| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Departments of Adult Oncology [N. M., S. G., G. D.] and Cancer Immunology and AIDS [S. B. W.], Dana-Farber Cancer Institute, and Department of Medicine [N. M., S. G., G. D.], Harvard Medical School, Boston, Massachusetts 02115; Department of Pathology and Laboratory Medicine, Albany Medical College, Albany, New York 12208 [C. S.]; and Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts 02114 [M. M.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
- and expressed higher levels of
B7–1 and CD1d than DCs cells generated by FL. Injection sites of
metastatic melanoma patients vaccinated with irradiated, autologous
tumor cells engineered to secrete GM-CSF demonstrated similar, dense
infiltrates of DCs expressing high levels of B7–1. These findings
reveal critical differences in the abilities of GM-CSF and FL to
enhance the function of DCs in vivo and have important
implications for the crafting of tumor vaccines. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The central importance of DCs in priming immune responses has generated substantial interest in manipulating these cells for the induction of antitumor immunity. The development of in vitro methods to propagate large numbers of DCs from hemopoietic progenitors (3, 4, 5, 6) has led to several studies that indicate that DCs can dramatically enhance antitumor immunity (7) . DCs pulsed with tumor antigen-derived peptides or whole tumor cell lysates and DCs genetically modified to express tumor antigens elicit striking antitumor effects in murine model systems (8, 9, 10, 11) . Initial clinical testing of DC-based vaccines has revealed the induction of tumor destruction in cancer patients as well, although the underlying effector mechanisms remain to be clarified (12 , 13) .
In contrast to these cancer vaccination strategies that involve the ex vivo manipulation of DCs, other approaches attempt to enhance DC function in vivo. The systemic administration of recombinant FL protein results in the marked expansion of both myeloid- and lymphoid-type DCs in many tissues (14, 15, 16, 17) and induces impressive antitumor effects in several murine models (18 , 19) . Tumor cells engineered to secrete FL also demonstrate reduced tumorigenicity (20) . These studies suggest that DCs can infiltrate implanted tumors and initiate processing of tumor antigens; however, nonspecific mechanisms are induced by FL as well, because antitumor effects are only partially compromised in SCID mice (18) .
We have demonstrated that vaccination with irradiated tumor cells engineered to secrete GM-CSF stimulates potent, specific, and long-lasting antitumor immunity in multiple murine tumor models (21) . Recently, we have extended these findings to patients with metastatic melanoma; as a consequence of vaccination, patients consistently develop intense CD4- and CD8-positive T lymphocyte and plasma cell infiltrates in metastatic lesions (22) . These reactions result in extensive tumor necrosis, fibrosis, and edema. Pathological analysis of the vaccination sites reveals a dense infiltrate of DCs, macrophages, eosinophils, and T lymphocytes in the dermis and s.c. tissues.
The abilities of several vaccination strategies involving DCs to
enhance antitumor immunity raises the intriguing question of whether
distinct or overlapping mechanisms underly the various approaches. To
begin to address this issue, we used the poorly immunogenic B16
melanoma model to compare the effects of GM-CSF and FL on DC function
and the concomitant induction of antitumor immunity. Although B16 cells
engineered to secrete either cytokine stimulated the marked expansion
of CD11c+ DCs both locally and systemically,
GM-CSF-expressing cells were more effective in eliciting systemic
antitumor immunity. The superior vaccination activity triggered by
GM-CSF involved the high level expression of B7–1 and CD1d on
CD8- DCs.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Recombinant Retroviruses.
Total RNA was obtained from C57Bl/6 spleens using TRIZOL (Life
Technologies, Inc., Grand Island, NY) according to the manufacturer’s
instructions. cDNA was synthesized using oligo-dT primers and MMLV
reverse transcriptase (Life Technologies, Inc.). A PCR was performed to
obtain cDNA encoding murine FL. The primers used were: sense strand 5'
CATATCATGACAGTGCTGGCGCCAGCC and antisense strand 5'
GTAAGGATCCTAGGGATGGGAGGGGAGG, derived from the published
sequence (23)
. The sense strand primer incorporates a
BspHI restriction site upstream of the initiator ATG, and
the antisense primer incorporates a BamHI restriction site
downstream of the termination codon. The conditions of the PCR were: 30
cycles of 96°C for 30 s, 50°C for 50 s, and 72°C for 3
min. The 711-bp amplified fragment was sequenced to confirm the
integrity of the cDNA, digested with BspHI and
BamHI, and subcloned into pMFG, as described previously
(21)
. The pMFG vector uses the MMLV long terminal repeat
sequences to generate both a full-length viral RNA (for encapsidation
into viral particles) and a subgenomic RNA that is responsible for
expression of inserted sequences. pMFG-FL and pMFG-murine GM-CSF
(21)
vectors were transfected into 293GPG cells to
generate high titer stocks of concentrated recombinant MMLV particles
that have incorporated the vesicular stomatitis virus G protein
(24)
.
Tumor Models.
B16-F10 melanoma cells (syngeneic to C57Bl/6 mice) were maintained in
DMEM containing 10% (vol/vol) FCS and penicillin/streptomycin. B16
cells were infected in the presence of polybrene (Sigma Chemical Co.),
and unselected populations were used for study, as described previously
(21)
. The proportion of tumor cells transduced with the
retroviral vector (which contains no selectable marker) was determined
by Southern analysis. GM-CSF secretion was determined by ELISA, as
described (21)
. No replication competent retrovirus is
generated in this system, as determined by the histidine mobilization
assay (25)
. For tumorigenicity experiments, 5
x 105 live, wild-type, or
cytokine-secreting B16 cells were injected s.c. in Hank’s balanced
saline solution (Life Technologies, Inc.); mice were sacrificed when
tumors reached 1.5–2 cm in longest diameter. For vaccination
experiments, mice were immunized s.c. on the abdominal wall with
5 x 105 irradiated (3500 rads),
cytokine-secreting B16 cells and 7 days later were challenged with
1 x 106 live, wild-type B16 cells
injected s.c. on the back.
Antibodies.
Fluorescence-activated cell sorting of splenocyte populations (depleted
of erythrocytes with ammonium chloride) were performed using FITC- or
phycoerythrin-conjugated monoclonal antibodies to CD11c, CD11b,
I-Ab, CD8, CD1d, CD3
, CD4, NK1.1, B7–1,
B7–2, and CD40 in the presence of blocking antibodies against the
Fc
III/II receptors (PharMingen).
Cellular Assays.
Mixed leukocyte reactions were performed by culturing 2
x 104
irradiated splenocytes (harvested 14
days after injection of live, cytokine-secreting tumor cells and
depleted of erythrocytes) with 2 x
104
nylon wool purified BALB/c T cells in RPMI
supplemented with 10% FCS, 2 mM L-glutamine,
10 mM HEPES, 1% penicillin/streptomycin, 0.1
mM nonessential amino acids, 1% sodium pyruvate, and
5 x 10-5 M 2-mercaptoethanol
(complete medium). After 4 days, [3H]thymidine
was added to the culture and incorporation was measured after 8 h
with liquid scintillation counting. For the measurement of
tumor-induced T cell cytokine production, splenocytes were harvested 7
days after vaccination with irradiated, cytokine-producing tumor cells,
depleted of erythrocytes, and cultured (1 x
106 cells) with irradiated (10,000 rads) B16
cells (2 x 104
) in 2 ml of
complete medium supplemented with 10 units/ml of IL-2. Supernatants
were harvested after 5 days and assayed for GM-CSF, IL-4, IL-5, and
IFN- by ELISA using the appropriate monoclonal antibodies (Endogen;
PharMingen).
Histology.
Tissues for pathological examination were fixed in 10% neutral
buffered formalin, processed to paraffin embedment, and stained with
H&E. In some cases, tissues were snap-frozen in liquid nitrogen and
sections were immunostained for protein expression using monoclonal
antibodies to CD11c, B7–1, CD3, and CD1a (PharMingen; DAKO).
Isotype-matched controls were included for each primary antibody.
Briefly, 4-µm sections were air-dried overnight and fixed in acetone
at 4°C. After incubation with hydrogen peroxide, biotin, and Fc
receptor blocking reagents, appropriate primary or isotype-matched
control antibodies were applied. The peroxidase- and alkaline
phosphatase-labeled streptavidin-biotin indirect methods were combined
with the appropriate substrate-chromogen, resulting in either a brown
or red precipitate at the antigen site. Finally, sections were
counterstained with hematoxylin and evaluated using light microscopy.
Human samples were obtained from vaccinated metastatic melanoma
patients, as reported previously (22)
.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Bioactivity of Cytokine-secreting Tumor Cells.
GM-CSF-secreting B16 cells generated approximately 300
ng/106 cells/48 h of bioactive protein, as
determined by ELISA (21)
. Because monoclonal antibodies to
FL were not available to us, we evaluated the production of bioactive
FL protein by analyzing the stimulation of hematopoiesis in C57Bl/6
mice that received injections of live, FL-secreting B16 cells.
Although the injection of wild-type B16 cells into C57Bl/6 mice resulted in only minimal changes in peripheral blood counts and splenocyte populations (data not shown), the injection of FL-secreting B16 cells produced dramatic alterations in hematopoiesis. FL-secreting B16 cells displayed only modest reductions in tumorigenicity (likely due to the poor immunogenicity of this tumor model) and, thus, constitutively released FL into the circulation. This cytokine production stimulated a marked leukocytosis, with total WBC counts reaching up to 17,000 (x10-3/ml) by day 14 after injection, similar to effects previously described with administration of recombinant human FL protein (26) . FL-secreting B16 cells also elicited marked generalized lymphadenopathy and splenomegaly. Pathological analysis of the splenic architecture revealed marked expansion of the marginal zones and periarteriolar T cell-rich regions and blurring of the red/white pulp boundaries (data not shown), alterations similarly induced by recombinant human FL protein (15) .
To determine whether FL-secreting B16 cells stimulated the expansion of
DCs systemically, as has been reported with recombinant FL protein
(14)
, we analyzed splenocyte populations for cells
expressing high levels of CD11c and MHC class II molecules. As shown in
Fig. 1A
, by 14 days after injection, FL-secreting B16 cells
produced a marked increase in cells staining positive for both markers,
with an average of 25% positive cells per spleen. Cytospin
preparations revealed substantial numbers of cells with dendritic
morphology (data not shown). In contrast, injection of wild-type B16
cells did not alter spleen cellularity or DC numbers (data not shown).
Because injection of FL-secreting B16 cells led to a 3–4-fold increase
in total spleen cellularity, overall this tumor line induced a nearly
100-fold increase in DC numbers. Moreover, these DCs functioned
efficiently as stimulators in mixed leukocyte reactions (data not
shown). Together, these findings demonstrate that FL-secreting B16
cells elicit comparable effects on hematopoietic populations as the
injections of recombinant FL protein (14)
.
|
, by 14 days after injection,
GM-CSF-secreting B16 cells also induced a marked increase in cells
staining positive for both markers, with an average of 15% positive
cells per spleen. Cytospin preparations revealed substantial numbers of
cells with dendritic morphology (data not shown). Since the total
spleen cellularity increased by 3-fold, this represented a 
40-fold
increase in DC numbers. Moreover, these cells functioned efficiently as
stimulators in mixed leukocyte reactions as well (data not shown).
These results demonstrate that both GM-CSF and FL stimulate DC
expansion in vivo.
Irradiated, Cytokine-secreting Tumor Cells Elicit Local DC
Accumulation.
Because both GM-CSF- and FL-secreting B16 cells formed tumors in
syngeneic hosts, we also examined the consequences of injecting
irradiated, cytokine-secreting tumor cells. Although irradiation
induces cell cycle arrest, it fails to inhibit cytokine production
in vitro for at least 7 days (21)
. Whereas
implantation of irradiated, wild-type B16 cells evoked only a scant
infiltrate (data not shown), implantation of irradiated, FL-secreting
B16 cells elicited an intense local reaction composed primarily of
lymphocytes and DCs (Fig. 2A
). Strong staining for CD11c was demonstrable in these
infiltrates (Fig. 2C
).
|
). Strong
staining for CD11c was also evident in these infiltrates (Fig. 2D
). Together, these findings indicate that both FL- and
GM-CSF-secreting B16 cells markedly increase DC numbers locally.
Generation of Protective Antitumor Immunity.
Because GM-CSF- and FL-secreting B16 cells both stimulated the
generation of DCs in vivo, we compared the relative
abilities of these cytokines to enhance the generation of antitumor
immunity. For these experiments, mice received immunizations s.c. with
irradiated, GM-CSF- or FL-secreting B16 cells and were challenged 1
week later with live, wild-type B16 cells. As shown in Fig. 3
, vaccination with irradiated, GM-CSF-secreting B16 cells stimulated
higher levels of protective antitumor immunity than vaccination with
irradiated, FL-secreting B16 cells. Similar results were found in five
independent experiments.
|
, and GM-CSF (22)
. To compare the relative
abilities of irradiated, GM-CSF- or FL-secreting B16 cells to induce
tumor-specific cytokine production in the mouse, we harvested
splenocytes 7 days after vaccination, cultured them for 5 days with
IFN--treated, irradiated B16 cells, and analyzed the supernatants by
ELISA. As shown in Fig. 4
, mice that received immunizations of irradiated, GM-CSF-secreting B16
cells developed T lymphocytes that produced high levels of IL-5,
IFN-, and GM-CSF. In contrast, vaccination with irradiated,
FL-secreting B16 cells resulted in weaker production of IFN- and
GM-CSF and minimal amounts of IL-5. IL-4 was not detected in either
group.
|
, GM-CSF-secreting B16 cells produced DCs
almost exclusively of the myeloid type, which expressed high levels of
CD11b and did not express CD8 (15
, 27)
. In contrast,
FL-secreting tumor cells produced the expansion of both lymphoid-
(CD8+, CD11b-) and
myeloid-type DCs (Fig. 5, B and D
), as was
reported following the administration of recombinant human FL protein
(14
, 15) . No differences were observed in the DC
expression of CD4 following injection of GM-CSF- or FL-secreting B16
cells (data not shown).
|
). GM-CSF also stimulated more uniform,
high level expression of B7–2, CD40, and MHC class II molecules than
FL, although these differences were less striking (Fig. 6,
C—F
, and Fig. 1, A and B
).
|
). Although previous studies using recombinant FL protein
had suggested that CD1d expression was restricted to
CD8+ DCs (15)
, these findings
reveal that GM-CSF induces the expression of this molecule on
CD8- DCs.
GM-CSF Activates DCs Locally.
To test whether the differences observed between GM-CSF- and
FL-activated DCs in the spleen were also demonstable locally, we
compared the expression of B7–1 in the infiltrates elicited by
irradiated, cytokine-secreting B16 cells. As shown in Fig. 7A
, GM-CSF-secreting B16 cells induced a high level of B7–1
staining at the immunization site, whereas little B7–1 staining was
found in the FL-elicited infiltrate (Fig. 7B
).
|
), similar to those observed in the murine studies (Fig. 2B
). Abundant CD1a staining of cells with dendritic
morphology was evident (Fig. 7D
), and these DCs expressed
high levels of B7–1 (Fig. 7E
). |
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
- DCs that express high levels of B7–1
and CD1d is critical to the potent antitumor activity of this cancer
vaccination strategy in mice and humans. Although many investigations have established that GM-CSF can induce DC development from hemopoietic progenitors in vitro (3, 4, 5, 6) , the capacity of this cytokine to enhance DC development in vivo has been less clearly defined. The systemic administration of recombinant murine GM-CSF protein elicted only minimal effects on splenic DC populations (14) , and GM-CSF transgenic mice did not manifest increased numbers of lymphoid tissue DCs (32) . The intradermal administration of recombinant GM-CSF protein to patients with leprosy also evoked only moderate, local DC accumulation (33) .
In contrast to these findings, our studies illustrate that the injection of GM-CSF-secreting tumor cells results in a dramatic expansion of DCs both locally and systemically. This stimulation likely reflects the efficient and stable production of GM-CSF protein by the MFG retroviral vector. Similar effects have been achieved recently with polyethylene glycol-modified recombinant GM-CSF protein (17) . Despite the impressive increase in DCs elicited by the pharmacological delivery of GM-CSF, we and others demonstrated that GM-CSF is dispensable for steady-state DC generation in vivo (34 , 35) .
Although several stimuli for DC activation in vitro have been identified, including GM-CSF, monocyte-conditioned medium, tumor necrosis factor, and CD40 ligand (36, 37, 38, 39) , less is known concerning the signals necessary for DC activation in vivo. Injection of lipopolysaccharide or extracts of Toxoplasma gondii has been shown, however, to evoke DC migration and maturation (40 , 41) , in part through the induction of IL-12, tumor necrosis factor, IL-1, and secondary lymphoid organ chemokine (42 , 43) . The experiments presented here establish that GM-CSF is a critical regulator of DC activation in vivo as well.
Because tumor cells secreting GM-CSF or FL both induce the marked expansion of DCs in vivo, our system rendered it possible to compare the functions of these cells in the development of antitumor immunity. Although other experiments indicate that both recombinant FL and GM-CSF protein can serve as effective adjuvants for soluble proteins antigens (17 , 44, 45, 46, 47) , the data presented here reveal that vaccination with irradiated tumor cells secreting GM-CSF is more potent than vaccination with irradiated tumor cells secreting FL.
The superior antitumor immunity stimulated by GM-CSF was associated with the induction of a broad T cell cytokine response, in contrast to the limited Th1 response induced by FL. Previously, we found similar, broad cytokine profiles in tumor-infiltrating lymphocytes derived from melanoma patients vaccinated with irradiated, autologous tumor cells engineered to secrete GM-CSF (22) . These observations, taken together with studies examining the efficacy of GM-CSF-based tumor vaccines in cytokine-deficient mice (48) , reveal important roles for both Th1 and Th2 cytokines in mediating tumor rejection.
The exclusive generation of myeloid-type DCs
(CD8- and CD11b+) by
GM-CSF-secreting tumors, in contrast to the generation of both
lymphoid- (CD8+ and
CD11b-) and myeloid-type DCs by FL-secreting
tumors, helps to explain the greater vaccination activity associated
with GM-CSF in two ways. First, recent studies indicate that
myeloid-type DCs elicit a broad cytokine response, whereas
lymphoid-type DCs elicit a Th1 response (17
, 49)
, perhaps
via antigen transfer (50)
. Second, because antigen
presentation stimulated by GM-CSF-based tumor cell vaccines involves
cross-priming by bone marrow-derived cells (51)
, the
capacity of DCs to phagocytose-irradiated cells (52, 53, 54)
is particularly relevant; the capture of apoptotic bodies by DCs
infiltrating tumor cells coexpressing GM-CSF and CD40 ligand has been
demonstrated (55)
. In this context,
CD8- DCs seem to be much more effective in
the ingestion of particulate antigens than
CD8+ DCs (15
, 56)
.
The comparison of DCs generated in vivo by GM-CSF and FL also revealed a striking difference in B7–1 expression. Whereas earlier work documented the capacity of GM-CSF to up-regulate B7–1 on cultured DCs (57) , the findings presented here illustrate that GM-CSF is more powerful than FL in augmenting B7–1 expression in vivo. This increase in B7–1 is likely to be important for the development of antitumor immunity, because recent work using T-cell clones has indicated that high level B7–1 expression markedly reduces the amount of antigen necessary to trigger T-cell proliferation and expands the diversity of cytokines released (58) . Experiments delineating the efficacy of GM-CSF-based tumor cell vaccines in B7–1 knockout mice (59) will help test this idea more thoroughly. A requirement for costimulatory function in antitumor immunity already has been established by demonstrating that vaccination with irradiated, GM-CSF-secreting tumor cells fails to induce protection against tumor challenge in CD40-deficient mice (60) .
Our comparative analysis also revealed a dramatic difference between
GM-CSF- and FL-generated DCs in the expression of CD1d. Although
previous studies suggested that CD1d was largely restricted to the
CD8+ population (15)
, the
experiments presented here show that CD1d can be expressed at very high
levels by CD8- DCs. Concomitant with the
induction of CD1d in animals injected with GM-CSF-secreting tumors was
a significant increase in the numbers of splenic NKT cells (date not
shown). Because activated NKT cells release large amounts of cytokines
(61)
, their stimulation by CD1d+ DCs
may be essential for amplifying the nascent antitumor immune response
and establishing the broad T cell cytokine profile. Indeed, other work
has shown that NKT cells are essential for the antitumor effects of
IL-12 (29)
. Experiments testing the activities of
GM-CSF-based vaccines in CD1d knockout mice (62, 63, 64)
should further clarify the role of NKT cells in antitumor immunity.
Lastly, our identification of a DC phenotype that results in the generation of potent antitumor immunity in vivo has important implications for the use of DCs in cancer vaccination strategies. It is of interest that many protocols involving the ex vivo expansion of DCs rely on the addition of monocyte-conditioned medium to produce functionally mature DCs (65) ; this requirement stems, in part, from the prior depletion of monocytes and granulocytes from the culture. An intriguing question raised by these observations is why hematopoietic progenitors capable of giving rise to granulocytes, macrophages, and DCs exist at all (66) . Examination of the vaccination sites of GM-CSF-secreting tumor cells reveals the marked accumulation of each of these cell types. It is, thus, tempting to speculate that the coordinated activation of DCs, macrophages, and granulocytes by GM-CSF is intricately linked to the development and differentiation of DCs in vivo; this culminates in the efficient priming of antigen-specific immune responses. This perspective suggests that appropriate pharmacological delivery of GM-CSF may have broad use for vaccination strategies.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by the Swiss National Science
Foundation (to N. M. and S. G.), the Swiss Cancer League (to S. G.),
NIH Grant AI45051 (to S. B. W.), the Cancer Research
Institute/Partridge Foundation, and National Cancer Institute Grant
CA74886 (to G. D.). 
3 To whom requests for reprints should be
addressed, at Dana-Farber Cancer Institute, Dana 510E, 44 Binney
Street, Boston, MA 02115. Phone: (617) 632-5051; Fax: (617) 632-5167;
E-mail: glenn_dranoff{at}dfci.harvard.edu
4 The abbreviations used are: DC, dendritic cell;
GM-CSF, granulocyte-macrophage colony-stimulating factor; FL,
Flt3-ligand; MMLV, Moloney murine leukemia virus; IL, interleukin.
Received 12/21/99. Accepted 4/14/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
cooperate in the generation of dendritic Langerhans cells. Nature (Lond.), 360: 258-261, 1992.[Medline]
14 NKT cells in IL-12-mediated rejection of tumors. Science (Washington DC), 278: 1623-1626, 1997. 14 NKT cells by glycosylceramides. Science (Washington DC), 278: 1626-1629, 1997.. J. Exp. Med., 179: 1109-18, 1994.+ and CD8- subclasses of dendritic cells direct the development of distinct T helper cells in vivo. J. Exp. Med., 189: 587-592, 1999.+ dendritic cells generate an immune response after subcutaneous injection without homing to the draining lymph node. J. Exp. Med., 189: 593-598, 1999.vß5 and CD36, and cross-present antigens to cytotoxic T lymphocytes. J. Exp. Med., 188: 1359-1368, 1998.This article has been cited by other articles:
|
|
 |
|
  M. B. Faries, E. C. Hsueh, X. Ye, M. Hoban, and D. L. Morton Effect of Granulocyte/Macrophage Colony-Stimulating Factor on Vaccination with an Allogeneic Whole-Cell Melanoma Vaccine Clin. Cancer Res., November 15, 2009; 15(22): 7029 - 7035. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Felio, H. Nguyen, C. C. Dascher, H.-J. Choi, S. Li, M. I. Zimmer, A. Colmone, D. B. Moody, M. B. Brenner, and C.-R. Wang CD1-restricted adaptive immune responses to Mycobacteria in human group 1 CD1 transgenic mice J. Exp. Med., October 26, 2009; 206(11): 2497 - 2509. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Curran and J. P. Allison Tumor Vaccines Expressing Flt3 Ligand Synergize with CTLA-4 Blockade to Reject Preimplanted Tumors Cancer Res., October 1, 2009; 69(19): 7747 - 7755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Darrasse-Jeze, S. Deroubaix, H. Mouquet, G. D. Victora, T. Eisenreich, K.-h. Yao, R. F. Masilamani, M. L. Dustin, A. Rudensky, K. Liu, et al. Feedback control of regulatory T cell homeostasis by dendritic cells in vivo J. Exp. Med., August 31, 2009; 206(9): 1853 - 1862. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Voedisch, C. Koenecke, S. David, H. Herbrand, R. Forster, M. Rhen, and O. Pabst Mesenteric Lymph Nodes Confine Dendritic Cell-Mediated Dissemination of Salmonella enterica Serovar Typhimurium and Limit Systemic Disease in Mice Infect. Immun., August 1, 2009; 77(8): 3170 - 3180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Segura, J. Wong, and J. A. Villadangos Cutting Edge: B220+CCR9- Dendritic Cells Are Not Plasmacytoid Dendritic Cells but Are Precursors of Conventional Dendritic Cells J. Immunol., August 1, 2009; 183(3): 1514 - 1517. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Zarei, F. Schwenter, P. Luy, M. Aurrand-Lions, P. Morel, M. Kopf, G. Dranoff, and N. Mach Role of GM-CSF signaling in cell-based tumor immunization Blood, June 25, 2009; 113(26): 6658 - 6668. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bedoui, S. Prato, J. Mintern, T. Gebhardt, Y. Zhan, A. M. Lew, W. R. Heath, J. A. Villadangos, and E. Segura Characterization of an Immediate Splenic Precursor of CD8+ Dendritic Cells Capable of Inducing Antiviral T Cell Responses J. Immunol., April 1, 2009; 182(7): 4200 - 4207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fonseca, R. Soiffer, V. Ho, M. Vanneman, M. Jinushi, J. Ritz, D. Neuberg, R. Stone, D. DeAngelo, and G. Dranoff Protein disulfide isomerases are antibody targets during immune-mediated tumor destruction Blood, February 19, 2009; 113(8): 1681 - 1688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Wolf, D. Buehler, S. E. Hensley, L. L. Cavanagh, E. J. Wherry, P. Kastner, S. Chan, and W. Weninger Plasmacytoid Dendritic Cells Are Dispensable during Primary Influenza Virus Infection J. Immunol., January 15, 2009; 182(2): 871 - 879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Quezada, K. S. Peggs, T. R. Simpson, Y. Shen, D. R. Littman, and J. P. Allison Limited tumor infiltration by activated T effector cells restricts the therapeutic activity of regulatory T cell depletion against established melanoma J. Exp. Med., September 1, 2008; 205(9): 2125 - 2138. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. P. Wang, G. N. Bowen, C. Padden, A. Cerny, R. W. Finberg, P. E. Newburger, and E. A. Kurt-Jones Toll-like receptor-mediated activation of neutrophils by influenza A virus Blood, September 1, 2008; 112(5): 2028 - 2034. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Iparraguirre, J. W. Tobias, S. E. Hensley, K. S. Masek, L. L. Cavanagh, M. Rendl, C. A. Hunter, H. C. Ertl, Ulrich. H. von Andrian, and W. Weninger Two distinct activation states of plasmacytoid dendritic cells induced by influenza virus and CpG 1826 oligonucleotide J. Leukoc. Biol., March 1, 2008; 83(3): 610 - 620. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Carreras, S. Turner, V. Paharkova-Vatchkova, A. Mao, C. Dascher, and S. Kovats Estradiol Acts Directly on Bone Marrow Myeloid Progenitors to Differentially Regulate GM-CSF or Flt3 Ligand-Mediated Dendritic Cell Differentiation J. Immunol., January 15, 2008; 180(2): 727 - 738. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Papenfuss, A. P. Kithcart, N. D. Powell, M. A. McClain, I. E. Gienapp, T. M. Shawler, and C. C. Whitacre Disease-modifying capability of murine Flt3-ligand DCs in experimental autoimmune encephalomyelitis J. Leukoc. Biol., December 1, 2007; 82(6): 1510 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Contractor, J. Louten, L. Kim, C. A. Biron, and B. L. Kelsall Cutting Edge: Peyer's Patch Plasmacytoid Dendritic Cells (pDCs) Produce Low Levels of Type I Interferons: Possible Role for IL-10, TGFbeta, and Prostaglandin E2 in Conditioning a Unique Mucosal pDC Phenotype J. Immunol., September 1, 2007; 179(5): 2690 - 2694. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wendland, N. Czeloth, N. Mach, B. Malissen, E. Kremmer, O. Pabst, and R. Forster CCR9 is a homing receptor for plasmacytoid dendritic cells to the small intestine PNAS, April 10, 2007; 104(15): 6347 - 6352. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. H. Hernandez, L. Shen, and K. L. Rock CD40-CD40 Ligand Interaction between Dendritic Cells and CD8+ T Cells Is Needed to Stimulate Maximal T Cell Responses in the Absence of CD4+ T Cell Help J. Immunol., March 1, 2007; 178(5): 2844 - 2852. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Parroche, F. N. Lauw, N. Goutagny, E. Latz, B. G. Monks, A. Visintin, K. A. Halmen, M. Lamphier, M. Olivier, D. C. Bartholomeu, et al. From the Cover: Malaria hemozoin is immunologically inert but radically enhances innate responses by presenting malaria DNA to Toll-like receptor 9 PNAS, February 6, 2007; 104(6): 1919 - 1924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gonzalez-Juarrero, J. M. Hattle, A. Izzo, A. P. Junqueira-Kipnis, T. S. Shim, B. C. Trapnell, A. M. Cooper, and I. M. Orme Disruption of granulocyte macrophage-colony stimulating factor production in the lungs severely affects the ability of mice to control Mycobacterium tuberculosis infection J. Leukoc. Biol., June 1, 2005; 77(6): 914 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. M. Bernt, S. Ni, A.-T. Tieu, and A. Lieber Assessment of a Combined, Adenovirus-Mediated Oncolytic and Immunostimulatory Tumor Therapy Cancer Res., May 15, 2005; 65(10): 4343 - 4352. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Driessens, M. Hamdane, V. Cool, T. Velu, and C. Bruyns Highly Successful Therapeutic Vaccinations Combining Dendritic Cells and Tumor Cells Secreting Granulocyte Macrophage Colony-stimulating Factor Cancer Res., November 15, 2004; 64(22): 8435 - 8442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Iijima, M. F. Neurath, T. Nagaishi, J. N. Glickman, E. E. Nieuwenhuis, A. Nakajima, D. Chen, I. J. Fuss, N. Utku, D. N. Lewicki, et al. Specific Regulation of T Helper Cell 1-mediated Murine Colitis by CEACAM1 J. Exp. Med., February 17, 2004; 199(4): 471 - 482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Li, P.-Y. Pan, P. Gu, D. Xu, and S.-H. Chen Role of Immature Myeloid Gr-1+ Cells in the Development of Antitumor Immunity Cancer Res., February 1, 2004; 64(3): 1130 - 1139. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Soiffer, F. S. Hodi, F. Haluska, K. Jung, S. Gillessen, S. Singer, K. Tanabe, R. Duda, S. Mentzer, M. Jaklitsch, et al. Vaccination With Irradiated, Autologous Melanoma Cells Engineered to Secrete Granulocyte-Macrophage Colony-Stimulating Factor by Adenoviral-Mediated Gene Transfer Augments Antitumor Immunity in Patients With Metastatic Melanoma J. Clin. Oncol., September 1, 2003; 21(17): 3343 - 3350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gillessen, Y. N. Naumov, E. E. S. Nieuwenhuis, M. A. Exley, F. S. Lee, N. Mach, A. D. Luster, R. S. Blumberg, M. Taniguchi, S. P. Balk, et al. CD1d-restricted T cells regulate dendritic cell function and antitumor immunity in a granulocyte-macrophage colony-stimulating factor-dependent fashion PNAS, July 22, 2003; 100(15): 8874 - 8879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. S. Hodi, M. C. Mihm, R. J. Soiffer, F. G. Haluska, M. Butler, M. V. Seiden, T. Davis, R. Henry-Spires, S. MacRae, A. Willman, et al. Biologic activity of cytotoxic T lymphocyte-associated antigen 4 antibody blockade in previously vaccinated metastatic melanoma and ovarian carcinoma patients PNAS, April 15, 2003; 100(8): 4712 - 4717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Schmollinger, R. H. Vonderheide, K. M. Hoar, B. Maecker, J. L. Schultze, F. S. Hodi, R. J. Soiffer, K. Jung, M. J. Kuroda, N. L. Letvin, et al. Melanoma inhibitor of apoptosis protein (ML-IAP) is a target for immune-mediated tumor destruction PNAS, March 18, 2003; 100(6): 3398 - 3403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Salgia, T. Lynch, A. Skarin, J. Lucca, C. Lynch, K. Jung, F. S. Hodi, M. Jaklitsch, S. Mentzer, S. Swanson, et al. Vaccination With Irradiated Autologous Tumor Cells Engineered to Secrete Granulocyte-Macrophage Colony-Stimulating Factor Augments Antitumor Immunity in Some Patients With Metastatic Non-Small-Cell Lung Carcinoma J. Clin. Oncol., February 15, 2003; 21(4): 624 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Beers, K. Honey, S. Fink, K. Forbush, and A. Rudensky Differential Regulation of Cathepsin S and Cathepsin L in Interferon {gamma}-treated Macrophages J. Exp. Med., January 20, 2003; 197(2): 169 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. S. Hodi, J. C. Schmollinger, R. J. Soiffer, R. Salgia, T. Lynch, J. Ritz, E. P. Alyea, J. Yang, D. Neuberg, M. Mihm, et al. ATP6S1 elicits potent humoral responses associated with immune-mediated tumor destruction PNAS, May 14, 2002; 99(10): 6919 - 6924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. L. Disis, K. Rinn, K. L. Knutson, D. Davis, D. Caron, C. dela Rosa, and K. Schiffman Flt3 ligand as a vaccine adjuvant in association with HER-2/neu peptide-based vaccines in patients with HER-2/neu-overexpressing cancers Blood, April 15, 2002; 99(8): 2845 - 2850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Basak, A. Harui, M. Stolina, S. Sharma, K. Mitani, S. M. Dubinett, and M. D. Roth Increased dendritic cell number and function following continuous in vivo infusion of granulocyte macrophage-colony-stimulating factor and interleukin-4 Blood, April 15, 2002; 99(8): 2869 - 2879. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Teshima, P. Reddy, K. P. Lowler, M. A. KuKuruga, C. Liu, K. R. Cooke, and J. L. M. Ferrara Flt3 ligand therapy for recipients of allogeneic bone marrow transplants expands host CD8alpha + dendritic cells and reduces experimental acute graft-versus-host disease Blood, March 1, 2002; 99(5): 1825 - 1832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Ge, D. Palliser, H. N. Eisen, and J. Chen Homeostatic T cell proliferation in a T cell-dendritic cell coculture system PNAS, February 14, 2002; (2002) 52714199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Teshima, C. Liu, K. P. Lowler, G. Dranoff, and J. L. M. Ferrara Donor Leukocyte Infusion from Immunized Donors Increases Tumor Vaccine Efficacy after Allogeneic Bone Marrow Transplantation Cancer Res., February 1, 2002; 62(3): 796 - 800. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-L. Tso, A. Zisman, A. Pantuck, R. Calilliw, J. M. Hernandez, S. Paik, D. Nguyen, B. Gitlitz, P. I. Shintaku, J. de Kernion, et al. Induction of G250-targeted and T-Cell-mediated Antitumor Activity against Renal Cell Carcinoma Using a Chimeric Fusion Protein Consisting of G250 and Granulocyte/Monocyte-Colony Stimulating Factor Cancer Res., November 1, 2001; 61(21): 7925 - 7933. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. R. Fischer, Y. Luo, M. Luo, L. Santambrogio, and M. E. Dorf RANTES-Induced Chemokine Cascade in Dendritic Cells J. Immunol., August 1, 2001; 167(3): 1637 - 1643. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gillessen, N. Mach, C. Small, M. Mihm, and G. Dranoff Overlapping roles for granulocyte-macrophage colony-stimulating factor and interleukin-3 in eosinophil homeostasis and contact hypersensitivity Blood, February 15, 2001; 97(4): 922 - 928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Honey, M. Duff, C. Beers, W. H. Brissette, E. A. Elliott, C. Peters, M. Maric, P. Cresswell, and A. Rudensky Cathepsin S Regulates the Expression of Cathepsin L and the Turnover of gamma -Interferon-inducible Lysosomal Thiol Reductase in B Lymphocytes J. Biol. Chem., June 15, 2001; 276(25): 22573 - 22578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Ge, D. Palliser, H. N. Eisen, and J. Chen Homeostatic T cell proliferation in a T cell-dendritic cell coculture system PNAS, March 5, 2002; 99(5): 2983 - 2988. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
