| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Imperial Cancer Research Fund, Clare Hall Laboratories, South Mimms, Herts EN6 3LD, United Kingdom [P. M., P. K.], Dipartimento di Oncologia Sperimentale, Istituto Nazionale per lo Studio e la Cura dei Tumori, 20133 Milano, Italy [A. B.], and Institute of Medical Radiobiology, University of Zürich, CH-8008 Zürich, Switzerland [M. S., J. J.]
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
MGMT expression varies widely among human cells (3 , 4) . In extreme cases, cells produce no MGMT protein despite retaining an intact MGMT gene. These Mex- cell lines comprise approximately 25% of those transformed in vitro or cultured from tumors (for review see Ref. 1 ). It has been known for some time that the MGMT gene is susceptible to epigenetic regulation associated with an altered frequency of DNA 5-meC residues in CpG dinucleotides (5, 6, 7, 8) . This "biological" methylation (for a recent review see Ref. 9 ) is distinct from "chemical" methylation mediated by agents such as MNU or temozolomide, which modify the nitrogen and oxygen atoms of DNA. Early studies indicated that regulation of MGMT expression was complex and the MGMT gene was highly methylated in expressing Mex+ cells (5 , 6 , 10) . The most recent studies using the bisulfite DNA sequencing technique (11) have suggested that the level of MGMT is inversely related to the density of CpG methylation in the MGMT promoter (12, 13, 14) .
Resistance to methylating agents may also develop via
tolerance of DNA O6-methylguanine.
Methylation tolerance is a consequence of an abrogated long patch MMR
pathway (for review see Ref. 15
). Inactivation of one of
the components of two essential MMR complexes, hMutS
(a heterodimer
comprising the hMSH2 and hMSH6 proteins (16)
or hMutL
(hMLH1 and hPMS2; Ref. 17
), is sufficient to confer a high
level of methylating agent resistance in a Mex-
cell. MMR defective variants have been isolated from several
Mex- human cell lines by a simple selection for
resistance to MNU or
N-methyl-N'-nitro-N-nitrosoguanidine.
A number of independent MNU-resistant variants of the Burkitts
lymphoma cell line Raji were recently assigned to two categories
(18)
. Some had regained expression of the MGMT
gene, whereas the predominant fraction became methylation tolerant
through the impairment of hMutS
functionmost likely of the hMSH6
subunit. Because the MGMT gene was known to be
epigenetically regulated, the latter findings suggested that
hMSH6 might also be susceptible to suppression through
methylation. The ability of identical treatment to elicit two distinct
types of phenotypic change, MGMT reactivation and hMSH6
loss, in a single cell type offered a unique opportunity to examine the
factors that might regulate the expression of these genes. Here, we
report that, although MGMT regulation in Raji cells is
influenced by CpG methylation, the relationship between the
methylation status of the MGMT promoter and its
transcriptional activity is complex, inasmuch as a high level of
methylation failed to attenuate the expression of the gene. In
contrast, expression of hMSH6 seems to be regulated by cytosine
methylation in the more conventional, inverse fashion. Treatment with a
demethylating agent could reactivate the silenced hMSH6
gene, and a high density of CpG promoter methylation efficiently
reduced its expression. hMSH6, therefore, joins the
hMLH1 MMR gene (19, 20, 21)
as a potential
candidate for suppression by this mutation-free mechanism in human
tumors.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines.
The Mex+ and Mex- cell
lines and the MNU-resistant variants were maintained as described
previously (18)
. The HT29 colorectal cancer cell line was
obtained from C. Dixon (Cancer Genetics Laboratory, Imperial Cancer
Research Fund) and cultured as described previously (22)
.
HeLa cells were maintained in DMEM (Life Technologies, Inc.)
supplemented with 10% FCS. Human embryonic kidney 293 cells were
maintained in DMEM D5671 (Sigma Chemical Co.) supplemented with 2%
inactivated horse serum. Both media contained 2 mM
L-glutamine, 100 units/ml penicillin, and 100 µg/ml
streptomycin. For starvation medium, the inactivated horse serum
concentration was reduced to 0.2%. Cells were synchronized at the
G1-S boundary by transfer to starvation medium
for 48 h, followed by return to complete medium supplemented with
100 µM L-mimosine for a further 14 h.
DNA Isolation and Bisulfite Treatment.
DNA was isolated essentially following the method of Wu et
al. (23)
. Bisulfite treatment was carried out
following the modified (24)
procedure of Frommer et
al. (11)
. Briefly, 5 µg of genomic DNA were
digested with EcoRI (New England Biolabs) and denatured with
0.3 M NaOH for 15 min at 37°C. A freshly prepared solution of sodium
metabisulfite (2.5 M, pH 5.0) and hydroquinone (100
mM) was added to the denatured DNA, and the
mixture was incubated at 55° for 5 h. After desalting (Wizard
Clean Up System; Promega), the DNA was desulphonated with 0.3 M NaOH
for 15 min at 37°C. The solution was neutralized with 5 M ammonium
acetate (pH 7.0), and the DNA was ethanol precipitated and resuspended
in Tris-EDTA (pH 7.5).
PCR Amplification, DNA Cloning, and Sequencing.
Part of the MGMT 5' CpG island was amplified as two PCR
products, using primers established by Qian and Brent
(12)
. First-round PCR was carried out using the sense
primer 1 (TTAAGGTATAGAGTTTTAGGCGGAAGTTGG, positions -284/-255) and
the antisense primer 2 (AAAACGAAACGACCCAAACACTCACCAAAT, positions
+156/+185). This was followed by a second round of amplification using
primer 1 and the nested antisense primer 3
(AAACGAAACCCGAACGAAACGAAATATTCC) for fragment A and primer 2 and the
nested sense primer 4 (TTTAGCGAGGATGTGTAGATTGTTTTAGGT, positions
-159/-127) for fragment B. The amplifications were carried out
starting from 0.5 µg of bisulfite-treated DNA under the following
conditions: 95°C for 3 min; then 30 cycles of 95°C for 1 min,
60°C for 1 min, and 72°C for 1 min; and finally 1 cycle of 72°C
for 7 min. Amplified DNA was ligated into the
pBS-SK- vector (Stratagene) and transformed into
Escherichia coli. Several clones for each DNA
were sequenced using a Sequenase version 2.0 DNA sequencing kit
(Amersham).
5-Aza-2'-Deoxycytidine Treatment.
Raji cells seeded in exponential growth were treated with
5-aza-2'-deoxycytidine for four cycles of 24 h each during a
5-week period. The drug was removed, and the cells were maintained in
fresh medium until normal growth resumed. At this point, they were
either harvested for analysis or retreated with drug. Initial
treatments were carried out at a concentration of 1 µM.
This was increased to 3 µM for subsequent treatments.
Western Blot Analysis.
Cells were lysed on ice for 1 h using a buffer containing
1% NP40, 10 mM NaF, 1 mM
NaH3O4, 10 mM
NaHPO4, 1 µg/ml leupeptin, 2 µg/ml aprotinin,
and 1 mM AEBSF in PBS and centrifuged at 15,000
x g for 30 min. Fifty micrograms of each extract were
separated on 8% SDS-polyacrylamide gels. The proteins were transferred
to polyvinylidene difluoride membranes (Millipore) using a semidry
electrophoretic transfer apparatus (Bio-Rad) at room temperature. The
membranes were blocked for 1 h in PBS-T (containing 0.1% Tween
20) plus 5% powdered skim milk and incubated overnight at 4°C with
rabbit anti-MSH6 or mouse anti-PCNA antibodies diluted in PBS-T
containing 5% BSA. The filters were then incubated for 1 h with
the appropriate horseradish peroxidase-linked secondary antibody
(Bio-Rad) in PBS-T/5% BSA solution. Bound antibody was detected using
the enhanced chemiluminescence detection kit (Amersham International).
RNA Isolation and RT-PCR.
Extraction of total cellular RNA was carried out using Trizol reagent
(Life Technologies, Inc.) according to manufacturers instructions.
Approximately 300 ng of RNA were reverse-transcribed with random
hexamers (Perkin-Elmer Corp.). Amplification of all cDNAs was performed
under the following PCR conditions: 5 min at 95°C for 1 cycle; then
29 cycles of 95°C for 1 min, 59°C for 30 s, and 72°C for 1
min; and a final elongation step at 72°C for 7 min. The primers used
for the amplification were as follows:
ß Actin: (25)
Sense: ACACTGTGCCCATCTACGAGG
Antisense: AGGGGCCGGACTCGTCATACT
MGMT: (26)
Sense: GTGGGAGGAGCAATGAGAGG
Antisense: TCCCGCTCCCTTGAGCCAGG
hMSH6: (25)
Sense: CCCTCAGCCACCAAAGAAGCA
Antisense: CTGCCACCACTTCCTCATCCC.
The amplified ß-actin fragment spans several exon-intron boundaries and was used as a control for DNA contamination. The RT-PCR products were separated by electrophoresis on a 3% agarose gel, stained with ethidium bromide, and visualized by UV light.
MGMT Measurements.
The MGMT activity in cell extracts was determined as described
previously (27)
.
Isolation and Characterization of Clones Containing the hMSH6 5'
Flanking Region.
The P1 clone 6261 (kindly provided by C. Lengauer and B.
Vogelstein) containing the 5' flanking region and part of the
coding region of hMSH6 was randomly digested with
HindII and subcloned into pUC18. The promoter region was
identified by screening this DNA library using a primer, M1AS, designed
from the sequence of the 5'-flanking region of hMSH6:
5'-CCAGTGGCCAATCAACAGGCG-3' (positions -125 to -146). (The hMSH6
genomic sequence and a portion of the 5' untranslated sequence are
available; GenBank accession no. AH005068).
The nucleotide sequence of the 5'-flanking region and part of the exon/intron boundary were determined using the ABI Prism dye terminator sequencing kit (Perkin-Elmer Corp.) and a PE 310 sequencer (Perkin-Elmer Corp.).
Reporter Gene Plasmid Constructs.
Two hMSH6 upstream fragments were tested for the ability to
drive the expression of the firefly luciferase reporter gene in the
promoterless plasmid pGL3-Basic (Promega). A 4.8-kb
KpnI-NgoMIV fragment was inserted between the
KpnI and XmaI sites upstream from the firefly
luciferase reporter gene in pGL3-Basic. This construct was designated
pGL3 M6US-3558. For the construction of the other deletion mutant, pGL3
M6US-3558 was digested with MluI, rendered blunt-ended with
T4 DNA polymerase, and self-ligated. The resulting construct was
designated "pGL3 M6US-143." The orientation and sequence of the
inserts were verified by sequencing through the insert-vector
junctions. Plasmid DNA purifications were carried out using the Qiagen
Midi- or Maxi-prep kit (Qiagen, Inc.).
Transient Transfections and Dual Luciferase Activity Assays.
HeLa cells (3 x 105) were
plated in 35-mm dishes. Following a 24-h incubation, they were
transfected with the nonliposomal formulation FuGENE 6 transfection
reagent (Boehringer Mannheim), according to manufacturers
instructions. Each deletion construct (0.5 pmol) was combined with 55
fmol of the pRL-TK vector (Promega) as an internal control in 100 ml of
serum-free DMEM containing FuGENE 6 (5 µl). (pRL-TK encodes the
Renilla luciferase, and its activity can be distinguished from that of
the firefly luciferase encoded in the pGL3-Basic in the Dual-Luciferase
Assay System, Promega). The FuGENE 6 Reagent/DNA complex was allowed to
stand for 15 min at room temperature and was then added dropwise to the
cell cultures and evenly dispersed. The cell extracts were prepared
40 h after transfection, using reporter lysis buffer (300 µl;
Promega). The dual luciferase reporter assays were carried out on each
lysate (5 ml), as recommended by the manufacturer (Promega). Luciferase
activities were measured in a lumicounter. The transactivation activity
of each construct was normalized to the Renilla luciferase internal
control. All transfections were carried out in duplicate and repeated
at least twice.
Promoter Methylation Studies.
Plasmid pGL3 M6US-3558, containing the complete promoter region, and
the deletion construct pGL3 M6US-143 were methylated by
M.SssI, or M.HhaI methyltransferases (New England
Biolabs). Methylation by M.HhaI (4 units) was performed for
1 h at 37°C in 50 mM Tris-HCl (pH7.5), 10
mM EDTA, 5 mM
ß-mercaptoethanol, and 80 µM
S-adenosylmethionine. M.SssI methylation was carried out for
1 h at 37°C with 10 units of M.SssI in 10
mM Tris-HCl (pH 7.5), 50 mM
NaCl, 10 mM MgCl2, 1
mM DTT, and 80 µM
S-adenosylmethionine. The reactions were terminated by heating at
65°C for 10 min. Complete methylation was defined by resistance to
cleavage by HhaI and HpaII restriction
endonucleases, as determined by agarose gel electrophoresis. Only
plasmids that were completely resistant to digestion were used in the
transfection experiments aimed at determining the effects of CpG
methylation on hMSH6 expression in vivo.
| RESULTS |
|---|
|
|
|---|
, most likely in
hMSH6. All of the variants share a similar 40-fold resistance to MNU,
and the MMR-deficient clones also exhibit a modestly increased rate of
spontaneous mutation in microsatellites and at the HPRT
locus.
Promoter Methylation and MGMT Expression.
The methylation status of the MGMT promoter was analyzed by
direct DNA sequencing following bisulfite-induced deamination of
cytosine residues. DNA isolated from the Mex+
"revertants" Raji 101, Raji 105, and the methylation tolerant
Mex- Raji 9 was compared with that of HT29,
RajiMex+, and RajiMex-,
which served as controls. The DNA samples were digested with
EcoRI, denatured, and deaminated with sodium bisulfite. The
region -258 to +148, which includes the minimal MGMT
promoter, the putative SP1 binding sites, and most of the untranslated
exon 1 (Fig. 1a
), was then amplified by PCR and cloned. At least 10 clones
were sequenced for each cell line. Inspection confirmed that cytosines
in non-CpG elements had been quantitatively converted to uracil by the
bisulfite treatment. Fig. 1b
is an example of this analysis
for the -133 to -53 region of the Mex+ HT29 and
the RajiMex- cell lines.
|
|
In summary, a high density of methylation within the core promoter region is not incompatible with MGMT gene expression. The almost complete absence of cytosine methylation in the MGMT promoter of the Mex+ human colorectal tumor cell line HT29 was confirmed. The similar methylation patterns of the Raji Mex- and Raji Mex+MGMT promoters and the retention of extensive promoter methylation in the Mex+ Raji 101 or Raji 105 variants indicate that MGMT can be expressed from a methylated promoter. The tendency toward increased CpG methylation in MNU-treated cells suggests that MNU may induce, or select, cells with higher levels of CpG methylation.
MGMT Expression following Azadeoxycytidine Exposure.
The Mex- phenotype is associated with a
transcriptional silencing of the MGMT gene. RT-PCR of MGMT
cDNA confirmed that RajiMex- cells do not
express detectable MGMT mRNA (Fig. 3a
). MGMT cDNA from RajiMex+ and Raji
101 cells was, however, readily amplified. We investigated whether MGMT
expression in Raji cells could be altered by modulating the level of
5-meC in their DNA. RajiMex+ and Raji 101 cells
were treated with the methylation inhibitor AzadC. MGMT mRNA levels in
RajiMex+ and Raji 101 cells were reduced by AzadC
treatment. As determined by semiquanitiative RT-PCR, we estimate that
MGMT expression was reduced by about 510-fold in Raji 101 cells and
by approximately 23-fold in RajiMex+ cells.
|
Overall, the observations are consistent with a positive correlation between DNA 5-meC and MGMT expression in Raji cells. Promoter methylation is clearly not the only determinant of MGMT expression. Demethylation is associated with reduced MGMT mRNA and protein levels. These data imply that Raji MGMT is expressed from a methylated gene and that some level of cytosine methylation is a prerequisite for its expression. This essential methylation is presumably outside of the promoter regions.
Loss of hMSH6 Expression in Methylation-tolerant Raji Cells.
The Raji 104 clone was selected at the same time and using the same
protocol as Raji 101 and Raji 105. RajiF12 was isolated by a similar
protocol and has been in culture for several years (28)
.
Both Raji 104 and RajiF12 exhibit stable defects in the hMSH6 function
of MMR and are unable to correct single base mispairs in an in
vitro assay (18)
. RajiF12 is deficient in mismatch
binding. The hMSH6 function is also defective in Raji 9, which was
selected by acute MNU exposure. We analyzed hMSH6 protein levels in
these cells by immunoblotting (Fig. 4
). The hMSH6 protein was easily detectable in extracts of parental
RajiMex- cells and in extracts of three other
MMR defective variants (Raji 7, Raji 19, and Raji 10). In contrast,
hMSH6 was significantly less abundant or undetectable in extracts of
the RajiF12, Raji 9, and Raji 104 variants. Thus, the hMSH6 defect in
RajiF12, Raji9 and Raji104 is associated with significantly reduced
levels of the protein. Because Raji 9 extracts contained the lowest
level of hMSH6, we investigated the regulation of hMSH6 gene
expression in this variant.
|
|
hMSH6 Reactivation by Azadeoxycytosine.
hMSH6 gene expression was analyzed by RT-PCR before and
after AzadC treatment. hMSH6 mRNA was amplified to similar extents from
RajiMex+ and RajiMex-
cells. In contrast, little or no amplification was observed for Raji 9
cells (Fig. 6a
). This observation suggests that the much reduced level of
hMSH6 in Raji 9 cells is a consequence of either transcriptional
down-regulation or production of unstable mRNA.
|
In summary, methylation tolerance is associated with loss of hMSH6 function in Raji 9 and other Raji cell variants. This, in turn, is correlated with a significant reduction in the levels of hMSH6 protein. Dense methylation in vitro of its CpG island reduces the effectiveness of the hMSH6 promoter in a reporter construct. In vivo, hMSH6 expression was restored following exposure of Raji 9 to AzadC. This reactivation was evident at both the mRNA and protein levels. All these observations are consistent with a role for increased DNA cytosine methylation in down-regulating hMSH6 expression.
| DISCUSSION |
|---|
|
|
|---|
The properties of the Raji variants were nevertheless consistent with epigenetic control of MGMT. Demethylation by 5-AzadC diminished MGMT activity by reducing the level of MGMT transcripts. A similar reduction in MGMT protein expression has been noted in the HT29 (5) and IMR-90 (30) cell lines exposed to a demethylating agent. A simple explanation for these observations is that a degree of methylation is required for MGMT gene expression and that the modified sequences lie outside of the region containing the promoter and the first exon. We have not identified these putative controlling elements, but there are two likely candidate regions. Methylation of an EcoRI restriction site within the first intron has been positively correlated with MGMT expression (10) . In addition, exon 3 is highly CpG rich and meets many of the criteria of a CpG island. However, whereas most of the data on MGMT expression are consistent with the above model, there are exceptions. Spontaneous switching from a Mex+ to a Mex- phenotype in the human lymphoblastoid cell line GM1953 is accompanied by a significant increase in methylation of MGMT sequences (6) , whereas azadC-induced reactivation of MGMT in HeLa cells is accompanied by promoter demethylation (12 , 30) . This suggests that additional or alternative factors may influence MGMT expression in long-term cultured tumor cells. These might include alterations in methylation density within extensive regions of chromatin, which would override the effects within a specific gene (33) .
Promoter methylation has been correlated with the absence of MGMT expression in tumors (13) . The same immunohistochemical analysis also suggested that up to 40% of certain tumor types may be Mex-. The fact that this value is about 2-fold higher than that estimated previously from the analysis of MGMT activity in similar tumors (34, 35, 36) might simply reflect a difference in the immunohistochemical scoring of tumors that resemble Raji cells, with methylated promoters but low or intermediate MGMT levels, as Mex-. This would incorrectly imply a correlation between promoter methylation and the Mex- phenotype, and overestimate the fraction of true Mex- tumors. In this regard, it is noteworthy that although high levels of MGMT expression were associated with methylation-free promoter sequences in a series of colorectal carcinoma biopsies, promoter methylation status was not predictive for medium or low MGMT expression (37) . We emphasize that our data also indicate that MGMT promoter methylation is not diagnostic for the Mex- phenotype. A highly methylated MGMT promoter is fully compatible with a significant level of MGMT expression.
The hMSH6 protein is a component of the hMutS
mismatch recognition
complex, which is essential for correction of most replication errors.
hMSH6-defective cells exhibit increased rates of spontaneous mutation
(for review see Ref. 38
) and transgenic MSH6-deficient
mice are cancer prone (39)
. Although bisulfite sequencing
analysis of the hMSH6 promoter was unsuccessful, other
approaches provided evidence for epigenetic down-regulation of this key
MMR gene. hMSH6 expression was compatible with the conventional inverse
relationship between gene expression and methylation, and the
hMSH6 promoter could be shown to be inactivated by CpG
methylation in vitro. The hMSH6 gene, therefore,
joins hMLH1 as a target for epigenetic regulation in tumors
(19, 20, 21)
. Silencing of hMLH1 is common in
sporadic colorectal carcinomas, which are defective in MMR. Indeed, it
has been suggested that this mechanism may account for the majority of
MMR defects associated with the nonfamilial forms of this disease
(40)
. It is important to note that the strategy used in
this study to select the Raji variants has also yielded Raji
(18)
or A2780 ovarian carcinoma cells with
transcriptionally silenced hMLH1
genes.5
The diagnosis of MMR deficiency in colorectal carcinoma has, to date, depended heavily on the demonstration of dinucleotide repeat microsatellite instability. Although this approach successfully detects hMLH1-mutated tumors, the microsatellite instability associated with hMSH6-defective tumors is likely to be more subtle and to be largely confined to mononucleotide repeats. It is possible that a more thorough analysis of mononucleotide repeat instability in sporadic colorectal carcinoma will uncover a subset of tumors in which hMSH6 has been silenced epigenetically.
Epigenetic alteration of MGMT expression is associated with a modified chromatin configuration (33 , 41) . One important implication of the present study is that treatment of cells with simple methylating agents might trigger (or select for) CpG-related chromatin remodeling. These changes promote the emergence of resistance to methylating agents either through increased repair, by up-regulation of MGMT, or through tolerance, by loss of hMSH6 expression. A similar situation might exist in tumors. The causes and the consequences of the widespread alterations in CpG methylation levels in tumors are poorly understood, but it would seem that both endogenous and exogenous agents might be involved in this process. Our data raise the possibility that cytosine methylation-related chromatin remodeling might be triggered through chemotherapy. The interrelationships among chemotherapeutic agents, the levels of cytosine methylation, histone acetylation, and chromatin remodeling are of paramount importance to human cancer and merit closer investigation.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by the Swiss National Science
Foundation (to M. S. and J. J.). A. B.s stay in the Imperial
Cancer Research Fund laboratories on leave from the Istituto Nazionale
per lo Studio e la Cura dei Tumori (Milano, Italy) was supported by a
grant from the Italian Consiglio Nazionale delle Ricerche and from
funds provided under EU Concerted Action Contract
BMH4-CT98-3045. ![]()
2 To whom requests for reprints should be
addressed, at Imperial Cancer Research Fund, Clare Hall Laboratories,
Blanche Lane-South Mimms, Potters Bar, Herts EN6 3LD, United Kingdom.
Phone: 44-20-72693870; Fax: 44-20-72693812; E-mail: karran{at}icrf.icnet.uk ![]()
3 The abbreviations used are: MNU,
N-methyl-N-nitrosourea; MGMT,
O6-methylguanine-DNA methyltransferase;
5-meC, 5-methylcytosine; MMR, mismatch repair; PBS-T, PBS containing
0.1% Tween 20; RT-PCR, reverse transcription-PCR; AzadC,
5-azadeoxycytidine. ![]()
4 P. Branch, M. Masson, G. Aquilina, M. Bignami,
and P. Karran. Spontaneous development of drug resistance; mismatch
repair and p53 defects in resistance to cisplatin in human tumor cells.
Oncogene, in press, 2000. ![]()
5 M. Masson, G. Aquilina, M. Bignami, P.
Karran, unpublished data. ![]()
Received 6/22/99. Accepted 4/14/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. A. Maxwell, S. P. Johnson, R. E. McLendon, D. W. Lister, K. S. Horne, A. Rasheed, J. A. Quinn, F. Ali-Osman, A. H. Friedman, P. L. Modrich, et al. Mismatch Repair Deficiency Does Not Mediate Clinical Resistance to Temozolomide in Malignant Glioma Clin. Cancer Res., August 1, 2008; 14(15): 4859 - 4868. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Cahill, K. K. Levine, R. A. Betensky, P. J. Codd, C. A. Romany, L. B. Reavie, T. T. Batchelor, P. A. Futreal, M. R. Stratton, W. T. Curry, et al. Loss of the Mismatch Repair Protein MSH6 in Human Glioblastomas Is Associated with Tumor Progression during Temozolomide Treatment Clin. Cancer Res., April 1, 2007; 13(7): 2038 - 2045. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Maxwell, S. P. Johnson, J. A. Quinn, R. E. McLendon, F. Ali-Osman, A. H. Friedman, J. E. Herndon II, K. Bierau, J. Bigley, D. D. Bigner, et al. Quantitative analysis of O6-alkylguanine-DNA alkyltransferase in malignant glioma. Mol. Cancer Ther., October 1, 2006; 5(10): 2531 - 2539. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Gagnon, O. Bernard, L. Villeneuve, B. Tetu, and C. Guillemette Irinotecan Inactivation Is Modulated by Epigenetic Silencing of UGT1A1 in Colon Cancer Clin. Cancer Res., March 15, 2006; 12(6): 1850 - 1858. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brell, A. Tortosa, E. Verger, J. M. Gil, N. Vinolas, S. Villa, J. J. Acebes, L. Caral, T. Pujol, I. Ferrer, et al. Prognostic Significance of O6-Methylguanine-DNA Methyltransferase Determined by Promoter Hypermethylation and Immunohistochemical Expression in Anaplastic Gliomas Clin. Cancer Res., July 15, 2005; 11(14): 5167 - 5174. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Kimura, T. Nagasaka, J. Murakami, H. Sasamoto, M. Murakami, N. Tanaka, and N. Matsubara Methylation profiles of genes utilizing newly developed CpG island methylation microarray on colorectal cancer patients Nucleic Acids Res., March 10, 2005; 33(5): e46 - e46. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ogishima, H. Shiina, J. E. Breault, L. Tabatabai, W. W. Bassett, H. Enokida, L.-C. Li, T. Kawakami, S. Urakami, L. A. Ribeiro-Filho, et al. Increased Heparanase Expression Is Caused by Promoter Hypomethylation and Up-Regulation of Transcriptional Factor Early Growth Response-1 in Human Prostate Cancer Clin. Cancer Res., February 1, 2005; 11(3): 1028 - 1036. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Gazzoli and R. D. Kolodner Regulation of the Human MSH6 Gene by the Sp1 Transcription Factor and Alteration of Promoter Activity and Expression by Polymorphisms Mol. Cell. Biol., November 15, 2003; 23(22): 7992 - 8007. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Humbert, I. Achour, D. Lautier, G. Laurent, and B. Salles hMSH2 expression is driven by AP1-dependent regulation through phorbol-ester exposure Nucleic Acids Res., October 1, 2003; 31(19): 5627 - 5634. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Bhakat and S. Mitra CpG methylation-dependent repression of the human O6-methylguanine-DNA methyltransferase gene linked to chromatin structure alteration Carcinogenesis, August 1, 2003; 24(8): 1337 - 1345. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Satoh, T. Nakagawachi, H. Nakadate, Y. Kaneko, Z. Masaki, T. Mukai, and H. Soejima Significant Reduction of WT1 Gene Expression, Possibly Due to Epigenetic Alteration in Wilms' Tumor J. Biochem., March 1, 2003; 133(3): 303 - 308. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Esteller, M. F. Fraga, M. Guo, J. Garcia-Foncillas, I. Hedenfalk, A. K. Godwin, J. Trojan, C. Vaurs-Barriere, Y.-J. Bignon, S. Ramus, et al. DNA methylation patterns in hereditary human cancers mimic sporadic tumorigenesis Hum. Mol. Genet., December 1, 2001; 10(26): 3001 - 3007. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Schweizer, A.-L. Moisio, S. A. Kuismanen, K. Truninger, R. Vierumäki, R. Salovaara, J. Arola, R. Butzow, J. Jiricny, P. Peltomäki, et al. Lack of MSH2 and MSH6 Characterizes Endometrial but not Colon Carcinomas in Hereditary Nonpolyposis Colorectal Cancer Cancer Res., April 1, 2001; 61(7): 2813 - 2815. [Abstract] [Full Text] |
||||
![]() |
R. D. Wood, M. Mitchell, J. Sgouros, and T. Lindahl Human DNA Repair Genes Science, February 16, 2001; 291(5507): 1284 - 1289. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |