| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Division of Hematology/Oncology, and Division of Human Genetics [R. I. B.], Children’s Hospital Medical Center, Cincinnati, Ohio 45229 [D. W. L., K. Z., Z-Q. N., S. T., R. W., J. M. K., R. J. A.], and Physician Scientist Training Program, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229 [E. H. R., B. J. W.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The SNF2 subfamily of helicases is critical in the regulation of chromatin remodeling, DNA replication, repair, recombination, methylation, and transcription (4, 5, 6, 7, 8) . SNF2 polypeptides are characteristically ATPases, share several functional domains, are differentially expressed, and associate in protein complexes to perform their effector functions (4, 5, 6, 7, 8) . Yeast members of the SNF2 family are the basis for the derivation of the name SNF, which stands for "sucrose non-fermenter" (9 , 10) . Members of this family include genes involved in DNA repair (RAD5, RAD16, RAD54, and ERCC6), transcriptional regulation (Brahma, ATRX, and SNF2), and control of cell proliferation [MOT1, STH1, ISWI, BRG, and BRM (11, 12, 13, 14, 15, 16) ]. Additionally, DDM1, a SNF2 homologue identified in flowering plants, is known to facilitate DNA methylation, possibly through altering chromatin accessibility to methylation-forming complexes during replication (17) .
The multiple functions of SNF2 family members involving DNA homeostasis
and transcription suggest that these genes may play important roles
during embryogenesis and in the pathogenesis of cancer. For example,
mutations in the SNF2-like helicase ATRX result in a syndrome
characterized by X-linked mental retardation, congenital abnormalities,
and transcriptional down-regulation of 
-globin resulting in
-thalassemia (18)
. Mutations in RAD54 have been linked
to tumor formation (19
, 20)
. The human SNF5 gene
product, a BRM-associated factor, has been reported to show germ-line
and somatic mutations associated with the development of malignant
rhabdoid tumors (21
, 22)
. The HBRM protein interacts with
Rb to repress the activation of E2F1, resulting in disrupted cell cycle
regulation (23)
.
A role for SNF2 chromatin remodeling helicases in leukemia has not been established, although alterations in other chromatin remodeling proteins such as MLL and histone-modifying enzymes have been shown to be involved in translocations associated with various types of leukemia (24) . To identify genes involved in cytokine-dependent leukemic cell proliferation, survival, or apoptosis, our laboratory used a differential RNA display screen after SCF3 withdrawal from the cytokine-dependent human megakaryoblastic leukemia cell line MO7e (25) . One of the mRNAs that was found to be profoundly down-regulated after cytokine withdrawal was identified as a member of the SNF2 gene family of chromatin remodeling helicases (26, 27, 28) . This gene was originally identified as a partial cDNA called murine lymphocyte specific helicase, lsh, and its human counterpart is referred to as Hells (helicase lymphoid specific; Refs. 29 and 30 ). This report presents the full-length cDNA open reading frame for this human SNF2-like putative helicase, the locus for which is designated SMARCA6 (SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6).4 The protein product of SMARCA6 is referred to as PASG (proliferation-associated SNF2-like gene) because of the association of expression with cell proliferation (31) . Analysis of leukemia samples reveals a high incidence of an alternative PASG transcript containing a deletion of a region known to be critical for the regulation of transcription by yeast SNF2 gene products. These data suggest that PASG may play a role in leukemogenesis.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNA Isolation, Differential Display, and RNA Expression.
MO7e cells were cultured with or without SCF for 6 h, at which
time the cells were collected, and RNA was isolated using Trizol (Life
Technologies, Inc.). Purified MO7e total RNA was analyzed for
differential expression of mRNA as described by Liang and Pardee
(33)
with a Differential Display Kit (Display Systems, Los
Angeles, CA). Each PCR product was separated by electrophoresis in 5%
acrylamide gels followed by silver staining (34)
. Bands of
interest were eluted from the gel and reamplified using the same set of
primers to test for specificity and reproducibility, followed by
cloning (TA Cloning vector pCR2.1; Invitrogen, Carlsbad, CA) and
sequence analysis.
Quantitation of mRNA expression levels was determined by Northern blot hybridization in formaldehyde denaturing agarose gels. Membranes were hybridized overnight at 65°C with a [32P]dCTP (New England Nuclear, Boston, MA)-labeled 1474-bp cDNA probe representing nucleotides 692-2165 of the PASG cDNA sequence. An 18S rRNA radiolabeled probe was hybridized to membranes that had been stripped to assess RNA loading for some blots. Visualization and quantitation of PASG mRNA or rRNA expression were done with either X-ray film or a PhosphorImager (STORM 860; Molecular Dynamics, Sunnyvale, CA). Total RNA from various normal adult tissues was from Stratagene (La Jolla, CA).
cDNA Cloning and 5' RACE.
A cDNA library made from total MO7e RNA cloned into pUC19 was screened
with a PASG cDNA fragment to isolate a full-length PASG cDNA. 5' RACE
was performed to extend the extreme 5' end of the cDNA. Purified MO7e
total RNA (5 µg) was reverse-transcribed using a downstream 20-mer
gene-specific primer (GSP 1; 5'-CCACACAGAGATTAGTAGAG). This primer had
342 bp of overlap with the 5' end of the most 5' cDNA library clone. A
polyadenylation tail was added to the 3' end of the purified
product, using terminal deoxynucleotidyl transferase (Life
Technologies, Inc.). This resulting product was used as a template for
PCR, which was done using primers A
(5'-CCAGTGAGCAGAGTGAGGACTCGAGATTAATGCTACGTTTTTTTTTTT) and B
(5'-TCCTCATAACTGGCTTCTC).
The PCR product was diluted 1:5,000 in H2O and used as a template for nested PCR with the following upstream (primer C) and downstream (primer D) primers: (a) primer C, 5'- GACTCGAGATTAATGCTACGTT; and (b) primer D, 5'-GACTCCTTTTTTCTCTCCAA. All 5' RACE primers were made by Marshall University DNA Core Facility (Huntington, WV). Sequencing of cDNA clones was accomplished with either an automated DNA sequencer (PRISM, Model ABI377; Applied Biosystems, Inc. through the University of Cincinnati DNA Core) or a Sequenase kit (Ver. 2.0, Cleveland, OH) and 35S-labeled dATP (specific activity of 1500 Ci/mmol; New England Nuclear). Regions of sequence overlap from multiple clones were used to confirm continuity of sequences.
Genomic Structure and Chromosomal Mapping.
BAC clones pBeloBAC 11 16208, 16209, and 17189 (Genome Systems,
Inc., St. Louis, MO) were detected using specific primer pairs derived
from human PASG cDNA: (a) 5'-CGAATGCTGCCAGAACTAAA and
5'-TGCTGAAGTTGAAATCTCTG (clones 16208 and 16209); and (b)
5'-CGGGTGAGTGTCCAGGCATG and 5'-GCTGTTCTTCCTCTTCTAGC (clone 17189). BAC
clones were expanded and purified according to the supplier’s
protocol. Five overlapping cDNA probes covering the entire PASG open
reading frame were used for exon mapping. Exon-specific primers were
used to sequence across exon/intron boundaries.
Chromosome Mapping.
PCR on human/rodent somatic cell DNA hybrid panels from Coriell
Institute for Medical Research (Camden, NJ) allowed determination of
which chromosome contained the PASG gene. Radiation hybrid mapping
allowed for more specific chromosomal localization (Stanford G3
Radiation Hybrid Panel, RH01.02; Research Genetics, Inc., Huntsville,
AL). For FISH, a 30.9-kb BAC (BAC plasmid clone 16209; Genome Systems,
Inc.) was shown to contain a genomic insert of 23.5 kb, which spanned
part of the PASG gene. This plasmid was used as a probe for FISH
(35)
. The purified genomic clone was labeled with
digoxigenin-11-dUTP by nick translation (Boehringer Mannheim,
Indianapolis, IN). The probe mixture, including the labeled PASG
genomic clone and repetitive human DNA selected at
C0t 1 (initial concentration of DNA multiplied by
time in seconds) dissolved in Hybrisol VI (Oncor, Gaithersburg,
MD), was hybridized to normal cytogenetic metaphase slide preparations.
The slides were treated with fluorescein-labeled antidigoxigenin
antibody and counterstained with propidium iodide,
4',6-diamidino-2-phenylindole/antifade blue, and antifade, allowing
visualization under light microscopy of the areas where labeled DNA
hybridized to chromosomes. Giemsa staining selectively marked specific
chromosomal regions to create unique banding patterns for each
chromosome. These distinct bands served as landmarks along the
chromosome length and enabled identification of the specific site or
band to which the cloned genomic DNA probe had hybridized.
NLS Mutation and Analysis.
A complete open reading frame for PASG cDNA was amplified using a 5'
28-nucleotide oligomer (5'-TCAGGAGCTCAGGATGCCAGCGGAACGG-3') that
contained a SacI site and a Kozak translation initiation
sequence (AXXATGC). A 3' 30-nucleotide oligomer
(5'-TGGATCCCGGGCAAACAAACATTCAGGACT-3') included a XbaI site.
Green fluorescent protein vector (pEGFP-N1; Clontech) was used for
cloning and subsequent expression analysis. To investigate the role of
a 5' putative NLS signal, the motif was mutated using PCR-mediated
site-directed mutagenesis. An inactivating mutation in the
NH2 terminus putative NLS was constructed using
the mutagenic primer 5'-ATGAGGAAAAATAGAGGAAG-3', where the underlined
nucleotide creates a K to N substitution in the NLS (see Fig. 7
for a
schematic; Ref. 36
). Resulting PCR fragments were cloned
into pGEMTeasy vector (Promega, Madison, WI) and then subcloned into
the PASG-EGFP construct used for nuclear localization studies.
|
To determine the degree of disruption of nuclear targeting, 100 EGFP-positive cells were counted and visually scored for nuclear-only localization of the transfected protein. The individual performing the scoring was blinded as to the constructs being scored. The transfections were repeated three times, and the average percentage of EGFP-positive cells with nuclear-only localization was compared. Significant differences between the means were determined using Student’s t test in Microsoft Excel.
Western blotting of PASG-EGFP products was accomplished as follows. Cells were washed twice with PBS, exposed to RIPA2 buffer [20 mM Tris (pH 7.4), 10% glycerol, 137 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 0.5% sodium deoxycholate with 0.6 mM phenylmethylsulfonyl fluoride, 4.5 µg/ml aprotinin, and 1 µg/ml pepstatin], and collected with a rubber policeman. The cell lysate was shaken vigorously for 20 min at 4°C and microfuged at high speed for 10 min at 4°C. Aliquots of the supernatant were snap-frozen in liquid nitrogen and stored at -80°C. Protein concentrations were determined using Protein Assay (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. Approximately 50 µg of total cell lysate were denatured in 6x SDS/2-mercaptoethanol loading buffer (37) at 100°C for 10 min, electrophoresed on a 10% polyacrylamide gel, and transferred to nylon membranes (Amersham). These membranes were reversibly stained with Ponceau S to determine the evenness of transfer and loading (38) . Membranes were blocked with 10% nonfat dry milk in TBST for 1 h at 37°C and exposed to anti-GFP (Clontech) mouse monoclonal antibody at a dilution of 1:1000 in 10% milk/TBST for 1 h at 25°C. Membranes were washed in TBST and incubated for 1 h at 25°C in alkaline phosphatase-conjugated goat antimouse secondary antibody (Promega) at a 1:5000 dilution in 10% milk/TBST. After washing in TBST and TBS, blots were developed with nitroblue tetrazolium/5-bromo-4-chloro-3-indoyl phosphate (Sigma) according to the manufacturer’s instructions. Blots were scanned and processed for publication using Adobe Photoshop.
Deletion Analysis.
Total RNA was extracted from bone marrow, peripheral blood mononuclear
cells, fresh or frozen tissue, and cultured cells using Trizol reagent.
Full-length cDNA was synthesized using Superscript RNase H-Reverse
Transcriptase (Life Technologies, Inc.). To detect a 75-bp deletion
(from nucleotides 2014–2088) first identified in the MO7e cDNA
library, primers were designed that would amplify either a 255-bp
wild-type or a 180-bp deleted region: (a) 5' primer,
5'-CAGAGATTTCAACTTCAGCAG-3'; and (b) 3' primer,
5'-AGGCGATAAACAACAACTGG-3'. Reverse-transcribed templates were
amplified for 30 cycles (95°C for 30 s, 60°C for 45 s,
and 72°C for 30 s) using a Gene Amp PCR system 9700
(Perkin-Elmer/Applied Biosystems, Foster City, CA). The amplified
products were analyzed by agarose gel electrophoresis. Samples
containing a shorter product on the agarose gel were cloned into
pGEM-T-easy TA cloning vector (Promega). Cloned inserts were
sequenced to confirm the presence of the transcript with the 75-bp
deletion. Negative controls for deletion analysis included standard
water controls and patient total RNA samples that had not been
subjected to reverse transcription.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. One of the cDNAs identified from this screen had
significant homology to a conserved domain shared by a variety of DNA
and RNA helicases (data not shown). Northern blot analysis demonstrated
that this cDNA recognized an approximately 3.5-kb mRNA and confirmed
the decrease in expression after cytokine withdrawal (Fig. 1B)
. A higher molecular weight species of approximately 7.5
kb (data not shown) is hypothesized to represent a precursor of the
3.5-kb mRNA, but this has not been formally proven. To determine
whether the decrease in PASG expression was related to the induction of
apoptosis or growth arrest, MO7e cells were cultured in the absence of
FBS in the presence of 20 ng/ml SCF (Fig. 1C)
. Cells
cultured under these conditions undergo growth arrest but show minimal
apoptosis (Fig. 1D)
. Northern blot analysis demonstrates
that under such conditions of growth arrest without the induction of
apoptosis, the level of PASG mRNA declines dramatically (Fig. 1C)
. However, 24 h after returning cells to FBS, the
level of PASG mRNA again increases, demonstrating that the cells were
still viable and that the induction of proliferation by the addition of
FBS results in an increase of PASG mRNA (Fig. 1C)
. At
approximately 8–12 h after the addition of FBS, a rise in
[3H]thymidine incorporation is detectable,
which continues to increase along with cell numbers over 24 h
(data not shown). These results link PASG transcript expression more
closely with proliferation than with the inhibition of apoptosis.
|
. This open reading frame sequence was confirmed by sequencing cDNAs
from normal human thymus. The position of two in-frame stop codons in
the extreme 5' region followed by a Kozak consensus ATG start site
(39
, 40) as well as the presence of a 3' TAA termination
codon suggests that the 2514-nucleotide sequence (838 amino acids) is
the full-length open reading frame (Fig. 2)
. The cDNA sequence includes
a 105-nucleotide 5' UTR and a 477-nucleotide 3' UTR containing a
cognate polyadenylation sequence (Fig. 2)
. We believe that the
5' UTR should be approximately 500 bp long to account for the 3.5-kb
transcript size estimated from Northern blotting, but reverse
transcription through a highly GC-rich area in the 5' region upstream
from the start site was unsuccessful. This human sequence includes an
open reading frame that is 230 amino acids longer at the
NH2 terminus than the previously identified
murine cDNA and adds the 5' and 3' UTRs to the previously published
sequence (29
, 30)
. These sequences have also been
confirmed by sequencing genomic BAC clones. Domains originally shown to
be characteristic of other DNA and RNA helicases are shown in Fig. 2
,
as highlighted in black (I, Ia, II, III, IV, V and VI),
whereas those domains more recently shown to also share significant
homology among the SNF2 subfamily are depicted by gray
highlighting (domains IVa and IVb; Refs. 26, 27, 28
).
|
(27
, 28)
. Significant
homology with DDM1 and SNF2L also exists outside of the classical
helicase domains, suggesting a relatively recent evolutionary
divergence (Fig. 3, A and B
; Refs.
27
and 28
). This cDNA is one of the smallest
known members of the SNF2 gene family identified thus far, being
approximately the same size as RAD54 (Fig. 3B)
. However,
PASG is significantly more homologous to SNF2L than to human RAD54,
suggesting a shared function with SNF2L (Fig. 3A
; Refs.
27
and 28
). Of interest is that the spacing
of conserved motifs in PASG differs from other known members of the
SNF2 family in that PASG has additional amino acids inserted between
domains IV and V (Figs. 2
3)
. The functional significance of these
additional amino acids is unclear at this time.
|
.
|
. The human PASG gene has 22 exons that encode the open reading frame
(Table 1
; Fig. 5
). The location of conserved helicase domains is also noted. The
definition of conserved helicase domains is based on the analyses by
Gorbalenya et al. (26)
as well as Richmond and
Peterson (9)
. Using these criteria, the following
observations can be made for PASG genomic organization: most of the
conserved helicase domains lie within a single exon (Fig. 4
; Table 1
);
however, domain II, which contains the DEGH motif, could be considered
to be split between exons 10 and 11. Whereas the DEGH and immediately
surrounding sequences are contained within exon 11, there is an intron
situated between the glutamine (Q) and histidine (H) located 10 and 9
amino acids 5' to the DEGH motif, respectively. Thus, two amino acids
(L and Q) are contained within exon 10, whereas the remainder of domain
II lies within exon 11. Domain IVb is also split between exons 16 and
17. Domain IV lies completely within exon 13, based on the schema
described previously (Fig. 5
; Table 1
; Ref. 9
). Intron
size was determined by direct sequencing or estimated by the size of
PCR products spanning two consecutive exons.
|
|
; Ref. 39
).
In addition, this first ATG appears to be represented in the dominant
RNA transcript as assessed by RT-PCR (Fig. 6A)
. Of interest, however, is the presence of an alternative
splicing variant that results in the deletion of the first ATG (Fig. 6B)
. The donor and acceptor sites that form the sequence
basis for the alternative splicing are shown in Table 2
. This second ATG (at position +49) also contains surrounding
nucleotides for an acceptable Kozak box
(GCA-ATG-GTT). The alternative splicing variant
results in a predicted protein that is 16 amino acids shorter at the
NH2 terminus than that encoded by the dominant
transcript. This shorter transcript has been observed in all tissues
and cell lines sampled thus far as a minor mRNA species (data not
shown). These data demonstrate that the size of the human PASG product
is encoded by a locus of approximately 40,000 nucleotides situated at
chromosomal 10q23-q24; the gene locus contains 22 exons contributing to
the open reading frame. In addition, there is evidence for alternative
splicing at the 5' end of the gene that results in a protein with a
predicted alternative NH2 terminus.
|
|
. To investigate the role of this putative NLS, we used
PCR-mediated site-directed mutagenesis (Fig. 7A)
. The
mutation was cloned into a full-length PASG construct that was fused to
the EGFP, and the construct was transfected into COS-7 cells followed
by fluorescence microscopy. Mutation of the residue significantly
(P < 0.001) decreases the nuclear
localization of PASG when compared with EGFP-PASG. (Fig. 7C)
. Fig. 7B
shows the dramatic degree of
disruption of PASG addressing observed when the NLS signal is mutated.
Whereas the vast majority of cells transfected with the EGFP-PASG
NLS
show disrupted subcellular localization, a small percentage of cells
maintain proper nuclear location, suggesting that PASG may contain an
additional NLS motif. A comparable degree of disruption is seen when
constructs are transfected into NIH 3T3 or COS-7 cells,
demonstrating that this effect is not cell-type specific.
To ensure that the constructs produced full-length protein products,
Western blotting of PASG-GFP products was performed. At 48 h after
transfection, whole cell lysates were harvested. Anti-GFP Western
blotting shows that GFP-reactive bands of the appropriate size are
present in cells transfected with EGFP-PASG and EGFP-PASGNLS. Based
on the sequence data presented here, PASG is predicted to have a
molecular weight of approximately 97,000. The EGFP portion of
the fusion protein is predicted to add approximately
Mr 27,000 in size, suggesting that a
full-length EGFP-PASG protein should have a molecular weight of
approximately 124,000. As observed in Fig. 7D
, one of the
two GFP-positive bands migrates at approximately
Mr 124,000. A band appearing to run
Mr 10,000 less could be explained by
an alternative translational start at a downstream methionine (M86),
which is also surrounded by a conserved Kozak translational start
sequence. A PASG polypeptide beginning at M86 would have a predicted
molecular weight of 9,400 less than that of full-length PASG.
Expression of PASG Transcripts in Normal and Neoplastic Tissues and
Cell Lines.
The expression pattern of PASG mRNA in normal adult tissues was
determined using Northern blot hybridization. The highest levels of
expression of PASG mRNA are observed in the adult thymus and testis
(Fig. 8A)
. However, expression is also observed at dramatically
lower levels in other tissues, such as the uterus, small intestines,
colon, and peripheral blood mononuclear cells (Fig. 8, A and B)
. PASG mRNA is also present at relatively high levels in
mononuclear cells isolated from normal bone marrow (Fig. 8B
,
Lanes 2–5). Peripheral blood mononuclear cells,
representing mostly PBLs freshly isolated from normal individuals,
demonstrate detectable levels of PASG mRNA, although significantly less
than that observed in the thymus or bone marrow [Fig. 8B
,
compare Lanes 2–5 (bone marrow) with Lanes
10–11 (thymus) and Lanes 6–8 (PBLs)]. However,
activation of PBLs by a 3-day exposure to ConA results in a profound
increase in the level of PASG mRNA to the level of that seen in thymus
(Fig. 8
B, Lane 9).
|
. Whereas the
level of PASG mRNA varied considerably among the different cell lines,
some expression was detectable in all cell lines tested by Northern
blot hybridization. To examine the expression of PASG mRNA in
hematopoietic malignancies, samples of AML and ALL were analyzed. The
results showed that all samples of AML expressed relatively high levels
of PASG mRNA, regardless of whether they were obtained at diagnosis or
relapse (Fig. 8D
, Lanes 3–6). Whereas an
extensive analysis of all FAB subtypes of AML has not been performed,
samples from all FAB subtypes (M6 subtype not tested) have shown PASG
mRNA expression (Fig. 8
; data not shown). In addition, samples of both
T-cell and pre-B-cell ALL also showed expression of PASG mRNA, although
there was more variability, with some samples having relatively low
levels compared with that observed in AML samples [Fig. 8D
,
compare Lanes 3–6 (AML) with Lanes 7–11
(ALL)]. These results show that PASG mRNA is differentially expressed in normal and neoplastic human tissue and that it does not appear to be restricted to lymphocytes. In addition, the level of human PASG mRNA shows a significant increase when PBLs are activated and stimulated to proliferate after exposure to ConA, similar to that observed for the mouse homologue (29) .
Detection of a 75-nucleotide Deletion in PASG mRNA in both AML and
ALL.
During the screening and sequencing of cDNAs from the original cDNA
library derived from the myeloid leukemia cell line MO7e, a cDNA clone
was identified that had an in-frame 75-bp deletion in the COOH-terminal
half of the molecule. To determine whether this deletion was unique to
MO7e or might be present in leukemic blasts from patients, we screened
both AML and ALL samples by RT-PCR as described in "Materials and
Methods." The RT-PCR product for wild-type mRNA produces a 255-bp
amplicon, whereas the mRNA with the deletion gives a 180-bp fragment.
Fig. 9A
shows the presence of both transcripts in approximately
equal amounts obtained from leukemic blasts from a patient with AML
(Lane 1) and one from a patient with ALL (Lane
2). Samples, which show only the 255-bp wild-type product, are
included from a myeloid leukemia cell line, Spurlock (Lane
3), an ovarian cancer (Lane 4), and an EBV-transformed
lymphoblastoid cell line (Lane 5). Sequence analysis shows
that the longer amplicon represents the wild-type PASG mRNA, whereas
the shorter amplicon contains the in-frame 75-bp deletion (Fig. 9B)
. The analysis of additional samples of AML and ALL
demonstrates that the presence of the PASG mRNA with the 75-bp deletion
(PASG-75bp) occurs in approximately 57% of AML
samples and 37% of ALL samples (Table 3)
. The expression of the PASG-75bp mRNA was
observed in all AML FAB subtypes, except the M6 subtype, which was not
tested, as well as in both T-cell and pre-B-cell ALL (Table 3
; data not
shown). Interestingly, none of 20 samples of ovarian cancer or a
variety of transformed cell lines showed this deletion (Table 3)
. In
addition, the PASG-75bp mRNA form was not
observed in normal tissues, including bone marrow, thymus, and
quiescent or activated lymphocytes (Table 3)
. However, these data
cannot completely rule out the possibility that some normal tissues
could express this alternative mRNA in a small subset of cells or at a
very low level.
|
|
10)
. However, because the deletion results in an in-frame loss of
nucleotides, a complete mRNA is formed with the exception of the
deleted sequence. When DNA from several samples of leukemia or MO7e was
analyzed for genomic mutations at the donor/acceptor sites for
intron/exon boundaries in this region or in the downstream intron, no
mutations or abnormal sequences were found (data not shown). However,
there is a satisfactory donor splice sequence found within exon 18 that
serves as a donor site for the generation of the
PASG-75bp mRNA found in AML and ALL (Fig. 10)
. It
is unclear at this time why this site is used in addition to the normal
donor splice site in these acute leukemias. Of further interest is that
the region that is deleted contains an amino acid motif
(STRAGGLG) known to be critical for transcriptional activation
by the yeast SWI2/SNF2 polypeptide (9)
. The
PASG-75bp mutant mRNA in human leukemia thus
appears to arise as an abnormal, alternative RNA processing event.
These results suggest that the mutant PASG-75bp
mRNA may contribute to the altered physiology of leukemic blasts from
AML and ALL.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Different families of helicases play important roles in normal growth and development as well as in malignant cell transformation and cancer cell physiology (21 , 22 , 41 , 42) . The demonstration that the PASG gene is located on chromosome 10q23-q24 raises the possibility that it may also contribute to the development or physiology of several types of malignancies. This region of chromosome 10 has been associated with loss of heterozygosity in a variety of malignancies including prostate and ovarian cancer, glioblastoma, and high-grade astrocytomas as well as in subtypes of leukemia and lymphoma (43, 44, 45, 46, 47, 48, 49, 50, 51) . Our laboratory is currently screening such malignancies by single-strand conformational polymorphism analysis to determine whether and to what extent PASG might be altered.
In our initial assessment of PASG expression in leukemia, we observed the presence of a highly expressed transcript containing a 75-nucleotide deletion (PASG-75bp). This alternatively processed PASG transcript was observed in approximately 35% and 60% of ALL and AML samples, respectively. The predicted protein resulting from this in-frame deletion lacks 25 amino acids from exon 18 in the COOH-terminal half of the PASG protein. The 25-amino acid region contains the fourth conserved helicase motif including the sequence STRAGGLG. This conserved sequence has been shown by mutational analysis of the yeast SWI2/SNF2 polypeptide to be critical for the transactivation of genes involved in sucrose fermentation (9) . Specifically, the expression of SWI2/SNF2 mRNA containing the deletion of the sequence STRAGGLG results in a dominant negative phenotype and the inability of yeast to transactivate specific enzymatic pathways involved in sugar metabolism (9) . By analogy, the expression of PASG mRNA with a deletion involving this conserved sequence could also function in a dominant negative fashion in human leukemia. This might in turn lead to altered regional specific chromatin remodeling, resulting in altered gene expression (24) . The high homology of PASG to the DDM1 helicase also raises the possibility that PASG could be involved in chromatin remodeling essential for accessibility of DNA methylation enzymatic machinery (17 , 52) . The effect of a dominant negative form of PASG would then potentially result in the loss of gene specific methylation after DNA replication. A consequence of hypomethylation may be inappropriate expression of genes that play roles in altering cell proliferation and possibly drug resistance (52) . We are currently extending our analysis of PASG in leukemia as well as exploring the functional consequences of the 75-bp deletion.
Mutations and translocations involving histone acetylases and associated proteins are involved in the development of both myeloid and lymphoid leukemias (24) . For example, the MLL gene may contribute to altered chromatin remodeling and transcription by recruiting histone acetylases and/or SWI/SNF-like helicases (24) . If there is abnormal expression and/or localization of MLL secondary to a translocation event, the abnormal derepression of genes regulated by MLL might also occur due to aberrant recruitment and function of chromatin remodeling proteins (53) . Whether PASG is a component of such chromatin remodeling complexes remains to be established.
We have described several alternative forms of a SNF2-like helicase, PASG, which could potentially alter its function. The alternatively processed transcript, which results in the deletion of the first ATG, would produce a predicted protein that has lost 16 amino acids from the NH2 terminus. It will be of interest to know whether this NH2 terminus truncation affects PASG function. In addition, the critical role of a NLS in transporting PASG to the nucleus predicts the possibility that mutations changing or deleting this sequence would result in a PASG protein incapable of performing its nuclear function(s). The observation that a subset of human acute leukemias expresses an altered PASG transcript with a 75-nucleotide (25-amino acid) deletion involving a conserved domain known to result in a dominant negative polypeptide of the yeast homologue SWI2/SNF2 suggests that this altered form of PASG may also disrupt normal hematopoietic cell functions. Whether and by what mechanism the altered form of PASG contributes to leukemogenesis will require further work linking structural changes to functional consequences.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported in part by the Ohio Cancer Research
Associates and the Children’s Hospital Research Foundation. 
2 To whom requests for reprints should be
addressed, at Divisions of Hematology/Oncology and Genetics,
Children’s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH
45229. E-mail: Robert.Arceci{at}chmcc.org
3 The abbreviations used are: SCF, stem cell
factor; FBS, fetal bovine serum; NLS, nuclear localization sequence;
AML, acute myelogenous leukemia; ALL, acute lymphoblastic leukemia;
RACE, rapid amplification of cDNA ends; BAC, bacterial artificial
chromosome; FISH, fluorescence in situ hybridization;
BrdUrd, bromodeoxyuridine; TBST, Tris-buffered saline/Tween 20; GFP,
green fluorescent protein; EGFP, enhanced GFP; UTR, untranslated
region; RT-PCR, reverse transcription-PCR; PBL, peripheral blood
lymphocyte; ConA, concanavalin A; FAB, French-American-British.
4 The GenBank accession number for human PASG cDNA
is AF155827, and the Human Gene Nomenclature Committee designation for
this locus is SMARCA6.
Received 10/13/99. Accepted 4/28/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-thalassemia (ATR-X syndrome). Cell, 80: 837-845, 1995.[Medline]
-satellite DNA in bone marrow cells of a patient with acute myeloid leukemia. Cancer Genet. Cytogenet., 89: 1-6, 1996.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. J. Liguori, E. A.G. Blomme, and J. F. Waring Trovafloxacin-Induced Gene Expression Changes in Liver-Derived in Vitro Systems: Comparison of Primary Human Hepatocytes to HepG2 Cells Drug Metab. Dispos., February 1, 2008; 36(2): 223 - 233. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. A. Rauch, X. Zhong, X. Wu, M. Wang, K. H. Kernstine, Z. Wang, A. D. Riggs, and G. P. Pfeifer High-resolution mapping of DNA hypermethylation and hypomethylation in lung cancer PNAS, January 8, 2008; 105(1): 252 - 257. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Gibbons Histone modifying and chromatin remodelling enzymes in cancer and dysplastic syndromes Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R85 - R92. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Venables Aberrant and Alternative Splicing in Cancer Cancer Res., November 1, 2004; 64(21): 7647 - 7654. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Marinkovic, T. Marinkovic, E. Kokai, T. Barth, P. Moller, and T. Wirth Identification of novel Myc target genes with a potential role in lymphomagenesis Nucleic Acids Res., October 11, 2004; 32(18): 5368 - 5378. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L.-Q. Sun, D. W. Lee, Q. Zhang, W. Xiao, E. H. Raabe, A. Meeker, D. Miao, D. L. Huso, and R. J. Arceci Growth retardation and premature aging phenotypes in mice with disruption of the SNF2-like gene, PASG Genes & Dev., May 1, 2004; 18(9): 1035 - 1046. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Yan, E. Cho, S. Lockett, and K. Muegge Association of Lsh, a Regulator of DNA Methylation, with Pericentromeric Heterochromatin Is Dependent on Intact Heterochromatin Mol. Cell. Biol., December 1, 2003; 23(23): 8416 - 8428. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Fan, Q. Yan, J. Huang, S. Austin, E. Cho, D. Ferris, and K. Muegge Lsh-deficient Murine Embryonal Fibroblasts Show Reduced Proliferation with Signs of Abnormal Mitosis Cancer Res., August 1, 2003; 63(15): 4677 - 4683. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Scanlan, S. Welt, C. M. Gordon, Y.-T. Chen, A. O. Gure, E. Stockert, A. A. Jungbluth, G. Ritter, D. Jager, E. Jager, et al. Cancer-related Serological Recognition of Human Colon Cancer: Identification of Potential Diagnostic and Immunotherapeutic Targets Cancer Res., July 15, 2002; 62(14): 4041 - 4047. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
according to
Gorbalenya et al. 
