| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Departments of Cell Biology [X. Y., M. B., R. B., P. S.] and Medicine and Microbiology/Immunology [S. G., C. E. R.], Albert Einstein College of Medicine, New York, New York 10461
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) also exhibit retarded progression of
DEN-induced liver tumors. At 7 months there was a significant decrease
in liver weight (
27%; P < 0.01),
reflecting reduced tumor burden in Mgat3/
mice. In addition, tumors were generally fewer and smaller, and
histological changes were less severe in
Mgat3/ livers. Therefore, tumor
progression is retarded in mice with two different null mutations in
the Mgat3 gene. Second, we show that the development of
DEN-induced tumors is unaltered by high levels of GlcNAc-TIII in the
liver of transgenic mice. The Mgat3 gene coding exon under
the control of the major urinary protein (MUP) promoter was used to
generate transgenic mice that express GlcNAc-TIII in liver. Following
DEN injection and phenobarbitol treatment, however, no significant
differences were observed between MUP/Mgat3 transgenic and
control mice in either tumor numbers or liver weight. The combined data
provide strong evidence that retarded progression of tumors in mice
lacking GlcNAc-TIII is due to the absence of the bisecting GlcNAc
residue on N-glycans of a circulating glycoprotein(s) from
a tissue other than liver. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
15 times more resistant to the
toxicity of ricin and 15 times more sensitive to the toxicity of
E-PHA than CHO cells (7
, 8)
. Transfection of a
Mgat3 gene causes human hepatoma cells to suppress
production of hepatitis B virus (9)
and B16 melanoma cells
to exhibit reduced experimental metastasis (10)
.
Overexpression of GlcNAc-TIII in PC12 cells perturbs their ability to
respond to nerve growth factor (11)
, and overexpression in
a glioma cell line inhibits epidermal growth factor receptor function
(12)
. K562 cells expressing a transfected Mgat3
gene are comparatively resistant to natural killer cell cytotoxicity
and colonize spleen more effectively (13)
. In mice
overexpressing a Mgat3 transgene in hepatocytes, a reduction
in secretion of apolipoprotein and lipids from liver was reported
(14)
. Transgenic mice overexpressing a Mgat3
transgene in hematopoietic cells were found to have a defect in
stroma-dependent hemopoiesis (15)
. A role for bisected N-glycans in the development of liver cancer was proposed on the basis that GlcNAc-TIII activity increases substantially in tumor tissue following chemical induction of liver tumors in rats (16 , 17) . Whereas normal rat liver contains almost no detectable GlcNAc-TIII activity and barely detectable GlcNAc-TIII transcripts (18) , precancerous hepatic foci have GlcNAc-TIII activity and tumors exhibit a 50–60-fold increase in this activity and contain Mgat3 gene transcripts that can be detected by northern analysis. These results suggested that hepatic tumors might not occur, or that their development might be significantly reduced, in the absence of GlcNAc-TIII. We previously tested this hypothesis by generating mice homozygous for an insertion mutation that inactivates the Mgat3 gene (Mgat3tmlPst, termed Mgat3neo), and subjected Mgat3neo/neo males to DEN-induced hepatocarcinogenesis (19) . Compared with wild-type littermates, Mgat3neo/neo males were dramatically retarded in developing liver tumors. At 7 months after DEN injection, mice lacking active GlcNAc-TIII had very few small tumors, whereas wild-type mice had an average of 50 tumors per liver, and their livers weighed twice as much as livers from Mgat3neo/neo mice. However, both DEN-treated Mgat3neo/neo and wild-type mice had similar numbers of precancerous foci, and eventually tumors did develop in Mgat3neo/neo mice. Thus, lack of GlcNAc-TIII did not inhibit the induction phase, but rather it caused a marked retardation in DEN-induced tumor progression.
The Mgat3neo mutant allele gives rise to a
read-through transcript that we have shown to be translated into a
371–374 amino acid truncated
protein.4
Although this gene product has no GlcNAc-TIII activity
(19)
, an indirect effect of the protein on tumor
progression was a possibility. Therefore, we examined DEN-induced
hepatocarcinogenesis in a mutant mouse that lacks GlcNAc-TIII due to
deletion of the Mgat3 gene coding region, a mutation termed
Mgat3tmlJxm or Mgat3
(2)
. Here, we show that DEN-induced tumor formation is
also retarded in Mgat3/ mice. In addition,
we show that transgenic mice overexpressing GlcNAc-TIII in liver
acquire tumors at essentially the same rate as nontransgenic mice,
providing strong evidence for our hypothesis (19)
that it
is the lack of GlcNAc-TIII on a nonhepatic, circulating glycoprotein(s)
that leads to the reduced tumor progression observed in
Mgat3-/- mice.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
/ Mice.
(Mgat3tmlJxm) mutation in a genetic background
similar to that of mice carrying the Mgat3neo
(Mgat3tmlPst) mutation examined previously
(19)
, two R1 embryonic stem cell lines, clone 12 and clone
18, that are heterozygous for the Mgat3
mutation (2)
were kindly provided by Dr. J. D. Marth
(University of California, San Diego, CA). These cells were injected
into E3.5 C57Bl/6 blastocysts, and chimeras were obtained from both
clones, but only chimeras from clone 18 transmitted the mutant allele
when crossed with strain CD1 mice (Charles River). First-generation
heterozygotes were intercrossed and used in these experiments. The
Mgat3 allele was detected by PCR or Southern
analysis of tail genomic DNA. Primers 184 (sense,
AGAGAGGTGATGTGTGATGGG) and 99 (antisense, GAAGATCAGAGGAAGATTCCGC),
which flank the targeted Mgat3 gene coding sequence, were
used to detect the Mgat3 allele, whereas
primers 82 (sense, GCACTAGGCGCAAGTGGGTTGAG) and 83 (antisense,
GTAGATGCCCTCGGGTGTGAAG), from within the Mgat3 gene coding
region, were used to identify the endogenous Mgat3 allele.
PCR was carried out through 40 cycles at 94°C for 1 min, 57°C for 1
min, and 72°C for 2 min using Taq polymerase (Perkin-Elmer Corp.).
For Southern analysis, genomic DNA (10–20 µg) from liver or tail was
digested with HindIII (Life Technologies, Inc.),
electrophoresed through a 0.8% agarose gel, transferred to Hybond-N
nylon membrane (Amersham), and hybridized with probe Y (638 bp; see
Fig. 1
in Ref. 19
) which is located 434 bp downstream of the
Mgat3 gene coding sequence.
|
Southern Analysis.
Genomic DNA (10–20 µg) from tail or liver was digested with either
BglII or HindIII. After electrophoresis on a
0.8% agarose gel and transfer to nylon membrane, blots were probed
with Mgat3 gene probe A or Y. Rapid hybridization buffer
(Amersham) and Prime-it (Stratagene) radioactive labeling kit were used
following the manufacturer’s instructions. Prehybridization and
hybridization were carried out at 65°C for 2 h, respectively.
Washing conditions were 0.1x SSC [150 mM sodium chloride
and 15 mM sodium citrate (pH 7)], and 0.1% SDS 20 min at
room temperature and subsequently 30 min at 65°C.
Northern Analysis.
Trizol (Life Technologies, Inc.) was used to extract total RNA from
liver, and Oligo (dT) (Pharmacia) was used to purify poly
(A)+ RNA from total RNA. Total RNA (20–30 µg) or poly
(A)+ RNA (10 µg) was electrophoresed and transferred to
nylon membrane. Prehybridization/hybridization buffer contained 50
mM PIPES (piperazine-N,N'-bis(2-ethane-sulfonic
acid), 0.1 M NaCl, 50 mM sodium phosphate buffer, 0.5
mM EDTA, 5% SDS, and 60 µg/ml herring sperm DNA. Probe
V, a 0.58 kb BglII/PstI Mgat3 gene
fragment, was used to detect expression of the Mgat3
transgene and the endogenous Mgat3 gene. A
PstI/XhoI 575-bp fragment of the mouse
Mgat1 gene coding region (21)
was used to
determine integrity and amount of RNA loaded. Prehybridization and
hybridization were carried out at 60°C overnight, respectively.
Washing conditions were 2x SSC and 0.1% SDS, 20 min at room
temperature and subsequently 30 min at 65°C.
Western Blot and E-PHA Blot Analyses.
Liver glycoproteins and proteins were extracted with nonionic
detergent, and 50-µg aliquots were electrophoresed in a 10% SDS/PAGE
gel and transferred to polyvinylidene difluoride membrane, as described
previously (19)
. Desialylation was performed by treatment
of the membrane for 1 h at 80°C with 25 mM
H2SO4. A rabbit polyclonal antibody against
amino acids 120–136 of mouse GlcNAc-TIII (TRMLEKPSPGRTEEKTE;
synthesized by the Laboratory for Macromolecular Analysis at Albert
Einstein College of Medicine, New York, NY) was prepared by Covance
Research Products Inc. To purify the antibody, peptide was conjugated
to sulfolink coupling gel (Pierce Chemical Co.) to generate an affinity
column onto which the serum was applied after blocking the column with
50 mM cysteine. After washing with 10 column volumes of 10
mM HEPES (pH 7.2), the peptide bound antibody was eluted
with 0.1 M glycine (pH 2.4) into 0.1 ml of 1 M Tris (pH 8.5), and
stored at 4°C in 0.01% thimeresol. Biotinylated erythroagglutinin
from P. vulgaris (E-PHA; Vector Laboratories Inc.) was used
to detect the presence of the bisecting GlcNAc on N-glycans,
as described previously (19)
.
Induction of Liver Tumors.
DEN (Sigma Chemical Co.) was used to induce hepatoma, as described
(19)
. Briefly, DEN was injected i.p. into male mice at 10
µg/g body weight on day 12 after birth. One month after birth, mice
were given water containing 500 PPM phenobarbitol (Morton Grove
Pharmaceuticals, Inc.) until the experiment was terminated.
Analysis of Mice.
At different times after DEN injection, mice were weighed, euthanized
by injection of 1 ml of 2.5% avertin (tribromomethylalcohol and
tertiaryamylalcohol; Aldrich Chemical Co.), and dissected to collect
liver, spleen, kidneys, lungs, and blood. Organs were weighed and
examined for tumors. Visible tumors were counted, tumor diameter was
measured using microcallipers, and each liver was photographed. Slices
of liver, kidney, and lung were fixed in 10% formalin, sectioned, and
stained with H&E. Remaining liver and kidney tissue was frozen at
-80°C. H&E slides containing five liver sections of 5 µm from 22
or 23 mice in each group were scored blindly according to the following
numerical criteria based on previously published histological
characterization of multistage carcinogenesis in the mouse and rat
(22
, 23)
: 0, normal liver; 1, mild, localized dysplasia
with mild disruption of hepatic cords, no discernible altered hepatic
foci; 2, moderate dysplasia with disruption of hepatic cords, AHF
occupy less than 5% of the liver, AHF are approximately 1 mm in
diameter; 3, severe dysplasia and disruption of cord structure,
predominant AHF prevalent throughout the liver (encompass 20% or more
of liver), many exceed 2 mm and appear as distinct nodules on the
liver; 4, multiple, large neoplastic nodules present, some of which
appear to be early tumors, classified as adenomas when they exceed
approximately 4–5 mm; 5, clear HCC present, plus many earlier lesions,
HCCs are few in number and rather small, with a predominantly
differentiated phenotype; 6, many large HCCs present and some of the
tumors have a poorly differentiated phenotype, although differentiated
phenotypes are also present.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) were generated in a
129/CD1 mixed background, as described in "Materials and Methods."
Their genetic background was designed to be as similar as possible to
the Mgat3neo/neo mice studied previously
(19)
. Mgat3/ mice had the
genotype predicted from replacement of the Mgat3 gene coding
exon with a loxP sequence (Fig. 1
). By PCR, the endogenous Mgat3 allele was detected as an
0.8-kb product with primer pair 82/83, and the
Mgat3 allele was detected as an 0.85-kb
product with primer pair 184/99 (data not shown). By Southern analysis,
the Mgat3 allele was identified with probe Y
as an 3-kb HindIII fragment that reflects the loss of 1.7
kb of the Mgat3 gene coding sequence and the introduction of
160 bp containing a loxP site and flanking vector DNA.
The latter was shown, by sequencing of PCR products, to have introduced
a HindIII site into the targeted locus. The endogenous
Mgat3 allele was identified by a 5.8-kb HindIII
fragment with probe Y (Fig. 1
). Also shown in Fig. 1
is a lectin blot
of kidney glycoproteins from Mgat3/ and
Mgat3+/+ mice. The lectin E-PHA, which binds
bisected N-glycans preferentially, did not bind well to
glycoproteins from Mgat3/ mice, as
expected, if they lack bisected N-glycans due to loss of
GlcNAc-TIII (2
, 19) .
Male mice from the second generation of brother:sister matings were
injected with DEN at day 12 after birth and given phenobarbitol in
their drinking water until 7 months after injection, when they were
sacrificed. This regimen replicated our previous experiments in mice
homozygous for the Mgat3neo insertion mutation
(19)
. At sacrifice, tissues were weighed and prepared for
histology. Each liver was photographed, visible tumors on the surface
of the liver were counted, and, in several cases, the diameter of all
visible tumors was measured. A total of 25
Mgat3+/+ and 26
Mgat3/ mice were examined. Direct
comparison of the two groups revealed that
Mgat3/ mice had 15% less tumors, the
size of their largest tumor was smaller (8.1 mm in diameter compared
with 10.4 mm), and they had reduced liver weight (19%;
P < 0.04). These data indicated that tumor
progression was retarded in Mgat3/ mice.
To minimize some of the variation due to genetic background, data were
compared for the 15 sibling pairs among the cohort of treated mice. It
can be seen from Table 1
and Fig. 2
that highly significant differences exist between
Mgat3+/+ and Mgat3/
mice for several parameters. Mgat3/ mice
had, on average, fewer tumors than wild-type litter mates (53 compared
with 66 per liver), and the average size of their largest tumor was
less (7.4 mm compared with 10.4 mm). More significant differences were
uncovered when liver weights were compared. The average liver weight of
DEN-treated mice was 27% less for
Mgat3/ mice compared with
Mgat3+/+ litter mates (P
< 0.01; Table 1
). When the ratio of liver weight to kidney weight
was determined, a reduction of 26% was obtained for
Mgat3/ mice (P =
0.01; Fig. 2
). Similarly, when the ratio of liver to body weight was
calculated, Mgat3/ mice were 32% reduced
(P = 0.01; Fig. 2
). Finally, as expected in
mice with a lower tumor burden, Mgat3/
mice were slightly heavier than Mgat3+/+ mice
(Table 1)
. In control groups, no tumors were obtained and no
significant differences were observed in any of these parameters (Table 1)
.
|
|
/ and Mgat3+/+
mice indicated that progression of tumors was significantly slower in
Mgat3/ mice. This conclusion was borne out
by histological scoring of altered liver morphology, as described in
"Materials and Methods" for categories of 1 (mildly affected) to 6
(most affected). Among the cohort of DEN-treated
Mgat3/ mice, not one scored a 6,
characteristic of a liver replete with tumors and observed in three
Mgat3+/+ mice (Fig. 3A
). By contrast, comparatively more DEN-treated
Mgat3/ mice scored a 2, characteristic of
a liver with few tumor foci and little morphological change (Fig. 3A
). Histological examination of the tumors in
Mgat3/ livers revealed that they were
predominantly adenomas with a well differentiated phenotype (Fig. 3B
). Hepatocytes in these tumors had enlarged nuclei with
prominent nucleoli, but highly abnormal nuclei were rare. Some
cord-like structure remained in the tumors, further suggesting that the
tumors were adenomas rather than carcinomas. In contrast, many of the
tumors from wild-type livers had a poorly differentiated phenotype,
with pleomorphic nuclei and an acinar or trabecular tumor phenotype,
indicative of further progression toward malignancy (Fig. 3B
).
|
/ mice. A picture of a typical
Mgat3+/+ liver that scored 5 by histological
classification is shown in Fig. 4A
. This liver was almost completely replaced by 150 independent, pale
white tumors of varying sizes throughout all lobes of the liver.
Histology of this liver revealed very little tissue with a normal cord
structure. In contrast, a Mgat3/ liver
(Fig. 4B
) from category 5 did not have as many tumors, and
normal cord structure predominated. Thus, even within a category such
as 5, Mgat3/ livers were less severely
affected. The trend toward less severe tumor formation was also
observed in category 2 Mgat3/ livers
compared with Mgat3+/+ livers in category 2
(Fig. 4, C and D
). Tumors were sparse and small
in category 2 Mgat3/ livers, consistent
with the predominant normal histology of those livers. In contrast, the
wild-type liver in this category contained a larger number of tumors.
The combined data provide strong evidence that
Mgat3/ mice, lacking GlcNAc-TIII and the
ability to add the bisecting GlcNAc to glycoproteins, exhibit reduced
progression of liver tumors, as observed previously for mice with the
Mgat3neo/neo insertion mutation
(19)
.
|
). The MUP/Mgat3 transgene was detected by PCR with primer pair
190/192 that gave an 0.8-kb product. For Southern analysis,
BglII digested tail genomic DNA was probed with
Mgat3 gene-specific probe A. Founder 19 and offspring have
one integration site with six to seven tandem copies of the
MUP/Mgat3 transgene. Northern analysis showed a strong
signal at 2.4 kb from the transgene and did not detect transcripts from
the endogenous Mgat3 gene in liver; western blotting showed
that GlcNAc-TIII protein could be readily detected in transgenic but
not in nontransgenic mice; and lectin blotting with E-PHA, under
conditions optimal for the detection of N-glycans with a
bisected GlcNAc residue, showed binding to many liver glycoproteins
(Fig. 5B
). Northern analysis of all transgenic mice showed
that the MUP/Mgat3 transgene was highly expressed in the
liver of each mouse.
|
. Student’s t test and paired t test showed no
significant differences between transgenic mice and their nontransgenic
litter mates or between transgenic mice and a large group of non-litter
mate controls, even for the most sensitive indicator, the ratio of
liver to kidney weight (Fig. 6
). The gross morphology of tumors and the histological appearance of
tumors from the two groups were also indistinguishable. Therefore,
increased expression of GlcNAc-TIII in liver does not lead to an
earlier appearance of liver tumors nor to an enhanced rate of
progression of the tumors induced by DEN.
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
First, we have shown that mice with a different Mgat3
gene-inactivating mutation also exhibit slow growth of DEN-induced
tumors (Table 1
and Fig. 2
). DEN- and phenobarbitol-treated
Mgat3/ mice had smaller livers, smaller
tumors, and less severe histological changes in liver compared with
similarly treated Mgat3+/+ litter mate controls.
For organs such as lung, kidney or spleen, no significant differences
were observed between DEN-treated Mgat3/
and Mgat3+/+ mice. These results establish that
the development of liver tumors is retarded in
Mgat3-/- mice. However, the retardation was
significantly less marked in Mgat3/ mice
than the Mgat3neo/neo mice reported previously
(19)
. This could be due to a difference in genetic
background since it is well established that responsiveness to DEN
varies widely between mouse strains (24, 25, 26)
.
Mgat3neo/neo mice contain genetic contributions
from the 129SvJ, C57Bl/6, SJL, and CD1 strains, whereas
Mgat3/ mice contain contributions from the
two 129 mouse strains that generated R1 ES cells (27)
and
the CD1 strain used in this study. In fact, differences due to genetic
background were apparent because wild-type mice from the two
backgrounds given PB in drinking water differed very significantly in
body and liver weights, the 129/CD1 mice being significantly heavier,
on average, than the mice of more mixed genetic background (Ref. 19
and
Table 1
). Second, differences could arise between the two
Mgat3-/- mutants from the fact that
Mgat3neo/neo mice produce a truncated, inactive
GlcNAc-TIII from the Mgat3neo
allele,4
whereas the
Mgat3 allele produces no product from the
Mgat3 gene coding region. In other experiments, we have
found that although the truncated protein does not act as a dominant
negative in CHO cell transfectants, it has subtle, neurological
phenotypic effects in Mgat3neo/neo
(28)
and Mgat3/neo
mice.4
In a second test of the hypothesis, we investigated whether
overexpression of GlcNAc-TIII in liver would enhance tumor formation.
The data in Table 2
and Fig. 6
show that mice expressing high levels of
GlcNAc-TIII in liver, and nontransgenic control mice that have no
detectable expression of the Mgat3 gene in liver, developed
liver tumors at a similar rate that were indistinguishable in
appearance. This provides strong evidence that it is not a
liver-derived glycoprotein with bisected N-glycans that aids
DEN-induced tumor progression in mice. Rather, a circulating factor
that requires bisected N-glycans for optimal activity, or
serum half-life, or liver cell binding, or for optimal secretion into
the bloodstream is postulated to be missing or reduced in
Mgat3-/- mice. Likely tissues that might be a
source of a growth factor that stimulates progression of liver tumors
are kidney and lung. The Mgat3 gene is highly expressed in
kidney and moderately expressed in lung (1
, 2)
. However,
before attempting to correct the Mgat3-/-
liver tumor phenotype by other tissue-specific Mgat3
transgenes, it may be informative to examine the abilities of known
glycoprotein growth factors that emanate from kidney or lung to
stimulate the growth in culture of hepatocytes from
Mgat3+/+ and Mgat3-/-
mice. Sera from Mgat3+/+ and
Mgat3-/- mice might also reveal differences in
hepatocyte growth stimulatory activities. In addition, it will be of
interest to determine the regenerative properties of liver from
Mgat3+/+ compared with
Mgat3-/- mice after partial hepatectomy. If
Mgat3-/- livers are slower in regenerating, it
may be due to a lack of the same factor that promotes tumor
progression.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by National Cancer Institute Grants
R37-30645 (to P. S.) and RO1-37232 (to C. E. R.). Partial support
was also provided by the Comprehensive Cancer Center at Albert Einstein
College of Medicine (Grant PO1-13330). 
2 To whom requests for reprints should be
addressed, at Department of Cell Biology, Albert Einstein College of
Medicine, 1300 Morris Park Avenue, New York, NY 10461. Phone: (718)
430-3346; Fax: (718) 430-8574; E-mail: stanley{at}aecom.yu.edu
3 The abbreviations used are: GlcNAc-TIII,
N-acetylglucosaminyltransferase III; DEN, diethylnitrosamine; MUP,
major urinary protein; E-PHA, erythroagglutinin from Phaseolus
vulgaris; AHF, altered hepatic foci; HCC, hepatocellular
carcinoma; PB, phenobarbitol; CHO, Chinese hamster ovary.
4 R. Bhattacharyya, M. Bhaumik, and P.
Stanley, manuscript in preparation.
Received 12/20/99. Accepted 4/17/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Tamguney, K. Giles, D. V. Glidden, P. Lessard, H. Wille, P. Tremblay, D. F. Groth, F. Yehiely, C. Korth, R. C. Moore, et al. Genes contributing to prion pathogenesis J. Gen. Virol., July 1, 2008; 89(7): 1777 - 1788. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Stanley, S. Sundaram, J. Tang, and S. Shi Molecular analysis of three gain-of-function CHO mutants that add the bisecting GlcNAc to N-glycans Glycobiology, January 1, 2005; 15(1): 43 - 53. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Yang, J. Tang, C. E. Rogler, and P. Stanley Reduced Hepatocyte Proliferation is the Basis of Retarded Liver Tumor Progression and Liver Regeneration in Mice Lacking N-Acetylglucosaminyltransferase III Cancer Res., November 15, 2003; 63(22): 7753 - 7759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kui Wong, R. L. Easton, M. Panico, M. Sutton-Smith, J. C. Morrison, F. A. Lattanzio, H. R. Morris, G. F. Clark, A. Dell, and M. S. Patankar Characterization of the Oligosaccharides Associated with the Human Ovarian Tumor Marker CA125 J. Biol. Chem., August 1, 2003; 278(31): 28619 - 28634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bhattacharyya, M. Bhaumik, T. S. Raju, and P. Stanley Truncated, Inactive N-Acetylglucosaminyltransferase III (GlcNAc-TIII) Induces Neurological and Other Traits Absent in Mice That Lack GlcNAc-TIII J. Biol. Chem., July 12, 2002; 277(29): 26300 - 26309. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Sato, M. Takahashi, Y. Shibukawa, S. K. Jain, R. Hamaoka, J.-i. Miyagawa, Y. Yaginuma, K. Honke, M. Ishikawa, and N. Taniguchi Overexpression of N-Acetylglucosaminyltransferase III Enhances the Epidermal Growth Factor-induced Phosphorylation of ERK in HeLaS3 Cells by Up-regulation of the Internalization Rate of the Receptors J. Biol. Chem., April 6, 2001; 276(15): 11956 - 11962. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
