| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Urology, University of Washington, Seattle, Washington 98195
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Normal prostatic glandular tissue is composed of the principal cell types luminal epithelial cells, basal epithelial cells, and stromal smooth muscle cells (3) . Basal cells are the presumed progenitors of luminal cells (4 , 5) . The latter are the differentiated, postmitotic secretory cells of the prostate epithelium. Previously, I and others (6) presented a model of prostate cancer progression in which cancer cells arise from the transformation of luminal cells and can become more malignant by acquiring (progressively) the expression of markers specific to basal cells. As such, tumors can be comprised of more than one cancer cell type. Crucial to the identification of these cell types is the discovery of cell type-specific cell surface molecules that can be used in cell isolation by methods like flow cytometry. This allows one to study different cancer cell types individually with regard to their invasiveness, gene expression, and other biological properties. Furthermore, these molecules can, in theory, be targeted for therapeutic treatment of disseminated disease.
We reported recently that the cell surface molecules CD57 and CD44 can be used to identify two prostate cancer cell types. The CD44 type represents an advanced cancer cell type because it is found less frequently in primary tumors but more prominently in soft-tissue metastases (1) . Normal luminal cells are positive for CD57, whereas basal cells are positive for CD44 (7) . CD molecules are cluster of differentiation/designation antigens recognized by a set of monoclonal antibodies. These antibodies were originally raised against cells of the hematopoietic system. Thus, CD57 is identified as a natural killer cell antigen, and CD44 is identified as a lymphocyte homing receptor (8) . CD molecules are attractive to tag cancer cells because their specific antibodies are widely available and because the functions of many of these molecules are relatively well known. However, CD57 and CD44 can only identify two prostate cancer cell types. There may also be subtypes of the CD57 and CD44 types. I propose to identify other candidate CD molecules by screening three commonly used prostate cancer cell lines, LNCaP, PC3, and DU145. These cell lines were all derived from metastatic lesions: LNCaP was derived from a lymph node; PC3 was derived from bone; and DU145 was derived from brain (9) . Cell reactivity was detected by flow cytometry, a method capable of detecting a level as low as 1000 molecules/cell (10) .
| Materials and Methods |
|---|
|
|
|---|
Flow Cytometric Analysis and CD Antibodies.
Aliquots of cultured cells were resuspended in 0.1% BSA-HBSS
in a volume of 50 µl for antibody labeling and flow analysis. CD
monoclonal (mouse IgG and IgM and rat IgG) antibodies conjugated to
either R-phycoerythrin (PE, 575 nm peak fluorescence) or FITC
(530 nm peak fluorescence) were obtained from PharMingen (San Diego,
CA), except for
CD49a-FITC, which was obtained from Endogen
(Woburn, MA). Those specificities without an assigned CD number were
T-cell receptor 
, IL-8 receptor B, mannose receptor, NKB1,
perforin, fusin, and integrin ß7. About
0.050.1 µg of antibody was added to the cells, and the reaction was
incubated in the dark for 15 min at room temperature. Isotype control
was provided by irrelevant PE- or FITC-conjugated mouse MOPC21 (IgG1)
and G155-178 (IgG2a) antibodies. The reaction was stopped by the
addition of 1 ml of 0.1% BSA-HBSS. The cells were centrifuged and
fixed in 0.35 ml of 2% paraformaldehyde. Flow analysis was done by a
FACScan (Becton Dickinson, Mountain View, CA) machine fitted with a 488
nm laser. An isotype or no-antibody control was analyzed to delineate
the unstained and autofluorescent population (7)
. Events
that registered outside this trace were scored as positive, and 10,000
events were collected for each sample. The percentage of positive
events was determined.
CD Antibody Array.
CD reactivity detected by flow cytometry was checked by cell
binding to the same antibodies immobilized on a plastic grid array.
These arrays were constructed by spotting individual antibodies on the
surface of Falcon 1034 polystyrene 65 x 15-mm Petri
dishes with 10-mm grids. One dish could be spotted with 16 antibodies.
Each spot was wet with 1 µl of PBS before 0.1 µg of antibody in 1
µl of PBS was applied. Antibody binding to the plastic surface was
carried out at room temperature for 1 h. Afterward, the antibody
array was rinsed in 0.1% BSA-PBS and incubated under a blocking
solution of 1% BSA-PBS for 1 h. Cells were resuspended in small
aliquots (<5 µl) of 0.1% BSA-PBS and added directly to the antibody
spots. After a 15-min incubation at room temperature the array was
washed well with 0.1% BSA-PBS. Cell binding was scored by light
microscopy and photographed.
This method was also used to determine reactivity to fusin, integrin ß7, CD47, CD62L, CD62E, CD72, CD93, CD99R, CD114, CD121a, CDw125, and CDw131 because these antibodies were not dye-conjugated.
Gene Expression Analysis by
RT-PCR.3
RNA was prepared from LNCaP and PC3 cells and converted into
cDNA. Gene sequences in the cDNA populations were detected by PCR and
agarose gel electrophoresis of the reaction products as described
previously (11)
. The primer pair
sequences4
for Ki67, CD10, CD13, CD26, CD44, and CD81 were as follows:
(a) Ki67, GCAAATCATCCGAACCCGTGGTCATC and
GGTGTTCAACTATTCTCAGTCCAGGAG; (b) CD10,
GTGCCCAGCAGTCCAACTCATTGAAC and CCCCATTTCTGTGGTGTTGGCAAGTC;
(c) CD13, CATGTTTGACCGCTCCGAGGTCTATG and
CACTGGAGCACCACCTCCTTGTTCTC; (d) CD26,
TCCTCTACTATTAGATGTGTATGCAGG and GTATTTTGAGGTGCTAAGGTAAAGAGAAAC;
(e) CD44, CAGATCGATTTGAATATAACCTGCCGC and
AGGGATTCTGTCTGTGCTGTCGGTGAT; and (f) CD81,
GGGAGTGGAGGGCTGCACCAAGTGC and GATGCCACAGCACAGCACCATGCTC.
These sequences were selected so that: (a) they did not contain palindromes of 6 bp or longer; (b) their TM would be >72°, based on the empirical formula of 4° per G/C pair and 2° per A/T pair; and (c) their expected PCR products would be >400 bp in size.
Single-cell Sorting and Culture.
PC3 cells were labeled with
CD44-PE in 0.1% BSA-PBS as
described above. Single positive cells were sorted by FACStar Plus
(Becton Dickinson) into individual wells of a 96-well plate. Cells from
three regions of the cytogram representing low, intermediate, and high
staining positivity were sorted. One hundred µl of RPMI 1640 media
supplemented with 10% FCS were added to each well. After 3.5 weeks,
positive wells were harvested for flow analysis. The PC3 cells in each
well were trypsinized, rinsed with media, and resuspended in 40 µl of
0.1% BSA-HBSS for labeling with
CD44-PE. An aliquot was used for
the no-antibody control.
| Results |
|---|
|
|
|---|
|
|
Fig. 2
shows the level of expression for CD10, CD13, CD26, CD44, and CD81 in
LNCaP and PC3 cells as analyzed by RT-PCR. Both cell types were
positive for the cell proliferation-associated markers Ki67 and CD81.
In agreement with the flow analysis result, PC3 was positive for CD13
but negative for CD10, whereas LNCaP was positive for CD10 but negative
for CD13. PC3 was also positive for CD26 and CD44.
|
|
CD44-PE, and single cells were sorted from three
fractions that scored low, intermediate, and high for
CD44 staining.
Single cells were cultured separately in a 96-well plate. About
1520% of the wells were positive for growth, and the resultant
populations (from low, intermediate, high CD44-positive cells) were
analyzed by
CD44 staining as shown in Fig. 4
CD10-PE, but single LNCaP cells could not be
cultured (none of the wells was positive for growth).
|
| Discussion |
|---|
|
|
|---|
Because these cell lines were established from metastases, they
therefore represent advanced disease cell types. Accordingly, none are
positive for CD57, a luminal cell marker found in a majority of cancer
cells in primary tumors and a marker of well-differentiated cancer
(1)
. Other normal prostate epithelial cell markers that
are not strongly positive (i.e., expressed in >50% cells)
include CD24, CD38 (Ref. 12
), CD64 (Fc
receptor I),
CDw75, CD82 (KAI1), CD117 (c-kit), and CDw123 (IL-3 receptor
). Normal epithelial markers retained by these cells are CD9, CD46
(membrane cofactor protein), CD47, CD99R, CD107a (lysosomal-associated
protein LAMP-1), CD107b (LAMP-2), and CD147 (neurothelin). Because the
cancer cells are epithelial in origin, they are negative for the
prostate stromal cell markers CD49a (integrin
1), CD51/61 (integrin
vß3), and CDw131
(cytokine receptor subunit ß). A detailed account of the reactivity
of the CD antibodies to normal prostate cell types will be reported
elsewhere.
PC3 and DU145 are positive for the basal cell markers CD49b (integrin
2), CD49f (
6), CD55
(decay-accelerating factor), CD59 (membrane-attack-complex-inhibitory
factor), CD99R, CD104 (integrin ß4), and CD44.
LNCaP is positive for CD49f, CD59, and CD99R only. The other markers
are either negative (CD55 and CD44) or positive in some of the cells
(CD49b, 4050%; CD104, 2040%). This finding is in line with a
model of prostate cancer progression in which cancer cells acquire the
expression of basal cell markers as the disease worsens (1
, 6
, 11)
. In this regard, PC3 and DU145 cells can be considered to
represent more progressed cancer cell types than LNCaP. The
2ß1 integrin complex
of CD49b/CD29 present in PC3 and DU145 (and a smaller fraction of LNCaP
cells) is reported to play a role in the interaction between prostate
cancer cells and human bone marrow stroma (13
, 14)
. Bone
metastasis is a frequent outcome in prostate cancer. Bone metastases
can be assayed for CD49b/CD29-positive cells, and the frequency of
CD49b/CD29-positive cells in bone metastases can be compared with that
seen in non-bone metastases. The expression pattern of integrin
molecules by my flow analysis is compatible to that reported previously
by other investigators (15
, 16)
. Other basal cell markers
such as CD90 (Thy-1) and CDw92 are not detected in any of the cell
lines, whereas CD95 (Fas/APO-1 death receptor) is detected in the
2040% fraction.
CD54 (intracellular adhesion molecule 1) and CD58 (lymphocyte function-associated antigen 3) are examples of non-prostate epithelial markers expressed by these cancer cells. In benign tissue, expression of CD54 is localized to vessel endothelial and nerve cells, and expression of CD58 is localized to the stroma. Another stromal cell-specific marker, CD56 (neural cell adhesion molecule), is not detected in these epithelial cancer cell types but is found to be expressed by a LuCaP (17) xenograft tumor with neuroendocrine differentiation as well as tumor cells in a liver metastasis of a deceased patient.5 CD97, which is found in PC3 and DU145 cells but not in LNCaP cells, is a heptaspanin transmembrane molecule whose expression may be associated with dedifferentiation because it is found in undifferentiated, anaplastic thyroid cancer but not in differentiated thyroid cancer or normal thyroid tissue (18) . Normal prostate tissue and primary tumors show no reactivity to CD97. CD71 (transferrin receptor) and CD81 (target of an antiproliferative antibody 1) are characteristic of proliferating cells, although normal prostate cells also stain positive for these markers.
CD10 (neutral endopeptidase or common acute lymphoblastic leukemia antigen), CD13 (aminopeptidase N), and CD26 (dipeptidyl peptidase IV) are ectoenzymes that process bioactive peptides. All are luminal cell markers, and their expression (like that of the other luminal cell markers mentioned above) is diminished in cancer (19 , 20) . However, their expression pattern may be more complex. DU145 is negative for all three of these CD molecules, but PC3 is positive for CD13 and CD26, and LNCaP is positive for CD10. A LuCaP xenograft, such as LNCaP, established from a lymph node metastasis is also positive for CD10.5 CD13 appears to be down-regulated in CD57-positive cancer cells of primary tumors but is expressed by CD44-positive cancer cells present in soft-tissue metastases.5
Heterogeneity in expression may be an inherent population property of these cells. For example, PC3 cells can be sorted into single cells that stain high, intermediate, or low for CD44, and the sorted cells can be cultured separately. After the individual cultures have become confluent and are analyzed, a staining distribution similar to that of the original population is obtained. A thorough analysis would involve the examination of all other markers and isolation of subpopulations (e.g., CD44-positive versus CD44-negative PC3 or DU145 cells, CD10-positive versus CD10-negative LNCaP cells) to investigate their biological properties and gene expression.
It remains to be seen whether these three particular CD profiles can be detected in cancer cells of prostate tumors in patients. I think that the use of CD molecules to track prostate cancer cells can be applied to other types of adenocarcinoma to discover common themes.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
2 To whom requests for reprints should be
addressed, at Department of Urology, Box 356510, University of
Washington, Seattle, WA 98195. Phone: (206) 221-5795; Fax: (206)
685-7301; E-mail: aliu{at}u.washington.edu ![]()
3 The abbreviations used are: RT-PCR, reverse
transcription-PCR; IL, interleukin. ![]()
Received 12/10/99. Accepted 5/17/00.
| REFERENCES |
|---|
|
|
|---|
2ß1 integrin. Clin. Exp. Metastasis, 14: 19-26, 1996.[Medline]
2ß1 integrin. Clin. Exp. Metastasis, 15: 577-584, 1997.
This article has been cited by other articles:
![]() |
A. Iwase, H. Ando, T. Nagasaka, M. Goto, T. Harata, and F. Kikkawa Distribution of Endothelin-converting Enzyme-1 and Neutral Endopeptidase in Human Endometrium J. Histochem. Cytochem., December 1, 2007; 55(12): 1229 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iwase, H. Ando, T. Nagasaka, D. Shibata, T. Harata, Y. Shimomura, M. Goto, and F. Kikkawa Neutral Endopeptidase Expressed by Decidualized Stromal Cells Suppresses Akt Phosphorylation and Deoxyribonucleic Acid Synthesis Induced by Endothelin-1 in Human Endometrium Endocrinology, November 1, 2006; 147(11): 5153 - 5159. [Abstract] [Full Text] [PDF] |
||||
![]() |
D M Peehl Primary cell cultures as models of prostate cancer development Endocr. Relat. Cancer, March 1, 2005; 12(1): 19 - 47. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Liu, M. P. Roudier, and L. D. True Heterogeneity in Primary and Metastatic Prostate Cancer as Defined by Cell Surface CD Profile Am. J. Pathol., November 1, 2004; 165(5): 1543 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Liu and L. D. True Characterization of Prostate Cell Types by CD Cell Surface Molecules Am. J. Pathol., January 1, 2002; 160(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |