Cancer Research Annual Meeting 2010  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D. W.
Right arrow Articles by Arceci, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D. W.
Right arrow Articles by Arceci, R. J.
[Cancer Research 60, 3612-3622, July 1, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

Proliferation-associated SNF2-like Gene (PASG): A SNF2 Family Member Altered in Leukemia1

David W. Lee, Kejian Zhang, Zhi-Qiang Ning, Eric H. Raabe, Suzanne Tintner, Regina Wieland, Benjamin J. Wilkins, Julia M. Kim, Ruthann I. Blough and Robert J. Arceci2

Division of Hematology/Oncology, and Division of Human Genetics [R. I. B.], Children’s Hospital Medical Center, Cincinnati, Ohio 45229 [D. W. L., K. Z., Z-Q. N., S. T., R. W., J. M. K., R. J. A.], and Physician Scientist Training Program, University of Cincinnati College of Medicine, Cincinnati, Ohio 45229 [E. H. R., B. J. W.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
To identify genes involved in cell growth and/or apoptosis in leukemia, differential display was used to identify mRNAs that showed altered expression levels after cytokine withdrawal from the cytokine-dependent MO7e cell line. Sequence analysis of one transcript that showed a profound decrease in expression after cytokine withdrawal revealed it to be a member of the SNF2 family of chromatin remodeling ATPases. This cDNA had a 2514-nucleotide (838-amino acid) open reading frame and encoded an additional 230 amino acids at the NH2 terminus compared with the murine homologue, lsh, and the human counterpart, Hells. This gene locus has been designated SMARCA6 (SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6). The highest levels of mRNA expression in humans are observed in proliferative tissues such as the thymus, testis, and bone marrow. Whereas cytokine withdrawal in MO7e cells leads to apoptosis and decreased mRNA expression, growth arrest without the induction of apoptosis of MO7e cells also leads to down-regulation of mRNA expression, suggesting an association with cell proliferation and not suppression of apoptosis. Nuclear localization of this SNF2-like putative helicase is dependent on a nuclear localization sequence located in the NH2-terminal region. Based on sequence homology to other SNF2-like helicases, the pattern of tissue expression, and the association of expression with cell proliferation, we refer to the protein product as proliferation-associated SNF2-like gene product [PASG (D. W. Lee et al., Blood, 94: 594a, 1999)]. Examination of acute myelogenous leukemia and acute lymphoblastic leukemia samples revealed a high frequency of a PASG transcript containing an in-frame 75-nucleotide deletion, which codes for a conserved motif known to be critical for the transactivation activity of a related yeast SWI/SNF polypeptide. These results extend our knowledge of this SNF2-like family member and suggest a role for PASG in leukemogenesis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Our understanding of the molecular mechanisms that balance hematopoietic cell proliferation, survival, differentiation, and apoptosis remains incomplete. However, a common feature regulating and supporting these processes is the dependence on soluble and/or membrane-bound cytokines and their cognate receptor systems (1 , 2) . After the binding of cytokines to their receptors, a series of signal transduction pathways are activated that result in changes in cellular physiology, growth, and/or differentiation. In addition, the withdrawal of particular cytokines or survival factors often leads to apoptosis (1 , 2) . These regulatory mechanisms also play important roles in leukemic cell transformation and growth (3) .

The SNF2 subfamily of helicases is critical in the regulation of chromatin remodeling, DNA replication, repair, recombination, methylation, and transcription (4, 5, 6, 7, 8) . SNF2 polypeptides are characteristically ATPases, share several functional domains, are differentially expressed, and associate in protein complexes to perform their effector functions (4, 5, 6, 7, 8) . Yeast members of the SNF2 family are the basis for the derivation of the name SNF, which stands for "sucrose non-fermenter" (9 , 10) . Members of this family include genes involved in DNA repair (RAD5, RAD16, RAD54, and ERCC6), transcriptional regulation (Brahma, ATRX, and SNF2), and control of cell proliferation [MOT1, STH1, ISWI, BRG, and BRM (11, 12, 13, 14, 15, 16) ]. Additionally, DDM1, a SNF2 homologue identified in flowering plants, is known to facilitate DNA methylation, possibly through altering chromatin accessibility to methylation-forming complexes during replication (17) .

The multiple functions of SNF2 family members involving DNA homeostasis and transcription suggest that these genes may play important roles during embryogenesis and in the pathogenesis of cancer. For example, mutations in the SNF2-like helicase ATRX result in a syndrome characterized by X-linked mental retardation, congenital abnormalities, and transcriptional down-regulation of {alpha}-globin resulting in {alpha}-thalassemia (18) . Mutations in RAD54 have been linked to tumor formation (19 , 20) . The human SNF5 gene product, a BRM-associated factor, has been reported to show germ-line and somatic mutations associated with the development of malignant rhabdoid tumors (21 , 22) . The HBRM protein interacts with Rb to repress the activation of E2F1, resulting in disrupted cell cycle regulation (23) .

A role for SNF2 chromatin remodeling helicases in leukemia has not been established, although alterations in other chromatin remodeling proteins such as MLL and histone-modifying enzymes have been shown to be involved in translocations associated with various types of leukemia (24) . To identify genes involved in cytokine-dependent leukemic cell proliferation, survival, or apoptosis, our laboratory used a differential RNA display screen after SCF3 withdrawal from the cytokine-dependent human megakaryoblastic leukemia cell line MO7e (25) . One of the mRNAs that was found to be profoundly down-regulated after cytokine withdrawal was identified as a member of the SNF2 gene family of chromatin remodeling helicases (26, 27, 28) . This gene was originally identified as a partial cDNA called murine lymphocyte specific helicase, lsh, and its human counterpart is referred to as Hells (helicase lymphoid specific; Refs. 29 and 30 ). This report presents the full-length cDNA open reading frame for this human SNF2-like putative helicase, the locus for which is designated SMARCA6 (SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6).4 The protein product of SMARCA6 is referred to as PASG (proliferation-associated SNF2-like gene) because of the association of expression with cell proliferation (31) . Analysis of leukemia samples reveals a high incidence of an alternative PASG transcript containing a deletion of a region known to be critical for the regulation of transcription by yeast SNF2 gene products. These data suggest that PASG may play a role in leukemogenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell Lines, Culture Conditions, and Apoptosis Determination.
MO7e cells were cultured in RPMI 1640 containing 1% penicillin/streptomycin, 1% L-glutamine (all Life Technologies, Inc.), and 10% FBS (BioWhittaker, Walkersville, MD) supplemented with SCF (Genetics Institute, Cambridge, MA). Other cell lines included HL60, Spurlock, and K562 (myeloid leukemia-derived cell lines); Molt4 and CEM (T-cell-derived lymphoma/leukemia); Raji (B-cell lymphoma); PC-3, DU145, LNCAP, Lan2, Lan5, and Lan6 (prostate cancer-derived cell lines); EW-1 (Ewing’s sarcoma-derived cell line); and EBV-transformed lymphoblast cell lines. Apoptotic cell death after SCF withdrawal from MO7e cells was evaluated by acridine orange staining as described previously (32) . Briefly, MO7e cells (1 x 105 cells/well) were cultured in 96-well plates in the absence of SCF. Cells were collected at various times and stained with acridine orange (Sigma, St. Louis, MO) at a final concentration of 4 µg/ml for 10 min at room temperature. The stained cells were exposed to light with a wavelength of 570 nm and observed using a fluorescence microscope (Nikon Inc., Melville, NY). Apoptotic cells were identified by their condensed and/or fragmented nuclei, whereas normal cell nuclei had a typically even and rounded fluorescence pattern (32) .

RNA Isolation, Differential Display, and RNA Expression.
MO7e cells were cultured with or without SCF for 6 h, at which time the cells were collected, and RNA was isolated using Trizol (Life Technologies, Inc.). Purified MO7e total RNA was analyzed for differential expression of mRNA as described by Liang and Pardee (33) with a Differential Display Kit (Display Systems, Los Angeles, CA). Each PCR product was separated by electrophoresis in 5% acrylamide gels followed by silver staining (34) . Bands of interest were eluted from the gel and reamplified using the same set of primers to test for specificity and reproducibility, followed by cloning (TA Cloning vector pCR2.1; Invitrogen, Carlsbad, CA) and sequence analysis.

Quantitation of mRNA expression levels was determined by Northern blot hybridization in formaldehyde denaturing agarose gels. Membranes were hybridized overnight at 65°C with a [32P]dCTP (New England Nuclear, Boston, MA)-labeled 1474-bp cDNA probe representing nucleotides 692-2165 of the PASG cDNA sequence. An 18S rRNA radiolabeled probe was hybridized to membranes that had been stripped to assess RNA loading for some blots. Visualization and quantitation of PASG mRNA or rRNA expression were done with either X-ray film or a PhosphorImager (STORM 860; Molecular Dynamics, Sunnyvale, CA). Total RNA from various normal adult tissues was from Stratagene (La Jolla, CA).

cDNA Cloning and 5' RACE.
A cDNA library made from total MO7e RNA cloned into pUC19 was screened with a PASG cDNA fragment to isolate a full-length PASG cDNA. 5' RACE was performed to extend the extreme 5' end of the cDNA. Purified MO7e total RNA (5 µg) was reverse-transcribed using a downstream 20-mer gene-specific primer (GSP 1; 5'-CCACACAGAGATTAGTAGAG). This primer had 342 bp of overlap with the 5' end of the most 5' cDNA library clone. A polyadenylation tail was added to the 3' end of the purified product, using terminal deoxynucleotidyl transferase (Life Technologies, Inc.). This resulting product was used as a template for PCR, which was done using primers A (5'-CCAGTGAGCAGAGTGAGGACTCGAGATTAATGCTACGTTTTTTTTTTT) and B (5'-TCCTCATAACTGGCTTCTC).

The PCR product was diluted 1:5,000 in H2O and used as a template for nested PCR with the following upstream (primer C) and downstream (primer D) primers: (a) primer C, 5'- GACTCGAGATTAATGCTACGTT; and (b) primer D, 5'-GACTCCTTTTTTCTCTCCAA. All 5' RACE primers were made by Marshall University DNA Core Facility (Huntington, WV). Sequencing of cDNA clones was accomplished with either an automated DNA sequencer (PRISM, Model ABI377; Applied Biosystems, Inc. through the University of Cincinnati DNA Core) or a Sequenase kit (Ver. 2.0, Cleveland, OH) and 35S-labeled dATP (specific activity of 1500 Ci/mmol; New England Nuclear). Regions of sequence overlap from multiple clones were used to confirm continuity of sequences.

Genomic Structure and Chromosomal Mapping.
BAC clones pBeloBAC 11 16208, 16209, and 17189 (Genome Systems, Inc., St. Louis, MO) were detected using specific primer pairs derived from human PASG cDNA: (a) 5'-CGAATGCTGCCAGAACTAAA and 5'-TGCTGAAGTTGAAATCTCTG (clones 16208 and 16209); and (b) 5'-CGGGTGAGTGTCCAGGCATG and 5'-GCTGTTCTTCCTCTTCTAGC (clone 17189). BAC clones were expanded and purified according to the supplier’s protocol. Five overlapping cDNA probes covering the entire PASG open reading frame were used for exon mapping. Exon-specific primers were used to sequence across exon/intron boundaries.

Chromosome Mapping.
PCR on human/rodent somatic cell DNA hybrid panels from Coriell Institute for Medical Research (Camden, NJ) allowed determination of which chromosome contained the PASG gene. Radiation hybrid mapping allowed for more specific chromosomal localization (Stanford G3 Radiation Hybrid Panel, RH01.02; Research Genetics, Inc., Huntsville, AL). For FISH, a 30.9-kb BAC (BAC plasmid clone 16209; Genome Systems, Inc.) was shown to contain a genomic insert of 23.5 kb, which spanned part of the PASG gene. This plasmid was used as a probe for FISH (35) . The purified genomic clone was labeled with digoxigenin-11-dUTP by nick translation (Boehringer Mannheim, Indianapolis, IN). The probe mixture, including the labeled PASG genomic clone and repetitive human DNA selected at C0t 1 (initial concentration of DNA multiplied by time in seconds) dissolved in Hybrisol VI (Oncor, Gaithersburg, MD), was hybridized to normal cytogenetic metaphase slide preparations. The slides were treated with fluorescein-labeled antidigoxigenin antibody and counterstained with propidium iodide, 4',6-diamidino-2-phenylindole/antifade blue, and antifade, allowing visualization under light microscopy of the areas where labeled DNA hybridized to chromosomes. Giemsa staining selectively marked specific chromosomal regions to create unique banding patterns for each chromosome. These distinct bands served as landmarks along the chromosome length and enabled identification of the specific site or band to which the cloned genomic DNA probe had hybridized.

NLS Mutation and Analysis.
A complete open reading frame for PASG cDNA was amplified using a 5' 28-nucleotide oligomer (5'-TCAGGAGCTCAGGATGCCAGCGGAACGG-3') that contained a SacI site and a Kozak translation initiation sequence (AXXATGC). A 3' 30-nucleotide oligomer (5'-TGGATCCCGGGCAAACAAACATTCAGGACT-3') included a XbaI site. Green fluorescent protein vector (pEGFP-N1; Clontech) was used for cloning and subsequent expression analysis. To investigate the role of a 5' putative NLS signal, the motif was mutated using PCR-mediated site-directed mutagenesis. An inactivating mutation in the NH2 terminus putative NLS was constructed using the mutagenic primer 5'-ATGAGGAAAAATAGAGGAAG-3', where the underlined nucleotide creates a K to N substitution in the NLS (see Fig. 7Citation for a schematic; Ref. 36 ). Resulting PCR fragments were cloned into pGEMTeasy vector (Promega, Madison, WI) and then subcloned into the PASG-EGFP construct used for nuclear localization studies.



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Mutation of PASG nuclear localization signal disrupts subcellular localization. When a consensus nuclear localization signal near the NH2 terminus of PASG is mutated by site-directed mutagenesis (A), EGFP-PASG fusion proteins lose their nuclear-only subcellular localization pattern. B, quantitation of the average percentage of nuclear-only localization of vector only (EGFP-N1), wild-type PASG (EGFP-PASG), and PASG with mutated NLS (PASG{Delta}NLS). Bars, SE of three separate experiments. Asterisk, P < 0.001 EGFP-PASG{Delta}NLS versus EGFP-PASG by Student’s t test. C, comparison of nuclear localization in COS-7 cells by fluorescence microscopy using anti-BrdUrd antibody to visualize nuclei. Bar, 20 µm. D, Western blot using anti-EGFP monoclonal antibody of total cell lysate from untransfected, vector-only, and EGFP-PASG-transfected COS-7 cells. Arrowheads indicate two species of EGFP-PASG fusion protein. The extremely high molecular weight band present in all lanes is nonspecific. The intense band at approximately Mr 27,000 in Lane EGFP-N1 is unfused EGFP.

 
These constructs were transfected into COS-7 or NIH 3T3 cells using Effectene (Qiagen) or DOSPER (Boehringer Mannheim) liposomal reagents according to the manufacturers’ instructions. Forty-eight h later, cells were split at low density onto multiwell LabTek (Nalge Nunc International, Naperville, IL) slides. Cells were allowed to adhere for 24 h and pulsed with 10-5 M BrdUrd (Sigma) for 16 h. Cells were rinsed once with PBS, fixed for 15 min at 25°C with 3.7% paraformaldehyde (Sigma), permeabilized with 0.3% Triton X-100 in PBS for 15 min at 25°C, and incubated with anti-BrdUrd monoclonal antibody (Accurate Scientific, San Diego, CA) at a dilution of 1:500 for 1 h at 37°C in a solution of 5 mg/ml BSA, 0.5% NP40, 20 mM MgCl2, 0.02 unit/µl DNase I (Roche) in PBS. Cells were washed with PBS and incubated with 1:200 dilution of rhodamine-labeled donkey antirat antibody (Jackson Immunoresearch, West Grove, PA) for 1 h at 37°C. Cells were washed with PBS, mounted with Fluoromount-G (Southern Biotechnology Associates, Birmingham, AL), visualized with a Nikon Optiphot microscope, and photographed using a DC120 digital camera (Eastman Kodak, Rochester, NY). Photos were imported into Photoshop (Adobe) and processed for publication.

To determine the degree of disruption of nuclear targeting, 100 EGFP-positive cells were counted and visually scored for nuclear-only localization of the transfected protein. The individual performing the scoring was blinded as to the constructs being scored. The transfections were repeated three times, and the average percentage of EGFP-positive cells with nuclear-only localization was compared. Significant differences between the means were determined using Student’s t test in Microsoft Excel.

Western blotting of PASG-EGFP products was accomplished as follows. Cells were washed twice with PBS, exposed to RIPA2 buffer [20 mM Tris (pH 7.4), 10% glycerol, 137 mM NaCl, 0.1% SDS, 1% Triton X-100, 2 mM EDTA, 0.5% sodium deoxycholate with 0.6 mM phenylmethylsulfonyl fluoride, 4.5 µg/ml aprotinin, and 1 µg/ml pepstatin], and collected with a rubber policeman. The cell lysate was shaken vigorously for 20 min at 4°C and microfuged at high speed for 10 min at 4°C. Aliquots of the supernatant were snap-frozen in liquid nitrogen and stored at -80°C. Protein concentrations were determined using Protein Assay (Bio-Rad, Hercules, CA) according to the manufacturer’s instructions. Approximately 50 µg of total cell lysate were denatured in 6x SDS/2-mercaptoethanol loading buffer (37) at 100°C for 10 min, electrophoresed on a 10% polyacrylamide gel, and transferred to nylon membranes (Amersham). These membranes were reversibly stained with Ponceau S to determine the evenness of transfer and loading (38) . Membranes were blocked with 10% nonfat dry milk in TBST for 1 h at 37°C and exposed to anti-GFP (Clontech) mouse monoclonal antibody at a dilution of 1:1000 in 10% milk/TBST for 1 h at 25°C. Membranes were washed in TBST and incubated for 1 h at 25°C in alkaline phosphatase-conjugated goat antimouse secondary antibody (Promega) at a 1:5000 dilution in 10% milk/TBST. After washing in TBST and TBS, blots were developed with nitroblue tetrazolium/5-bromo-4-chloro-3-indoyl phosphate (Sigma) according to the manufacturer’s instructions. Blots were scanned and processed for publication using Adobe Photoshop.

Deletion Analysis.
Total RNA was extracted from bone marrow, peripheral blood mononuclear cells, fresh or frozen tissue, and cultured cells using Trizol reagent. Full-length cDNA was synthesized using Superscript RNase H-Reverse Transcriptase (Life Technologies, Inc.). To detect a 75-bp deletion (from nucleotides 2014–2088) first identified in the MO7e cDNA library, primers were designed that would amplify either a 255-bp wild-type or a 180-bp deleted region: (a) 5' primer, 5'-CAGAGATTTCAACTTCAGCAG-3'; and (b) 3' primer, 5'-AGGCGATAAACAACAACTGG-3'. Reverse-transcribed templates were amplified for 30 cycles (95°C for 30 s, 60°C for 45 s, and 72°C for 30 s) using a Gene Amp PCR system 9700 (Perkin-Elmer/Applied Biosystems, Foster City, CA). The amplified products were analyzed by agarose gel electrophoresis. Samples containing a shorter product on the agarose gel were cloned into pGEM-T-easy TA cloning vector (Promega). Cloned inserts were sequenced to confirm the presence of the transcript with the 75-bp deletion. Negative controls for deletion analysis included standard water controls and patient total RNA samples that had not been subjected to reverse transcription.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning Human PASG (SMARCA6) cDNA.
To analyze the gene products associated with growth and apoptosis in cytokine-dependent leukemia, a differential display screen was used to identify mRNAs whose expression was altered after cytokine withdrawal (SCF) from the human megakaryoblastic leukemia cell line MO7e. The percentage and timing of apoptosis after SCF withdrawal are shown in Fig. 1ACitation . One of the cDNAs identified from this screen had significant homology to a conserved domain shared by a variety of DNA and RNA helicases (data not shown). Northern blot analysis demonstrated that this cDNA recognized an approximately 3.5-kb mRNA and confirmed the decrease in expression after cytokine withdrawal (Fig. 1B)Citation . A higher molecular weight species of approximately 7.5 kb (data not shown) is hypothesized to represent a precursor of the 3.5-kb mRNA, but this has not been formally proven. To determine whether the decrease in PASG expression was related to the induction of apoptosis or growth arrest, MO7e cells were cultured in the absence of FBS in the presence of 20 ng/ml SCF (Fig. 1C)Citation . Cells cultured under these conditions undergo growth arrest but show minimal apoptosis (Fig. 1D)Citation . Northern blot analysis demonstrates that under such conditions of growth arrest without the induction of apoptosis, the level of PASG mRNA declines dramatically (Fig. 1C)Citation . However, 24 h after returning cells to FBS, the level of PASG mRNA again increases, demonstrating that the cells were still viable and that the induction of proliferation by the addition of FBS results in an increase of PASG mRNA (Fig. 1C)Citation . At approximately 8–12 h after the addition of FBS, a rise in [3H]thymidine incorporation is detectable, which continues to increase along with cell numbers over 24 h (data not shown). These results link PASG transcript expression more closely with proliferation than with the inhibition of apoptosis.



View larger version (33K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. The withdrawal of SCF from MO7e leukemic cells causes a progressive decrease in PASG mRNA levels with increasing apoptosis. A, the percentage of apoptotic MO7e cells after SCF withdrawal. B, Northern blot analysis demonstrating a decrease in PASG mRNA expression (top) relative to rRNA (bottom) after SCF withdrawal. C, Northern blot analysis of PASG mRNA expression (top) when MO7e cells are cultured in the presence of serum and SCF or in the absence of serum but in the presence of SCF for various periods of time (8, 12, 24, and 36 h). RF refers to "refeeding" with serum after 36 h of growth arrest induced by serum removal. The bottom panel shows the same blot after stripping and rehybridization with a probe to 18S rRNA. D, this table shows cell number, [3H]thymidine incorporation, and percentage of apoptosis at time 0 and 36 h after serum removal from MO7e cells.

 
A cDNA including a putative complete open reading frame was constructed using overlapping cDNA clones obtained from a MO7e cDNA library and 5' RACE (Fig. 2)Citation . This open reading frame sequence was confirmed by sequencing cDNAs from normal human thymus. The position of two in-frame stop codons in the extreme 5' region followed by a Kozak consensus ATG start site (39 , 40) as well as the presence of a 3' TAA termination codon suggests that the 2514-nucleotide sequence (838 amino acids) is the full-length open reading frame (Fig. 2)Citation . The cDNA sequence includes a 105-nucleotide 5' UTR and a 477-nucleotide 3' UTR containing a cognate polyadenylation sequence (Fig. 2)Citation . We believe that the 5' UTR should be approximately 500 bp long to account for the 3.5-kb transcript size estimated from Northern blotting, but reverse transcription through a highly GC-rich area in the 5' region upstream from the start site was unsuccessful. This human sequence includes an open reading frame that is 230 amino acids longer at the NH2 terminus than the previously identified murine cDNA and adds the 5' and 3' UTRs to the previously published sequence (29 , 30) . These sequences have also been confirmed by sequencing genomic BAC clones. Domains originally shown to be characteristic of other DNA and RNA helicases are shown in Fig. 2Citation , as highlighted in black (I, Ia, II, III, IV, V and VI), whereas those domains more recently shown to also share significant homology among the SNF2 subfamily are depicted by gray highlighting (domains IVa and IVb; Refs. 26, 27, 28 ).



View larger version (69K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Complete cDNA nucleotide and amino acid sequence of human PASG. Consensus helicase domains are indicated by {blacksquare} according to Gorbalenya et al. (54) . Other regions of homology shared within the SNF2 family are boxed in gray (28) . Asterisks indicate the location of in-frame stop codons in the 5' and 3' regions. A consensus polyadenylation sequence (AAUAAA) is noted in bold.

 
Based on protein sequence alignments, this cDNA is most homologous to DDM1 and SNF2L (the human homologue of Drosophila ISWI) while sharing various degrees of homology to the rest of the SNF2 family (Fig. 3, A and B)Citation (27 , 28) . Significant homology with DDM1 and SNF2L also exists outside of the classical helicase domains, suggesting a relatively recent evolutionary divergence (Fig. 3, A and BCitation ; Refs. 27 and 28 ). This cDNA is one of the smallest known members of the SNF2 gene family identified thus far, being approximately the same size as RAD54 (Fig. 3B)Citation . However, PASG is significantly more homologous to SNF2L than to human RAD54, suggesting a shared function with SNF2L (Fig. 3ACitation ; Refs. 27 and 28 ). Of interest is that the spacing of conserved motifs in PASG differs from other known members of the SNF2 family in that PASG has additional amino acids inserted between domains IV and V (Figs. 2Citation 3)Citation . The functional significance of these additional amino acids is unclear at this time.



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. A, schematic representation of homology between PASG and other members of the SNF2 family. PASG is most homologous to human SNF2L, Drosophila ISWI, and the flowering plant DDM1 gene based on homology both within and outside the helicase domains. B, size comparison of PASG and other members of the SNF2 family. Boxes represent the location of the conserved helicase domains. The line extending from 0 to 2500 represents amino acids. Note the difference in spacing between domains IV and V of PASG and other members of the family.

 
Chromosomal Localization, Genomic Structure, and NH2 Terminus Splicing Variants.
Initial chromosomal assignment of the PASG gene was accomplished by using a human/rodent somatic cell library and performing genomic PCR for regions in the 5' and 3' regions of the cDNA. These experiments demonstrated that the PASG gene was located on human chromosome 10 (data not shown). A radiation hybrid human genomic panel was then used to further map the PASG gene to chromosomal 10q23–24 (data not shown). This chromosomal assignment was confirmed using in situ hybridization with a BAC clone containing the PASG gene (Fig. 4)Citation .



View larger version (68K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Chromosomal mapping of PASG. A, chromosome identification and position were determined by Giemsa/trypsin banding. Arrows indicate hybridization to chromosome 10q23. B, FISH with a BAC clone labeled with fluorescein to metaphase human chromosomes counterstained with propidium iodide.

 
Two separate BAC clones containing overlapping regions of the PASG gene were used to determine the intron/exon boundaries (Table 1)Citation . The human PASG gene has 22 exons that encode the open reading frame (Table 1Citation ; Fig. 5Citation ). The location of conserved helicase domains is also noted. The definition of conserved helicase domains is based on the analyses by Gorbalenya et al. (26) as well as Richmond and Peterson (9) . Using these criteria, the following observations can be made for PASG genomic organization: most of the conserved helicase domains lie within a single exon (Fig. 4Citation ; Table 1Citation ); however, domain II, which contains the DEGH motif, could be considered to be split between exons 10 and 11. Whereas the DEGH and immediately surrounding sequences are contained within exon 11, there is an intron situated between the glutamine (Q) and histidine (H) located 10 and 9 amino acids 5' to the DEGH motif, respectively. Thus, two amino acids (L and Q) are contained within exon 10, whereas the remainder of domain II lies within exon 11. Domain IVb is also split between exons 16 and 17. Domain IV lies completely within exon 13, based on the schema described previously (Fig. 5Citation ; Table 1Citation ; Ref. 9 ). Intron size was determined by direct sequencing or estimated by the size of PCR products spanning two consecutive exons.


View this table:
[in this window]
[in a new window]

 
Table 1 Exon/intron organization of PASG

 


View larger version (7K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Schematic of intron/exon boundaries of the human PASG gene. There are 22 exons encoding the longest open reading frame as well as the 5' and 3' UTRs. The 5' and 3' UTRs are likely to be about the same size, although the length of the 5' UTR is listed as approximate based on the position of the most likely transcriptional start site (TATA box) location (data not shown) and the size of the mRNA (see "Results").

 
The first in-frame ATG that follows two stop codons has a surrounding sequence consistent with a Kozak consensus motif translational start site (GGC-ATG-CCA; Fig. 2Citation ; Ref. 39 ). In addition, this first ATG appears to be represented in the dominant RNA transcript as assessed by RT-PCR (Fig. 6A)Citation . Of interest, however, is the presence of an alternative splicing variant that results in the deletion of the first ATG (Fig. 6B)Citation . The donor and acceptor sites that form the sequence basis for the alternative splicing are shown in Table 2Citation . This second ATG (at position +49) also contains surrounding nucleotides for an acceptable Kozak box (GCA-ATG-GTT). The alternative splicing variant results in a predicted protein that is 16 amino acids shorter at the NH2 terminus than that encoded by the dominant transcript. This shorter transcript has been observed in all tissues and cell lines sampled thus far as a minor mRNA species (data not shown). These data demonstrate that the size of the human PASG product is encoded by a locus of approximately 40,000 nucleotides situated at chromosomal 10q23-q24; the gene locus contains 22 exons contributing to the open reading frame. In addition, there is evidence for alternative splicing at the 5' end of the gene that results in a protein with a predicted alternative NH2 terminus.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Alternative splicing at the 5' end results in two isoforms of PASG mRNA, predicting the generation of distinct proteins. Top, genomic DNA, indicating nucleotide 1 of the first ATG after two in-frame stop sites as well as the position and length of intron 1. A and B depict the splicing event leading to the dominant and minor mRNA transcripts, respectively, which are found in all tissues and cell lines examined thus far. The rectangles with diagonal lines represent exons coding for protein, whereas the rectangles without diagonal lines represent untranslated sequence. The solid arrows above and below the rectangles represent the positions of oligonucleotide primers used for RT-PCR amplification of cDNA. The electrophoretically separated products of PCR amplification from cDNA and the PASG genomic clone are shown on the ethidium bromide-stained agarose gel. Cloning and sequencing confirmed the identity of the amplified bands as PASG. Lane 1, RT-PCR product from MO7e cDNA; Lane 2, PCR product from BAC genomic clone containing PASG; Lane 3, RT-PCR products from normal thymus cDNA.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Alternative splicing results in major and minor transcripts of PASG

 
PASG Requires a NLS for Appropriate Subcellular Addressing.
Sequence analysis identified a putative NLS in the NH2 terminus of the protein and is indicated by the underlined residues in Fig. 7ACitation . To investigate the role of this putative NLS, we used PCR-mediated site-directed mutagenesis (Fig. 7A)Citation . The mutation was cloned into a full-length PASG construct that was fused to the EGFP, and the construct was transfected into COS-7 cells followed by fluorescence microscopy. Mutation of the residue significantly (P < 0.001) decreases the nuclear localization of PASG when compared with EGFP-PASG. (Fig. 7C)Citation . Fig. 7BCitation shows the dramatic degree of disruption of PASG addressing observed when the NLS signal is mutated. Whereas the vast majority of cells transfected with the EGFP-PASG{Delta}NLS show disrupted subcellular localization, a small percentage of cells maintain proper nuclear location, suggesting that PASG may contain an additional NLS motif. A comparable degree of disruption is seen when constructs are transfected into NIH 3T3 or COS-7 cells, demonstrating that this effect is not cell-type specific.

To ensure that the constructs produced full-length protein products, Western blotting of PASG-GFP products was performed. At 48 h after transfection, whole cell lysates were harvested. Anti-GFP Western blotting shows that GFP-reactive bands of the appropriate size are present in cells transfected with EGFP-PASG and EGFP-PASG{Delta}NLS. Based on the sequence data presented here, PASG is predicted to have a molecular weight of approximately 97,000. The EGFP portion of the fusion protein is predicted to add approximately Mr 27,000 in size, suggesting that a full-length EGFP-PASG protein should have a molecular weight of approximately 124,000. As observed in Fig. 7DCitation , one of the two GFP-positive bands migrates at approximately Mr 124,000. A band appearing to run Mr 10,000 less could be explained by an alternative translational start at a downstream methionine (M86), which is also surrounded by a conserved Kozak translational start sequence. A PASG polypeptide beginning at M86 would have a predicted molecular weight of 9,400 less than that of full-length PASG.

Expression of PASG Transcripts in Normal and Neoplastic Tissues and Cell Lines.
The expression pattern of PASG mRNA in normal adult tissues was determined using Northern blot hybridization. The highest levels of expression of PASG mRNA are observed in the adult thymus and testis (Fig. 8A)Citation . However, expression is also observed at dramatically lower levels in other tissues, such as the uterus, small intestines, colon, and peripheral blood mononuclear cells (Fig. 8, A and B)Citation . PASG mRNA is also present at relatively high levels in mononuclear cells isolated from normal bone marrow (Fig. 8BCitation , Lanes 2–5). Peripheral blood mononuclear cells, representing mostly PBLs freshly isolated from normal individuals, demonstrate detectable levels of PASG mRNA, although significantly less than that observed in the thymus or bone marrow [Fig. 8BCitation , compare Lanes 2–5 (bone marrow) with Lanes 10–11 (thymus) and Lanes 6–8 (PBLs)]. However, activation of PBLs by a 3-day exposure to ConA results in a profound increase in the level of PASG mRNA to the level of that seen in thymus (Fig. 8Citation B, Lane 9).



View larger version (71K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 8. Northern blot hybridization analysis demonstrates that PASG mRNA expression is tissue specific and physiologically regulated. A: Lane 1, heart; Lane 2, brain; Lane 3, placenta; Lane 4, lung; Lane 5, liver; Lane 6, skeletal muscle; Lane 7, kidney; Lane 8, spleen; Lane 9, thymus; Lane 10, prostate; Lane 11, testis; Lane 12, uterus; Lane 13, small intestine; Lane 14, colon; Lane 15, peripheral blood leukocytes. B: Lane 1, MO7e; Lanes 2–5, bone marrow mononuclear cells; Lanes 6–8, three different normal individuals’ peripheral blood mononuclear cells; Lane 9, ConA-stimulated peripheral blood mononuclear cells; Lane 10, 1-week-old thymus; Lane 11, 3-month-old thymus. C: Lane 1, MO7e; Lane 2, HL60 (myeloid leukemia); Lane 3, Spurlock (myeloid leukemia); Lane 4, K562 (myeloid leukemia); Lane 5, Molt4 (T-cell leukemia); Lane 6, CEM (T-cell lymphoma); Lane 7, Raji (B-cell lymphoma); Lane 8, 8226 (myeloma); Lane 9, Lan2 (prostate cancer); Lane 10, Lan5 (prostate cancer); Lane 11, Lan6 (prostate cancer); Lane 12, PC-3 (prostate cancer); Lane 13, DU145 (prostate cancer); Lane 14, LNCAP (prostate cancer). D: Lane 1, MO7e; Lane 2, normal bone marrow; Lanes 3–6, acute myeloid leukemia samples; Lanes 7–11, ALL. The bottom panels show ethidium bromide-stained blots after transfer (B-D) or phosphorimager.

 
In light of the expression pattern of PASG mRNA in normal tissues, we examined a variety of malignant cell lines, including those derived from myeloid and lymphoid leukemias (Fig. 8C)Citation . Whereas the level of PASG mRNA varied considerably among the different cell lines, some expression was detectable in all cell lines tested by Northern blot hybridization. To examine the expression of PASG mRNA in hematopoietic malignancies, samples of AML and ALL were analyzed. The results showed that all samples of AML expressed relatively high levels of PASG mRNA, regardless of whether they were obtained at diagnosis or relapse (Fig. 8DCitation , Lanes 3–6). Whereas an extensive analysis of all FAB subtypes of AML has not been performed, samples from all FAB subtypes (M6 subtype not tested) have shown PASG mRNA expression (Fig. 8Citation ; data not shown). In addition, samples of both T-cell and pre-B-cell ALL also showed expression of PASG mRNA, although there was more variability, with some samples having relatively low levels compared with that observed in AML samples [Fig. 8DCitation , compare Lanes 3–6 (AML) with Lanes 7–11 (ALL)].

These results show that PASG mRNA is differentially expressed in normal and neoplastic human tissue and that it does not appear to be restricted to lymphocytes. In addition, the level of human PASG mRNA shows a significant increase when PBLs are activated and stimulated to proliferate after exposure to ConA, similar to that observed for the mouse homologue (29) .

Detection of a 75-nucleotide Deletion in PASG mRNA in both AML and ALL.
During the screening and sequencing of cDNAs from the original cDNA library derived from the myeloid leukemia cell line MO7e, a cDNA clone was identified that had an in-frame 75-bp deletion in the COOH-terminal half of the molecule. To determine whether this deletion was unique to MO7e or might be present in leukemic blasts from patients, we screened both AML and ALL samples by RT-PCR as described in "Materials and Methods." The RT-PCR product for wild-type mRNA produces a 255-bp amplicon, whereas the mRNA with the deletion gives a 180-bp fragment.

Fig. 9ACitation shows the presence of both transcripts in approximately equal amounts obtained from leukemic blasts from a patient with AML (Lane 1) and one from a patient with ALL (Lane 2). Samples, which show only the 255-bp wild-type product, are included from a myeloid leukemia cell line, Spurlock (Lane 3), an ovarian cancer (Lane 4), and an EBV-transformed lymphoblastoid cell line (Lane 5). Sequence analysis shows that the longer amplicon represents the wild-type PASG mRNA, whereas the shorter amplicon contains the in-frame 75-bp deletion (Fig. 9B)Citation . The analysis of additional samples of AML and ALL demonstrates that the presence of the PASG mRNA with the 75-bp deletion (PASG-75bp) occurs in approximately 57% of AML samples and 37% of ALL samples (Table 3)Citation . The expression of the PASG-75bp mRNA was observed in all AML FAB subtypes, except the M6 subtype, which was not tested, as well as in both T-cell and pre-B-cell ALL (Table 3Citation ; data not shown). Interestingly, none of 20 samples of ovarian cancer or a variety of transformed cell lines showed this deletion (Table 3)Citation . In addition, the PASG-75bp mRNA form was not observed in normal tissues, including bone marrow, thymus, and quiescent or activated lymphocytes (Table 3)Citation . However, these data cannot completely rule out the possibility that some normal tissues could express this alternative mRNA in a small subset of cells or at a very low level.



View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 9. Both AML and ALL samples demonstrate a 75-bp deletion of PASG mRNA. A, RT-PCR shows the presence of two amplicons representing the wild-type (255 bp) and 75-bp deletion (180 bp) from exon 18. Lane M, DNA molecular weight markers; Lane 1, AML; Lane 2, ALL; Lane 3, Spurlock (AML cell line); Lane 4, normal ovary; Lane 5, EBV-transformed cell line. B, nucleotide sequence of mutant and wild-type forms of PASG mRNA showing the 75-nucleotide deletion.

 

View this table:
[in this window]
[in a new window]

 
Table 3 Presence of 75-bp deletion in neoplastic and normal tissues

 
This 75-nucleotide deletion causes the loss of 25 amino acids from the 3' half of exon 18 (Figs. 9Citation 10)Citation . However, because the deletion results in an in-frame loss of nucleotides, a complete mRNA is formed with the exception of the deleted sequence. When DNA from several samples of leukemia or MO7e was analyzed for genomic mutations at the donor/acceptor sites for intron/exon boundaries in this region or in the downstream intron, no mutations or abnormal sequences were found (data not shown). However, there is a satisfactory donor splice sequence found within exon 18 that serves as a donor site for the generation of the PASG-75bp mRNA found in AML and ALL (Fig. 10)Citation . It is unclear at this time why this site is used in addition to the normal donor splice site in these acute leukemias. Of further interest is that the region that is deleted contains an amino acid motif (STRAGGLG) known to be critical for transcriptional activation by the yeast SWI2/SNF2 polypeptide (9) . The PASG-75bp mutant mRNA in human leukemia thus appears to arise as an abnormal, alternative RNA processing event. These results suggest that the mutant PASG-75bp mRNA may contribute to the altered physiology of leukemic blasts from AML and ALL.



View larger version (19K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 10. Schematic of the alternative splicing events leading to PASG mRNA with a 75-bp deletion. A shows the amino acid sequence of PASG involved in this deletion with conserved helicase domain in bold. B demonstrates the nucleotide locations for exons 18 and 19 along with the approximately 1100-nucleotide intron. The arrows above the line show the normal splicing event leading to a wild-type PASG mRNA, whereas the arrows below the line demonstrate the alternative splicing that leads to a 75-bp deletion. C shows the amino acid sequence resulting from the 75-bp deletion including the conserved STRAGGLG motif shown in bold.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The initial strategy that we used to identify gene products regulated by cytokines in factor-dependent hematopoietic malignancies led to the isolation of a gene encoding a protein belonging to a heterogeneous family of helicases and chromatin remodeling molecules. The analysis of the cDNA reveals that this putative helicase is most closely related to the SNF2L family of genes, with the highest sequence and structural homology to the DDM1 and SNF2L genes. The genetic locus has been designated SMARCA6. The mRNA level encoding this protein is down-regulated in response to cytokine withdrawal followed by growth arrest and apoptosis, down-regulated after growth arrest without the induction of significantly increased apoptosis when cells are cultured without serum but with cytokine (SCF), up-regulated in lymphocytes stimulated to proliferate by exposure to ConA, and expressed in a variety of tissues and cell types. The sequence homology, expression pattern, and association with proliferation have led us to refer to the gene product as PASG (31) .

Different families of helicases play important roles in normal growth and development as well as in malignant cell transformation and cancer cell physiology (21 , 22 , 41 , 42) . The demonstration that the PASG gene is located on chromosome 10q23-q24 raises the possibility that it may also contribute to the development or physiology of several types of malignancies. This region of chromosome 10 has been associated with loss of heterozygosity in a variety of malignancies including prostate and ovarian cancer, glioblastoma, and high-grade astrocytomas as well as in subtypes of leukemia and lymphoma (43, 44, 45, 46, 47, 48, 49, 50, 51) . Our laboratory is currently screening such malignancies by single-strand conformational polymorphism analysis to determine whether and to what extent PASG might be altered.

In our initial assessment of PASG expression in leukemia, we observed the presence of a highly expressed transcript containing a 75-nucleotide deletion (PASG-75bp). This alternatively processed PASG transcript was observed in approximately 35% and 60% of ALL and AML samples, respectively. The predicted protein resulting from this in-frame deletion lacks 25 amino acids from exon 18 in the COOH-terminal half of the PASG protein. The 25-amino acid region contains the fourth conserved helicase motif including the sequence STRAGGLG. This conserved sequence has been shown by mutational analysis of the yeast SWI2/SNF2 polypeptide to be critical for the transactivation of genes involved in sucrose fermentation (9) . Specifically, the expression of SWI2/SNF2 mRNA containing the deletion of the sequence STRAGGLG results in a dominant negative phenotype and the inability of yeast to transactivate specific enzymatic pathways involved in sugar metabolism (9) . By analogy, the expression of PASG mRNA with a deletion involving this conserved sequence could also function in a dominant negative fashion in human leukemia. This might in turn lead to altered regional specific chromatin remodeling, resulting in altered gene expression (24) . The high homology of PASG to the DDM1 helicase also raises the possibility that PASG could be involved in chromatin remodeling essential for accessibility of DNA methylation enzymatic machinery (17 , 52) . The effect of a dominant negative form of PASG would then potentially result in the loss of gene specific methylation after DNA replication. A consequence of hypomethylation may be inappropriate expression of genes that play roles in altering cell proliferation and possibly drug resistance (52) . We are currently extending our analysis of PASG in leukemia as well as exploring the functional consequences of the 75-bp deletion.

Mutations and translocations involving histone acetylases and associated proteins are involved in the development of both myeloid and lymphoid leukemias (24) . For example, the MLL gene may contribute to altered chromatin remodeling and transcription by recruiting histone acetylases and/or SWI/SNF-like helicases (24) . If there is abnormal expression and/or localization of MLL secondary to a translocation event, the abnormal derepression of genes regulated by MLL might also occur due to aberrant recruitment and function of chromatin remodeling proteins (53) . Whether PASG is a component of such chromatin remodeling complexes remains to be established.

We have described several alternative forms of a SNF2-like helicase, PASG, which could potentially alter its function. The alternatively processed transcript, which results in the deletion of the first ATG, would produce a predicted protein that has lost 16 amino acids from the NH2 terminus. It will be of interest to know whether this NH2 terminus truncation affects PASG function. In addition, the critical role of a NLS in transporting PASG to the nucleus predicts the possibility that mutations changing or deleting this sequence would result in a PASG protein incapable of performing its nuclear function(s). The observation that a subset of human acute leukemias expresses an altered PASG transcript with a 75-nucleotide (25-amino acid) deletion involving a conserved domain known to result in a dominant negative polypeptide of the yeast homologue SWI2/SNF2 suggests that this altered form of PASG may also disrupt normal hematopoietic cell functions. Whether and by what mechanism the altered form of PASG contributes to leukemogenesis will require further work linking structural changes to functional consequences.


    ACKNOWLEDGMENTS
 
We thank the staff of the Hematology/Oncology Division who helped with the collection of tissue samples and cell lines. We are grateful to the Children’s Cancer Group and the group’s leukemia cell banks for some of the samples used in these studies. Dr. Steven Cannistra (Beth Israel Hospital, Boston, MA) generously supplied us with samples of ovarian cancer. We thank Dr. Jin Li for performing sequence analysis of the PASG genomic clones.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by the Ohio Cancer Research Associates and the Children’s Hospital Research Foundation. Back

2 To whom requests for reprints should be addressed, at Divisions of Hematology/Oncology and Genetics, Children’s Hospital Medical Center, 3333 Burnet Avenue, Cincinnati, OH 45229. E-mail: Robert.Arceci{at}chmcc.org Back

3 The abbreviations used are: SCF, stem cell factor; FBS, fetal bovine serum; NLS, nuclear localization sequence; AML, acute myelogenous leukemia; ALL, acute lymphoblastic leukemia; RACE, rapid amplification of cDNA ends; BAC, bacterial artificial chromosome; FISH, fluorescence in situ hybridization; BrdUrd, bromodeoxyuridine; TBST, Tris-buffered saline/Tween 20; GFP, green fluorescent protein; EGFP, enhanced GFP; UTR, untranslated region; RT-PCR, reverse transcription-PCR; PBL, peripheral blood lymphocyte; ConA, concanavalin A; FAB, French-American-British. Back

4 The GenBank accession number for human PASG cDNA is AF155827, and the Human Gene Nomenclature Committee designation for this locus is SMARCA6. Back

Received 10/13/99. Accepted 4/28/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Broudy V. Stem cell factor and hematopoiesis. Blood, 90: 1345-1364, 1997.[Free Full Text]
  2. Corey S. J., Anderson S. M. Src-related protein tyrosine kinases in hematopoiesis. Blood, 93: 1-14, 1999.[Free Full Text]
  3. Wickremasinghe R. G., Hoffbrand A. V. Biochemical and genetic control of apoptosis. Relevance to normal hematopoiesis and hematological malignancies. Blood, 93: 3587-3600, 1999.[Free Full Text]
  4. Eisen A., Lucchesi J. C. Unraveling the role of helicases in transcription. Bioessays, 20: 634-641, 1998.[Medline]
  5. Kadonaga J. T. Eukaryotic transcription: an interlaced network of transcription factors and chromatin-modifying machines. Cell, 92: 307-313, 1998.[Medline]
  6. Travers A. An engine for nucleosome remodeling. Cell, 96: 311-314, 1999.[Medline]
  7. Armstrong J. A., Emerson B. M. Transcription of chromatin: these are complex times. Curr. Opin. Genet. Dev., 8: 165-172, 1998.[Medline]
  8. West S. C. DNA helicases: new breeds of translocating motors and molecular pumps. Cell, 86: 177-180, 1996.[Medline]
  9. Richmond E., Peterson C. L. Functional analysis of the DNA-stimulated ATPase domain of yeast SWI2/SNF2. Nucleic Acids Res., 24: 3685-3692, 1996.[Abstract/Free Full Text]
  10. Laurent B. C., Treich I., Carlson M. The yeast SNF2/SWI2 protein has DNA-stimulated ATPase activity required for transcriptional activation. Genes Dev., 7: 583-591, 1993.[Abstract/Free Full Text]
  11. Auble D. T., Steggerda S. M. Testing for DNA tracking by MOT1, a SNF2/SWI2 protein family member. Mol. Cell. Biol., 19: 412-423, 1999.[Abstract/Free Full Text]
  12. Varga-Weisz P. D., Wilm M., Bonte E., Dumas K., Mann M., Becker P. B. Chromatin-remodelling factor CHRAC contains the ATPases ISWI and topoisomerase II. Nature (Lond.), 388: 598-602, 1997.[Medline]
  13. Du J., Nasir I., Benton B. K., Kladde M. P., Laurent B. C. Sth1p, a Saccharomyces cerevisiae Snf2p/Swi2p homolog, is an essential ATPase in RSC and differs from Snf/Swi in its interactions with histones and chromatin-associated proteins. Genetics, 150: 987-1005, 1998.[Abstract/Free Full Text]
  14. Fryer C. J., Archer T. K. Chromatin remodelling by the glucocorticoid receptor requires the BRG1 complex. Nature (Lond.), 393: 88-91, 1998.[Medline]
  15. Muchardt C., Yaniv M. A human homologue of Saccharomyces cerevisiae SNF2/SWI2 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO J., 12: 4279-4290, 1993.[Medline]
  16. Deuring R., Fanti L., Armstrong J. A., Sarte M., Papoulas O., Prestel M., Daubresse G., Verardo M., Moseley S. L., Berloco M., Tsukiyama T., Wu C., Pimpinelli S., Tamkun J. W. The ISWI chromatin-remodeling protein is required for gene expression and the maintenance of higher order chromatin structure in vivo. Mol. Cell, 5: 355-365, 2000.[Medline]
  17. Jeddeloh J. A., Stokes T. L., Richards E. J. Maintenance of genomic methylation requires a SWI2/SNF2-like protein. Nat. Genet., 22: 94-97, 1999.[Medline]
  18. Gibbons R. J., Picketts D. J., Villard L., Higgs D. R. Mutations in a putative global transcriptional regulator cause X-linked mental retardation with {alpha}-thalassemia (ATR-X syndrome). Cell, 80: 837-845, 1995.[Medline]
  19. Mendiola M., Bello M. J., Alonso J., Leone P. E., Vaquero J., Sarasa J. L., Kusak M. E., De Campos J. M., Pestana A., Rey J. A. Search for mutations of the hRAD54 gene in sporadic meningiomas with deletion at 1p32. Mol. Carcinog., 24: 300-304, 1999.[Medline]
  20. Rasio D., Murakumo Y., Robbins D., Roth T., Silver A., Negrini M., Schmidt C., Burczak J., Fishel R., Croce C. M. Characterization of the human homologue of RAD54: a gene located on chromosome 1p32 at a region of high loss of heterozygosity in breast tumors. Cancer Res., 57: 2378-2383, 1997.[Abstract/Free Full Text]
  21. Versteege I., Sevenet N., Lange J., Rousseau-Merck M. F., Ambros P., Handgretinger R., Aurias A., Delattre O. Truncating mutations of hSNF5/INI1 in aggressive paediatric cancer. Nature (Lond.), 394: 203-206, 1998.[Medline]
  22. Biegel J. A., Zhou J-Y., Rorke L. B., Stenstrom C., Wainwright L. M., Fogelgren B. Germ-line and acquired mutations of INI1 in atypical teratoid and rhabdoid tumors. Cancer Res., 59: 74-79, 1999.[Abstract/Free Full Text]
  23. Trouche D., Le Chalony C., Muchardt C., Yaniv M., Kouzarides T. RB and hbrm cooperate to repress the activation functions of E2F1. Proc. Natl. Acad. Sci. USA, 94: 11268-11273, 1997.[Abstract/Free Full Text]
  24. Redner R. L., Wang J., Liu J. M. Chromatin remodeling and leukemia: new therapeutic paradigms. Blood, 94: 417-428, 1999.[Free Full Text]
  25. Avanzi G. C., Lista P., Giovinazzo B., Miniero R., Saglio G., Benetton G., Coda R., Cattoretti G., Pegoraro L. Selective growth response to IL-3 of a human leukaemic cell line with megakaryoblastic features. Br. J. Haematol., 69: 359-366, 1988.[Medline]
  26. Gorbalenya A. E., Koonin E. V., Donchenko A. P., Blinov V. M. A novel superfamily of nucleoside triphosphate-binding motif containing proteins which are probably involved in duplex unwinding in DNA and RNA replication and recombination. FEBS Lett., 235: 16-24, 1988.[Medline]
  27. Gorbalenya A. E., Koonin E. V. Helicases: amino acid sequence comparisons and structure-function relationships. Curr. Opin. Struct. Biol., 3: 419-429, 1993.
  28. Eisen J. A., Sweder K. S., Hanawalt P. C. Evolution of the SNF2 family of proteins: subfamilies with distinct sequences and functions. Nucleic Acids Res., 14: 2715-2723, 1995.
  29. Jarvis C. D., Geiman T., Vila-Storm M. P., Osipovich O., Akella U., Candeias S., Nathan I., Durum S. K., Muegge K. A novel putative helicase produced in early murine lymphocytes. Gene (Amst.), 169: 203-207, 1996.[Medline]
  30. Geiman T. M., Durum S. K., Muegge K. Characterization of gene expression, genomic structure, and chromosomal localization of Hells (Lsh). Genomics, 54: 477-483, 1998.[Medline]
  31. Lee D. W., Zhang K., Ning Z-Q., Wilkins B. J., Wieland R., Kim J. M., Blough R. I., Raabe E. H., Arceci R. J. PASG: a SNF2-like chromatin remodeling helicase altered in leukemia and associated with proliferation. Blood, 94: 594a 1999.
  32. Ning Z. Q., Murphy J. J. Calcium ionophore-induced apoptosis of human B cells is preceded by the induced expression of early response genes. Eur. J. Immunol., 23: 3369-3372, 1993.[Medline]
  33. Liang P., Pardee A. B. Differential display. A general protocol. Mol. Biotechnol., 10: 261-267, 1998.[Medline]
  34. Bloom H., Beier H., Gross H. S. Improved silver staining of plant proteins. RNA and DNA in polyacrylamide gels. Electrophoresis, 8: 93-99, 1987.
  35. Smolarek T. A., Blough R. I., Roster R. S., Ulbright T. M., Palmer C. G., Heerema N. H. Identification of multiple chromosome 12 abnormalities in human testicular germ cell tumors by two-color fluorescence in situ hybridization (FISH). Genes Chromosomes Cancer, 14: 252-258, 1995.[Medline]
  36. Weiner M. P., Costa G. L. Rapid PCR site-directed mutagenesis Dieffenbach C. W. Dveksler G. S. eds. . PCR Primer, : 613-622, Cold Spring Harbor Laboratory Press Plainview, NY 1995.
  37. Gallagher, S., Winston, S. E., Fuller, S. A., and Hurrell, J. G. R. Electrophoresis and immunoblotting. In: J. S. Bonifacino, M. Dasso, J. B. Harford, J. Lippincott-Schwartz, and K. M. Yamada (eds.), Current Protocols in Cell Biology. New York: John Wiley and Sons, Inc., 1999.
  38. Scopes, R. K., and Smith, J. A. Analysis of Proteins. In: F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (eds.), Current Protocols in Molecular Biology. New York: John Wiley and Sons, Inc., 1999.
  39. Kozak M. Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs. Nucleic Acids Res., 12: 857-872, 1984.[Abstract/Free Full Text]
  40. Kozak M. At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol., 196: 947-950, 1987.[Medline]
  41. Miyagawa K. Genetic instability and cancer. Int. J. Hematol., 67: 3-14, 1998.[Medline]
  42. Chakraverty R. K., Hickson I. D. Defending genome integrity during DNA replication: a proposed role for RecQ family helicases. Bioessays, 21: 286-294, 1999.[Medline]
  43. Bergerheim U. S., Kunimi K., Collins V. P., Ekman P. Deletion mapping of chromosomes 8, 10, and 16 in human prostatic carcinoma. Genes Chromosomes Cancer, 3: 215-220, 1991.[Medline]
  44. Bigner S. H., Mark J., Burger P. C., Mahaley M. S., Jr., Bullard D. E., Muhlbaier L. H., Bigner D. D. Specific chromosomal abnormalities in malignant human gliomas. Cancer Res., 48: 405-411, 1988.[Abstract/Free Full Text]
  45. Cavenee W. K. Accumulation of genetic defects during astrocytoma progression. Cancer (Phila.), 70: 1788-1793, 1992.[Medline]
  46. Ittmann M. Allelic loss on chromosome 10 in prostate adenocarcinoma. Cancer Res., 56: 2143-2147, 1996.[Abstract/Free Full Text]
  47. Kagan J., Finger L. R., Letofsky J., Finan J., Nowell P. C., Croce C. M. Clustering of breakpoints on chromosome 10 in acute T-cell leukemias with the t(10;14) chromosome translocation. Proc. Natl. Acad. Sci. USA, 86: 4161-4165, 1989.[Abstract/Free Full Text]
  48. Leenstra S., Bijlsma E. K., Troost D., Oosting J., Westerveld A., Bosch D. A., Hulsebos T. J. Allele loss on chromosomes 10 and 17p and epidermal growth factor receptor gene amplification in human malignant astrocytoma related to prognosis. Br. J. Cancer, 70: 684-689, 1994.[Medline]
  49. Trybus T. M., Burgess A. C., Wojno K. J., Glover T. W., Macoska J. A. Distinct areas of allelic loss on chromosomal regions 10p and 10q in human prostate cancer. Cancer Res., 56: 2263-2267, 1996.[Abstract/Free Full Text]
  50. Abeliovich D., Yehuda O., Ben-Neriah S., Kapelushnik Y., Ben-Yehuda D. dup(10q) lacking {alpha}-satellite DNA in bone marrow cells of a patient with acute myeloid leukemia. Cancer Genet. Cytogenet., 89: 1-6, 1996.[Medline]
  51. Yang-Feng T. L., Landau N. R., Baltimore D., Francke U. The terminal deoxynucleotidyltransferase gene is located on human chromosome 10 (10q23-q24) and on mouse chromosome 19. Cytogenet. Cell Genet., 43: 121-126, 1986.[Medline]
  52. Singal R., Ginder G. D. DNA methylation. Blood, 93: 4059-4070, 1999.[Free Full Text]
  53. Rozenblatt-Rosen O., Rozovskaia T., Burakov D., Sedkov Y., Tillib S., Blechman J., Nakamura T., Croce C. M., Mazo A., Canaani E. The C-terminal SET domains of ALL-1 and trithorax interact with the INI1 and SNR1 proteins, components of the SWI/SNF complex. Proc. Natl. Acad. Sci. USA, 95: 4152-4157, 1998.[Abstract/Free Full Text]
  54. Gorbalenya A. E., Koonin E. V., Donchenko A. P., Blinov V. M. Two related superfamilies of putative helicases involved in replication, recombination, repair and expression of DNA and RNA genomes. Nucleic Acids Res., 17: 4713-4730, 1989.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Drug Metab. Dispos.Home page
M. J. Liguori, E. A.G. Blomme, and J. F. Waring
Trovafloxacin-Induced Gene Expression Changes in Liver-Derived in Vitro Systems: Comparison of Primary Human Hepatocytes to HepG2 Cells
Drug Metab. Dispos., February 1, 2008; 36(2): 223 - 233.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. A. Rauch, X. Zhong, X. Wu, M. Wang, K. H. Kernstine, Z. Wang, A. D. Riggs, and G. P. Pfeifer
High-resolution mapping of DNA hypermethylation and hypomethylation in lung cancer
PNAS, January 8, 2008; 105(1): 252 - 257.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. J. Gibbons
Histone modifying and chromatin remodelling enzymes in cancer and dysplastic syndromes
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R85 - R92.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. P. Venables
Aberrant and Alternative Splicing in Cancer
Cancer Res., November 1, 2004; 64(21): 7647 - 7654.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
D. Marinkovic, T. Marinkovic, E. Kokai, T. Barth, P. Moller, and T. Wirth
Identification of novel Myc target genes with a potential role in lymphomagenesis
Nucleic Acids Res., October 11, 2004; 32(18): 5368 - 5378.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
L.-Q. Sun, D. W. Lee, Q. Zhang, W. Xiao, E. H. Raabe, A. Meeker, D. Miao, D. L. Huso, and R. J. Arceci
Growth retardation and premature aging phenotypes in mice with disruption of the SNF2-like gene, PASG
Genes & Dev., May 1, 2004; 18(9): 1035 - 1046.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Q. Yan, E. Cho, S. Lockett, and K. Muegge
Association of Lsh, a Regulator of DNA Methylation, with Pericentromeric Heterochromatin Is Dependent on Intact Heterochromatin
Mol. Cell. Biol., December 1, 2003; 23(23): 8416 - 8428.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Fan, Q. Yan, J. Huang, S. Austin, E. Cho, D. Ferris, and K. Muegge
Lsh-deficient Murine Embryonal Fibroblasts Show Reduced Proliferation with Signs of Abnormal Mitosis
Cancer Res., August 1, 2003; 63(15): 4677 - 4683.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. J. Scanlan, S. Welt, C. M. Gordon, Y.-T. Chen, A. O. Gure, E. Stockert, A. A. Jungbluth, G. Ritter, D. Jager, E. Jager, et al.
Cancer-related Serological Recognition of Human Colon Cancer: Identification of Potential Diagnostic and Immunotherapeutic Targets
Cancer Res., July 15, 2002; 62(14): 4041 - 4047.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, D. W.
Right arrow Articles by Arceci, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, D. W.
Right arrow Articles by Arceci, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online