene transfer studies in mammalian cells. Proc. Natl. Acad. Sci. USA, 85: 8047-8051, 1988.[Abstract/Free Full Text]
  26. Brasel K., McKenna H., Morrissey P., Charrier K., Morris A., Lee C., Williams D., Lyman S. Hematologic effects of flt3 ligand in vivo in mice. Blood, 88: 2004-2012, 1996.[Abstract/Free Full Text]
  27. Vremec D., Shortman K. Dendritic cell subtypes in mouse lymphoid organs. Cross-correlation of surface markers, changes with incubation, and differences among thymus, spleen, and lymph nodes. J. Immunol., 159: 565-573, 1997.[Abstract]
  28. Cella M., Sallusto F., Lanzavecchia A. Origin, maturation, and antigen presenting function of dendritic cells. Curr. Opin. Immunol., 9: 10-16, 1997.[Medline]
  29. Cui J., Shin T., Kawano T., Sato H., Kondo E., Toura I., Kaneko Y., Koseki H., Kanno M., Taniguchi M. Requirement for V{alpha} 14 NKT cells in IL-12-mediated rejection of tumors. Science (Washington DC), 278: 1623-1626, 1997.[Abstract/Free Full Text]
  30. Kawano T., Cui J., Koezuka Y., Toura I., Kaneko Y., Motoki K., Ueno H., Nakagawa R., Sato H., Kondo E., Koseki H., Taniguchi M. CD1d-restricted and TCR-mediated activation of V{alpha} 14 NKT cells by glycosylceramides. Science (Washington DC), 278: 1626-1629, 1997.[Abstract/Free Full Text]
  31. Joyce S., Woods A., Yewdell J., Bennick J., Dharshan De Silva A., Boesteanu A., Balk S., Cotter R., Brutkiewicz R. Natural ligand of mouse CD1d1: cellular glycosylphosphatidylinositol. Science (Washington DC), 279: 1541-1544, 1998.[Abstract/Free Full Text]
  32. Metcalf D., Shortman K., Vremec D., Mifsud S., Di Rago L. Effects of excess GM-CSF levels on hematopoiesis and leukemia development in GM-CSF/max 41 double transgenic mice. Leukemia (Baltimore), 10: 713-719, 1996.[Medline]
  33. Kaplan G., Walsh G., Guido L., Meyn P., Burkhardt R., Abalos R., Barker J., Frindt P., Fajardo T., Celona R., Cohn Z. Novel responses of human skin to intradermal recombinant granulocyte/macrophage-colony stimulating factor: Langerhans cell recruitment, keratinocyte growth, and enhanced wound healing. J. Exp. Med., 175: 1717-1728, 1992.[Abstract/Free Full Text]
  34. Dranoff G., Crawford A. D., Sadelain M., Ream B., Rashid A., Bronson R. T., Dickersin G. R., Bachurski C. J., Mark E. L., Whitsett J. A., Mulligan R. C. Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis. Science (Washington DC), 264: 713-716, 1994.[Abstract/Free Full Text]
  35. Vremec D., Lieschke G., Dunn A., Robb L., Shortman K. The influence of granulocyte-macrophage colony-stimulating factor on dendritic cell levels in mouse lymphoid organs. Eur. J. Immunol., 27: 40-44, 1997.[Medline]
  36. Witmer-Pack M., Olivier W., Valinsky J., Schuler G., Steinman R. Granulocyte-macrophage colony-stimulating factor is essential for the viability and function of cultured murine epidermal Langerhans cells. J. Exp. Med., 166: 1484-1498, 1987.[Abstract/Free Full Text]
  37. O’Doherty U., Steinman R., Peng M., Cameron P., Gezelter S., Kopeloff I., Swiggard W., Pope M., Bhardwaj N. Dendritic cells freshly isolated from human blood express CD4 and mature into typical immunostimulatory dendritic cells after culture in monocyte-conditioned medium. J. Exp. Med., 178: 1067-1078, 1993.[Abstract/Free Full Text]
  38. Sallusto F., Lanzavecchia A. Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor {alpha}. J. Exp. Med., 179: 1109-18, 1994.[Abstract/Free Full Text]
  39. Caux C., Massacrier C., Vanbervliet B., Dubois B., Van Kooten C., Durand I., Banchereau J. Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med., 180: 1263-1272, 1994.[Abstract/Free Full Text]
  40. De Smedt T., Pajak B., Muraille E., Lespagnard L., Heinen E., De Baetselier P., Urbain J., Leo O., Moser M. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo. J. Exp. Med., 184: 1413-1424, 1996.[Abstract/Free Full Text]
  41. Reis e Sousa C., Hieny S., Scharton-Kersten T., Jankovic D., Charest H., Germain R., Sher A. In vivo microbial stimulation induces rapid CD40 ligand-independent production of interleukin 12 by dendritic cells and their redistribution to T cell areas. J. Exp. Med., 186: 1819-1829, 1997.[Abstract/Free Full Text]
  42. Roake J., Rao A., Morris P., Larsen C., Hankins D., Austyn J. Dendritic cell loss from nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin-1. J. Exp. Med., 181: 2237-2247, 1995.[Abstract/Free Full Text]
  43. Gunn M., Kyuwa S., Tam C., Kakiuchi T., Matsuzawa A., Williams L., Nakano H. Mice lacking expression of secondary lymphoid organ chemokine have defects in lymphocyte homing and dendritic cell localization. J. Exp. Med., 189: 451-460, 1999.[Abstract/Free Full Text]
  44. Disis M. L., Bernhard H., Shiota F. M., Hand S. L., Gralow J. R., Huseby E. S., Gillis S., Cheever M. A. Granulocyte-macrophage colony-stimulating factor—an effective adjuvant for protein and peptide-based vaccines. Blood, 88: 202-210, 1996.[Abstract/Free Full Text]
  45. Morrissey P., Bressler L., Park L., Alpert A., Gillis S. Granulocyte-macrophage colony-stimulating factor augments the primary antibody response by enhancing the function of antigen-presenting cells. J. Immunol., 139: 1113-1119, 1987.[Abstract]
  46. Jager E., Ringhoffer M., Dienes H. P., Arand M., Karbach J., Jager D., Ilsemann C., Hagedorn M., Oesch F., Knuth A. Granulocyte-macrophage-colony-stimulating factor enhances immune responses to melanoma-associated peptides in vivo. Int. J. Cancer, 67: 54-62, 1996.[Medline]
  47. Pulendran B., Smith J., Jenkins M., Schoenborn M., Maraskovsky E., Maliszewski C. Prevention of peripheral tolerance by a dendritic cell growth factor: Flt3 ligand as an adjuvant. J. Exp. Med., 188: 2075-2082, 1998.[Abstract/Free Full Text]
  48. Hung K., Hayashi R., Lafond-Walker A., Lowenstein C., Pardoll H., Levitsky H. The central role of CD4+ T cells in the antitumor immune response. J. Exp. Med., 188: 2357-2368, 1998.[Abstract/Free Full Text]
  49. Maldonado-López R., De Smedt T., Michel P., Godfroid J., Pajak B., Heirman C., Thielemans K., Leo O., Urbain J., Moser M. CD8{alpha}+ and CD8{alpha}- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med., 189: 587-592, 1999.[Abstract/Free Full Text]
  50. Smith A., Fazekas de St. Groth B. Antigen-pulsed CD8{alpha}+ dendritic cells generate an immune response after subcutaneous injection without homing to the draining lymph node. J. Exp. Med., 189: 593-598, 1999.[Abstract/Free Full Text]
  51. Huang A. Y., Golumbek P., Ahmadzadeh M., Jaffee E., Pardoll D., Levitsky H. Role of bone marrow-derived cells in presenting MHC class I-restricted tumor antigens. Science (Washington DC), 264: 961-965, 1994.[Abstract/Free Full Text]
  52. Albert M., Sauter B., Bhardwaj N. Dendritic cells acquire antigen from apoptotic cells and induce class I-restricted CTLs. J. Exp. Med., 392: 86-89, 1998.
  53. Albert M., Pearce S., Francisco L., Sauter B., Roy P., Silverstein R., Bhardwaj N. Immature dendritic cells phagocytose apoptotic cells via {alpha}vß5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med., 188: 1359-1368, 1998.[Abstract/Free Full Text]
  54. Inaba K., Turley S., Yamaide F., Iyoda T., Mahnke K., Inaba M., Pack M., Subklewe M., Sauter B., Sheff D., Albert M., Bhardwaj N., Mellman I., Steinman R. Efficient presentation of phagocytosed cellular fragments on the major histocompatibility complex class II products of dendritic cells. J. Exp. Med., 188: 2163-2173, 1998.[Abstract/Free Full Text]
  55. Chiodoni C., Paglia P., Stoppacciaro A., Rodolfo M., Parenza M., Colombo M. Dendritic cells infiltrating tumors cotransduced with granulocyte/macrophage colony-stimulating factor (GM-CSF) and CD40 ligand genes take up and present endogenous tumor-associated antigens, and prime naive mice for a cytotoxic T lymphocyte response. J. Exp. Med., 190: 125-133, 1999.[Abstract/Free Full Text]
  56. Shen Z., Reznikoff G., Dranoff G., Rock K. Cloned dendritic cells can present exogenous antigens on both MHC class I and II molecules. J. Immunol., 158: 2723-2730, 1997.[Abstract]
  57. Larsen C. P., Ritchie S. C., Hendrix R., Linsley P. S., Hathcock K. S., Hodes R. J., Lowry R. P., Pearson T. C. Regulation of immunostimulatory function and costimulatory molecule (B7–1 and B7–2) expression on murine dendritic cells. J. Immunol., 152: 5208-5219, 1994.[Abstract]
  58. Murtaza A., Kuchroo V., Freeman G. Changes in the strength of co-stimulation through the B7/CD28 pathway alter functional T cell responses to altered peptide ligands. Int. Immunol., 11: 407-416, 1999.[Abstract/Free Full Text]
  59. Freeman G., Borriello F., Hodes R., Reiser H., Gribben J., Ng J., Kim J., Goldberg J., Hathcock K., Lombard L., Wang S., Gray G., Nadler L., Sharpe A. Uncovering of functional alternative CTLA-4 counter-receptor in B7-deficient mice. Science (Washington DC), 262: 907-909, 1993.[Abstract/Free Full Text]
  60. Mackey M., Gunn J., Ting P., Kikutani H., Dranoff G., Noelle R., Barth R. Protective immunity induced by tumor vaccines requires interaction between CD40 and its ligand, CD154. Cancer Res., 57: 2569-2574, 1997.[Abstract/Free Full Text]
  61. Bendelac A., Rivera M., Park S-H., Roark J. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol., 15: 535-562, 1997.[Medline]
  62. Chen Y., Chiu N., Mandal M., Wang N., Wang C. Impaired NK+ T cell development and early IL-4 production in CD1-deficient mice. Immunity, 6: 459-467, 1997.[Medline]
  63. Mendiratta S., Martin W., Hong S., Boesteanu A., Joyce S., Van Kaer L. CD1d mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity, 6: 469-477, 1997.[Medline]
  64. Smiley S., Kaplan M., Grusby M. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science (Washington DC), 275: 977-979, 1997.[Abstract/Free Full Text]
  65. Reddy A., Sapp M., Feldman M., Subklewe M., Bhardwaj N. A monocyte conditioned medium is more effective than defined cytokines in mediating the terminal maturation of human dendritic cells. Blood, 90: 3640-3646, 1997.[Abstract/Free Full Text]
  66. Inaba K., Inaba M., Deguchi M., Hagi K., Yasumizu R., Ikehara S., Muramatsu S., Steinman R. Granulocytes, macrophages, and dendritic cells arise from a common major histocompatibility complex class II-negative progenitor in mouse bone marrow. Proc. Natl. Acad. Sci. USA, 90: 3038-3042, 1993.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
BloodHome page
S. Zarei, F. Schwenter, P. Luy, M. Aurrand-Lions, P. Morel, M. Kopf, G. Dranoff, and N. Mach
Role of GM-CSF signaling in cell-based tumor immunization
Blood, June 25, 2009; 113(26): 6658 - 6668.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Bedoui, S. Prato, J. Mintern, T. Gebhardt, Y. Zhan, A. M. Lew, W. R. Heath, J. A. Villadangos, and E. Segura
Characterization of an Immediate Splenic Precursor of CD8+ Dendritic Cells Capable of Inducing Antiviral T Cell Responses
J. Immunol., April 1, 2009; 182(7): 4200 - 4207.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Fonseca, R. Soiffer, V. Ho, M. Vanneman, M. Jinushi, J. Ritz, D. Neuberg, R. Stone, D. DeAngelo, and G. Dranoff
Protein disulfide isomerases are antibody targets during immune-mediated tumor destruction
Blood, February 19, 2009; 113(8): 1681 - 1688.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. I. Wolf, D. Buehler, S. E. Hensley, L. L. Cavanagh, E. J. Wherry, P. Kastner, S. Chan, and W. Weninger
Plasmacytoid Dendritic Cells Are Dispensable during Primary Influenza Virus Infection
J. Immunol., January 15, 2009; 182(2): 871 - 879.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. A. Quezada, K. S. Peggs, T. R. Simpson, Y. Shen, D. R. Littman, and J. P. Allison
Limited tumor infiltration by activated T effector cells restricts the therapeutic activity of regulatory T cell depletion against established melanoma
J. Exp. Med., September 1, 2008; 205(9): 2125 - 2138.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. P. Wang, G. N. Bowen, C. Padden, A. Cerny, R. W. Finberg, P. E. Newburger, and E. A. Kurt-Jones
Toll-like receptor-mediated activation of neutrophils by influenza A virus
Blood, September 1, 2008; 112(5): 2028 - 2034.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Iparraguirre, J. W. Tobias, S. E. Hensley, K. S. Masek, L. L. Cavanagh, M. Rendl, C. A. Hunter, H. C. Ertl, Ulrich. H. von Andrian, and W. Weninger
Two distinct activation states of plasmacytoid dendritic cells induced by influenza virus and CpG 1826 oligonucleotide
J. Leukoc. Biol., March 1, 2008; 83(3): 610 - 620.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Carreras, S. Turner, V. Paharkova-Vatchkova, A. Mao, C. Dascher, and S. Kovats
Estradiol Acts Directly on Bone Marrow Myeloid Progenitors to Differentially Regulate GM-CSF or Flt3 Ligand-Mediated Dendritic Cell Differentiation
J. Immunol., January 15, 2008; 180(2): 727 - 738.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. L. Papenfuss, A. P. Kithcart, N. D. Powell, M. A. McClain, I. E. Gienapp, T. M. Shawler, and C. C. Whitacre
Disease-modifying capability of murine Flt3-ligand DCs in experimental autoimmune encephalomyelitis
J. Leukoc. Biol., December 1, 2007; 82(6): 1510 - 1518.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Contractor, J. Louten, L. Kim, C. A. Biron, and B. L. Kelsall
Cutting Edge: Peyer's Patch Plasmacytoid Dendritic Cells (pDCs) Produce Low Levels of Type I Interferons: Possible Role for IL-10, TGFbeta, and Prostaglandin E2 in Conditioning a Unique Mucosal pDC Phenotype
J. Immunol., September 1, 2007; 179(5): 2690 - 2694.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Wendland, N. Czeloth, N. Mach, B. Malissen, E. Kremmer, O. Pabst, and R. Forster
CCR9 is a homing receptor for plasmacytoid dendritic cells to the small intestine
PNAS, April 10, 2007; 104(15): 6347 - 6352.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. G. H. Hernandez, L. Shen, and K. L. Rock
CD40-CD40 Ligand Interaction between Dendritic Cells and CD8+ T Cells Is Needed to Stimulate Maximal T Cell Responses in the Absence of CD4+ T Cell Help
J. Immunol., March 1, 2007; 178(5): 2844 - 2852.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Parroche, F. N. Lauw, N. Goutagny, E. Latz, B. G. Monks, A. Visintin, K. A. Halmen, M. Lamphier, M. Olivier, D. C. Bartholomeu, et al.
From the Cover: Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9
PNAS, February 6, 2007; 104(6): 1919 - 1924.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Gonzalez-Juarrero, J. M. Hattle, A. Izzo, A. P. Junqueira-Kipnis, T. S. Shim, B. C. Trapnell, A. M. Cooper, and I. M. Orme
Disruption of granulocyte macrophage-colony stimulating factor production in the lungs severely affects the ability of mice to control Mycobacterium tuberculosis infection
J. Leukoc. Biol., June 1, 2005; 77(6): 914 - 922.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. M. Bernt, S. Ni, A.-T. Tieu, and A. Lieber
Assessment of a Combined, Adenovirus-Mediated Oncolytic and Immunostimulatory Tumor Therapy
Cancer Res., May 15, 2005; 65(10): 4343 - 4352.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Driessens, M. Hamdane, V. Cool, T. Velu, and C. Bruyns
Highly Successful Therapeutic Vaccinations Combining Dendritic Cells and Tumor Cells Secreting Granulocyte Macrophage Colony-stimulating Factor
Cancer Res., November 15, 2004; 64(22): 8435 - 8442.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Iijima, M. F. Neurath, T. Nagaishi, J. N. Glickman, E. E. Nieuwenhuis, A. Nakajima, D. Chen, I. J. Fuss, N. Utku, D. N. Lewicki, et al.
Specific Regulation of T Helper Cell 1-mediated Murine Colitis by CEACAM1
J. Exp. Med., February 17, 2004; 199(4): 471 - 482.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Q. Li, P.-Y. Pan, P. Gu, D. Xu, and S.-H. Chen
Role of Immature Myeloid Gr-1+ Cells in the Development of Antitumor Immunity
Cancer Res., February 1, 2004; 64(3): 1130 - 1139.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. Soiffer, F. S. Hodi, F. Haluska, K. Jung, S. Gillessen, S. Singer, K. Tanabe, R. Duda, S. Mentzer, M. Jaklitsch, et al.
Vaccination With Irradiated, Autologous Melanoma Cells Engineered to Secrete Granulocyte-Macrophage Colony-Stimulating Factor by Adenoviral-Mediated Gene Transfer Augments Antitumor Immunity in Patients With Metastatic Melanoma
J. Clin. Oncol., September 1, 2003; 21(17): 3343 - 3350.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Gillessen, Y. N. Naumov, E. E. S. Nieuwenhuis, M. A. Exley, F. S. Lee, N. Mach, A. D. Luster, R. S. Blumberg, M. Taniguchi, S. P. Balk, et al.
CD1d-restricted T cells regulate dendritic cell function and antitumor immunity in a granulocyte-macrophage colony-stimulating factor-dependent fashion
PNAS, July 22, 2003; 100(15): 8874 - 8879.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. S. Hodi, M. C. Mihm, R. J. Soiffer, F. G. Haluska, M. Butler, M. V. Seiden, T. Davis, R. Henry-Spires, S. MacRae, A. Willman, et al.
Biologic activity of cytotoxic T lymphocyte-associated antigen 4 antibody blockade in previously vaccinated metastatic melanoma and ovarian carcinoma patients
PNAS, April 15, 2003; 100(8): 4712 - 4717.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. C. Schmollinger, R. H. Vonderheide, K. M. Hoar, B. Maecker, J. L. Schultze, F. S. Hodi, R. J. Soiffer, K. Jung, M. J. Kuroda, N. L. Letvin, et al.
Melanoma inhibitor of apoptosis protein (ML-IAP) is a target for immune-mediated tumor destruction
PNAS, March 18, 2003; 100(6): 3398 - 3403.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
R. Salgia, T. Lynch, A. Skarin, J. Lucca, C. Lynch, K. Jung, F. S. Hodi, M. Jaklitsch, S. Mentzer, S. Swanson, et al.
Vaccination With Irradiated Autologous Tumor Cells Engineered to Secrete Granulocyte-Macrophage Colony-Stimulating Factor Augments Antitumor Immunity in Some Patients With Metastatic Non-Small-Cell Lung Carcinoma
J. Clin. Oncol., February 15, 2003; 21(4): 624 - 630.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. Beers, K. Honey, S. Fink, K. Forbush, and A. Rudensky
Differential Regulation of Cathepsin S and Cathepsin L in Interferon {gamma}-treated Macrophages
J. Exp. Med., January 20, 2003; 197(2): 169 - 179.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. S. Hodi, J. C. Schmollinger, R. J. Soiffer, R. Salgia, T. Lynch, J. Ritz, E. P. Alyea, J. Yang, D. Neuberg, M. Mihm, et al.
ATP6S1 elicits potent humoral responses associated with immune-mediated tumor destruction
PNAS, May 14, 2002; 99(10): 6919 - 6924.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. L. Disis, K. Rinn, K. L. Knutson, D. Davis, D. Caron, C. dela Rosa, and K. Schiffman
Flt3 ligand as a vaccine adjuvant in association with HER-2/neu peptide-based vaccines in patients with HER-2/neu-overexpressing cancers
Blood, April 15, 2002; 99(8): 2845 - 2850.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. K. Basak, A. Harui, M. Stolina, S. Sharma, K. Mitani, S. M. Dubinett, and M. D. Roth
Increased dendritic cell number and function following continuous in vivo infusion of granulocyte macrophage-colony-stimulating factor and interleukin-4
Blood, April 15, 2002; 99(8): 2869 - 2879.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Teshima, P. Reddy, K. P. Lowler, M. A. KuKuruga, C. Liu, K. R. Cooke, and J. L. M. Ferrara
Flt3 ligand therapy for recipients of allogeneic bone marrow transplants expands host CD8alpha + dendritic cells and reduces experimental acute graft-versus-host disease
Blood, March 1, 2002; 99(5): 1825 - 1832.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Ge, D. Palliser, H. N. Eisen, and J. Chen
Homeostatic T cell proliferation in a T cell-dendritic cell coculture system
PNAS, February 14, 2002; (2002) 52714199.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Teshima, C. Liu, K. P. Lowler, G. Dranoff, and J. L. M. Ferrara
Donor Leukocyte Infusion from Immunized Donors Increases Tumor Vaccine Efficacy after Allogeneic Bone Marrow Transplantation
Cancer Res., February 1, 2002; 62(3): 796 - 800.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C.-L. Tso, A. Zisman, A. Pantuck, R. Calilliw, J. M. Hernandez, S. Paik, D. Nguyen, B. Gitlitz, P. I. Shintaku, J. de Kernion, et al.
Induction of G250-targeted and T-Cell-mediated Antitumor Activity against Renal Cell Carcinoma Using a Chimeric Fusion Protein Consisting of G250 and Granulocyte/Monocyte-Colony Stimulating Factor
Cancer Res., November 1, 2001; 61(21): 7925 - 7933.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. R. Fischer, Y. Luo, M. Luo, L. Santambrogio, and M. E. Dorf
RANTES-Induced Chemokine Cascade in Dendritic Cells
J. Immunol., August 1, 2001; 167(3): 1637 - 1643.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Gillessen, N. Mach, C. Small, M. Mihm, and G. Dranoff
Overlapping roles for granulocyte-macrophage colony-stimulating factor and interleukin-3 in eosinophil homeostasis and contact hypersensitivity
Blood, February 15, 2001; 97(4): 922 - 928.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Honey, M. Duff, C. Beers, W. H. Brissette, E. A. Elliott, C. Peters, M. Maric, P. Cresswell, and A. Rudensky
Cathepsin S Regulates the Expression of Cathepsin L and the Turnover of gamma -Interferon-inducible Lysosomal Thiol Reductase in B Lymphocytes
J. Biol. Chem., June 15, 2001; 276(25): 22573 - 22578.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Ge, D. Palliser, H. N. Eisen, and J. Chen
Homeostatic T cell proliferation in a T cell-dendritic cell coculture system
PNAS, March 5, 2002; 99(5): 2983 - 2988.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mach, N.
Right arrow Articles by Dranoff, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mach, N.
Right arrow Articles by Dranoff, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online