Cancer Research Cancer Epigenetics  Protein Translation and Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malgeri, U.
Right arrow Articles by Neri, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malgeri, U.
Right arrow Articles by Neri, A.
[Cancer Research 60, 4058-4061, August 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Detection of t(4;14)(p16.3;q32) Chromosomal Translocation in Multiple Myeloma by Reverse Transcription-Polymerase Chain Reaction Analysis of IGH-MMSET Fusion Transcripts1

Ursula Malgeri, Luca Baldini, Vittorio Perfetti, Sonia Fabris, Maurizio Colli Vignarelli, Gualtiero Colombo, Valentina Lotti, Silvana Compasso, Silvia Bogni, Luigia Lombardi, Anna Teresa Maiolo and Antonino Neri2

Hematology Service [U. M., L. B., S. F., V. L., S. C., S. B., L. L., A. T. M., A. N.] and 3rd Division of Internal Medicine [G. C.], Università degli Studi di Milano, Ospedale Maggiore IRCCS, 20122 Milan, and Department of Internal Medicine [V. P.] and Biotechnology Research Laboratories [M. C. V.], Policlinico San Matteo IRCCS, 27100 Pavia, Italy


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We and others have recently identified a novel recurring t(4;14)(p16.3;q32) translocation in multiple myeloma (MM) that leads to an apparent deregulation of the FGFR3 and WHSC1/MMSET genes. Because the presence of IGH-MMSET hybrid transcripts has been found in MM cell lines with t(4;14), they may represent a specific tumor-associated marker in MM. In this study, we developed a reverse transcription-PCR (RT-PCR) assay for detecting chimeric transcripts from all of the 4p16.3 breakpoints identified thus far, and we used it to investigate a representative panel of 53 MM patients and 16 patients with monoclonal gammopathy of uncertain significance; in addition, t(4;14) was investigated in all of the MM patients by means of two-color fluorescence in situ hybridization. IGH-MMSET transcripts were found in 11 of the 53 (20%) MM cases and 1 of 16 (6%) cases of monoclonal gammopathy of uncertain significance. There was complete concordance between the RT-PCR and fluorescence in situ hybridization analyses of the MM cases. The results of this study indicate that RT-PCR is a sensitive and reliable method of detecting t(4;14) and suggest that it may be useful for monitoring the disease in a significant proportion of patients.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
MM3 is a malignant proliferation of bone marrow plasma cells that is characterized by a wide spectrum of clinical entities. A number of recent advances in the molecular biology of MM have provided new insights into the pathogenesis of this still incurable disease (1) . Despite the apparently low incidence revealed by cytogenetic analyses, we and others have demonstrated that translocations involving the immunoglobulin loci, predominantly the heavy chain locus (IGH) at 14q32, are frequently associated with MM (2, 3, 4, 5) . Translocations to the IGH locus usually occur within the switch regions and involve a large number of chromosome loci, particularly 11q13, 4p16.3, 16q23, and 6p25, in which the cyclin D1, FGFR3 and MMSET, c-MAF, and MUM1/IRF4 putative target genes are located, respectively (5, 6, 7, 8, 9, 10, 11) .

The t(4;14)(p16.3;q32) chromosomal translocation has not been described previously in reports based on conventional cytogenetics, probably because of the involvement of the telomeric portions of chromosomes 4p16.3 and 14q32; however, we and others have identified this translocation in MM by cloning the "illegitimate" switch-rearranged IGH alleles suggestive of translocation events. Molecular analyses of the 4p16.3 breakpoints (4 , 7 , 9) have shown that they occur 50–100 kb centromeric to the fibroblast growth factor receptor 3 gene (FGFR3; Ref. 12 ) and within the 5' regions of a novel gene called WHSC1/MMSET (9 , 13) . The FGFR3 gene is a member of the tyrosine kinase receptor family (fibroblast growth factor receptors 1–4), whose ability to bind a large number of related mitogenic fibroblast growth factors leads to the activation of complex signaling pathways regulating cell proliferation, differentiation, and migration in many different tissues (14) . The gene is overexpressed in the translocated cases, and activating point mutations have been found in the deregulated FGFR3 genes of some MM cell lines (4 , 7 , 15) , suggesting that it may play a critical role in tumorigenesis. The WHSC1/MMSET gene, which has been proposed as a candidate for Wolf-Hirschhorn malformation syndrome (13) , contains several functional domains, is expressed in early development (particularly in rapidly growing tissues), and is thought to play a role in transcriptional regulation. It extends over about 120 kb on the genome, and its 5' untranslated region lies approximately 50 kb centromeric of FGFR3. The 4p16.3 breakpoints directly involve the WHSC1/MMSET gene because they occur within 5' introns or upstream of its coding sequence, probably in the transcription regulatory regions. Finally, the gene is expressed at relatively low levels in MM cell lines but is overexpressed in the majority of those carrying the translocation (9 , 13) . The t(4;14)(p16.3;q32) translocation may therefore lead to the deregulation of two different potential oncogenes in MM.

The detection of t(4;14) is difficult by means of conventional cytogenetics or Southern blotting because of the poor sensitivity of karyotype analyses and the relatively large dispersion of 4p16.3 breakpoints. We and others have recently developed a two-color FISH assay using IGH- and 4p16.3-specific probes, which has revealed this lesion in 12–17% of the studied MM cases (5 , 8) . Chesi et al. (9) have shown that the presence of t(4;14) in MM cell lines leads to the formation of IGH-MMSET hybrid transcripts, which may therefore represent a specific marker of the translocation. In this study, we developed a RT-PCR assay for the detection of IGH-MMSET transcripts, investigated their presence in total mRNAs from pathological samples of 53 MM patients and 16 patients with MGUS, and compared the results of the RT-PCR and two-color FISH analyses in MM patients. Our data indicate that RT-PCR is a sensitive and reliable method for the detection of the t(4;14) translocation in MM.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Patients.
The study involved 53 MM patients and 16 patients with MGUS whose diagnoses were made according to the criteria described by Durie and Salmon (16) . The bone marrow aspirate from each patient was examined by means of conventional light microscopy and immunophenotype analyses. Complete clinicopathological data were available for all of the patients and are summarized in Table 1Citation . The pathological samples from 35 MM patients (including three cases with plasma cell leukemia) were obtained at diagnosis; the samples from the remaining 18 MM patients were obtained during phases of disease relapse or progression. The Durie-Salmon clinical stage of all of the MM patients shown in Table 1Citation refers to that recorded at the time of diagnosis. The pathological samples from all of the MGUS patients were obtained at diagnosis.


View this table:
[in this window]
[in a new window]

 
Table 1 Clinicopathological characteristics of the patients included in the study

 
RNA Extraction and RT-PCR Analysis.
The mRNAs from KMS-11 (kindly provided by Dr. T. Otsuki, Okayama, Japan), OPM-2 and NCI-H929 cell lines (DSMZ, Braunschweig, Germany), and the bone marrow cell suspensions of the studied patients were extracted using the Trizol reagent (Life Technologies, Inc., Grand Island, NY). First-strand cDNA was synthesized as described previously (4) . The PCR amplifications were made by diluting 5 µl of first-strand cDNA from each case into a 25-µl PCR mixture containing specific primers (20 pmol), MgCl2 (1 mM), deoxynucleotide triphosphates (200 mM), and Taq DNA polymerase (0.5 unit; Roche Diagnostic, Milan, Italy). The approximate location of primers used in the study is indicated in Fig. 1BCitation , and their sequences (5' to 3') are as follows: (a) JH6, ACCACGGTCACCGTCTCCTCA (sense primer); (b) 1, AGCCCTTGTTAATGGACTTG (sense primer); (c) 2, CTTTGCAAGGCTCGCAGTGAC (sense primer); (d) ms4f, ATTCCAGCTCCGAAAGAGTC (sense primer); (e) ms6r, CCTCAATTTCCCTGAAATTGGTT (antisense primer); (f) ms5r, AAGAACTGTACGTGATACTG (antisense primer); and (g) ms4r, TAAGTTTGGTATAGCTGTGA (antisense primer). In the case of the reactions using the JH6-ms6r or 1-ms6r primers, 35 amplification cycles were performed at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min. For the nested-PCR, 1 µl of a first amplification reaction carried out with the 1-ms6r set of primers was used in 30 amplification cycles performed at 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s with the internal 2 and ms5r primers.



View larger version (51K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. RT-PCR assay for the detection of the IGH/MMSET hybrid transcripts associated with the t(4;14)(p16.3;q32) translocation in MM. A, schematic representation of the WHSC1/MMSET and FGFR3 loci on 4p16.3. The white and black boxes indicate untranslated and translated MMSET exons, and the arrows indicate the approximate location of 4p16.3 breakpoints in the MM cell lines and primary tumors characterized thus far (4 , 7 , 9) . B, schematic representation of the t(4;14) junction, der(4), showing the three different types of 4p16.3 breakpoints (see the text): the MMSET exons ({square}) and the IGH region (Iµ, {blacksquare}; JH, ) are indicated. The approximate locations of the primers used (see "Materials and Methods") are shown below the map. C, RT-PCR analysis of the IGH/MMSET hybrid transcripts in the KMS-11, NCI-H929, and OPM-2 cell lines using the 1 and ms6r (Lane 1) or JH6 and ms6r (Lane 2) primers; the length of the HaeIII-digested {phi}{chi} molecular markers is indicated in bp. D, schematic representation of the IGH/MMSET hybrid transcripts shown in C and their respective lengths in bp. E, nested PCR analysis. cDNA obtained from serial dilutions of the NCI-H929 cells and negative control KG1 cells was amplified with the 1 and ms6r primers (left). The nested PCR amplifications using the 2 and ms5r internal primers are shown on the right. The length of the amplified fragments (the one at the top contains the putative exon 4a; see the text) is indicated in bp.

 
DNA Sequencing.
The PCR-amplified DNA fragments were sequenced directly using the appropriate primers. The fragments were purified by means of agarose gel extraction and sequenced in both directions using the Big Dye Terminator Cycle Sequencing Kit in an ABI Prism 310 automated sequencer (Perkin-Elmer, Norwalk, CT).

FISH Analysis.
Detection of the t(4;14) translocation was performed by two-color FISH as recently described by Finelli et al. (8) .


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
RT-PCR Assay for the Detection of t(4;14)(p16.3;q32).
As reported previously (9) , the 4p16.3 breakpoints in t(4;14) occur telomeric to or within the 5' introns of the WHSC1/MMSET gene (see scheme in Fig. 1ACitation ). As a result, the der(4) chromosome leads to the formation of IGH-MMSET hybrid transcripts (Fig. 1BCitation ). The RT-PCR used to detect these transcripts in our series of patients was based on IGH and MMSET primers, some of which have been reported previously [see "Materials and Methods" and the scheme in Fig. 1BCitation (9) ]. The primers were tested on the MM-derived KMS-11, NCI-H929, and OPM-2 cell lines representative of the three 4p16.3 breakpoint patterns described thus far: (a) 5' to exon 3 (KMS-11); (b) within intron 3 (NCI-H929); or (c) within intron 4 (OPM-2) of the MMSET gene (see the scheme in Fig. 1BCitation ). For practical purposes, we called these breakpoints MB4-1, MB4-2, and MB4-3, respectively.

In an attempt to assess a RT-PCR capable of detecting all of the breakpoint types, we performed two separate PCRs on reverse-transcribed cDNAs from the three cell lines using the JH6-ms6r or 1-ms6r set of primers (Fig. 1BCitation ). IGH-MMSET fusion transcripts were detected with both sets of primers (Fig. 1CCitation and the scheme in Fig. 1DCitation ). A single amplified fragment of the expected size was detected in the OPM-2 cell line in each reaction, whereas two fragments were constantly found in the NCI-H929 cells (the lower and stronger fragment was of the expected size); this pattern was also detected using the ms5r but not the ms4r antisense primer (see the scheme in Fig. 1BCitation ; data not shown). In the KMS-11 cells, amplification with JH6-ms6r primers showed the presence of a fragment of the expected size plus a faint upper fragment that was still present when the ms5r but not the ms4r primer was used (data not shown). The fragments of the expected size were separated by agarose gel and analyzed by direct sequencing. The fainter upper fragments observed in NCI-H929 and KMS-11 were sequenced and found to contain an additional 104-nucleotide stretch between exon 4 and exon 5 (data not shown). A data bank search indicated that this 104-bp sequence is located 7654 nucleotides downstream of exon 4 of the MMSET gene [position 24666–24562 of the L190b4 cosmid clone described by Baxendale et al. (17) ]; this sequence is flanked by canonical acceptor and donor splice sites and may therefore represent a novel putative MMSET exon (which we called exon 4a). MMSET transcripts, including those containing the putative exon 4a, are constantly detected by RT-PCR in both normal and neoplastic leukocytes (data not shown); the analysis of the open reading frame containing exon 4a revealed that it leads to a putative MMSET truncated protein of 273 amino acids (data not shown).

Because t(4;14) represents a specific molecular marker suitable for the molecular monitoring of the minimal residual disease in MM, we tried to develop a more sensitive nested PCR assay by using the internal 2 and ms5r primers specific for the -MMSET transcript. KMS-11, NCI-H929, or OPM-2 cells were serially diluted with the KG1 cell line negative for the translocation; under our nested PCR conditions, we were able to detect the amplified fragment specific for each cell line in 1 positive cell in 1 x 105 negative cells (see Fig. 1ECitation ; data not shown).

RT-PCR Analysis in MM Patients.
RT-PCR analysis was performed in 53 patients using the JH6-ms6r (data not shown) or 1-ms6r (Fig. 2ACitation ) primers in separate reactions. Hybrids transcripts were found in 11 cases with both sets of primers . MB4-1, MB4-2, and MB4-3 breakpoints were found in six cases, three cases, and one case, respectively; in the remaining case (LB109 in Fig. 2ACitation ), two amplified fragments of similar intensity were detected, with the lower fragment having the size specific for the MB4-3 type. The amplified fragments were sequenced in all of the positive cases, confirming the type of breakpoint in the first 10 patients; in case LB109, the sequence of the lower fragment was specific for the MB4-3 type, whereas the sequence of the upper fragment contained the 104-nucleotide stretch from the putative exon 4a. The latter findings suggest that the breakpoint in this case is 5' to exon 4a, a hypothesis that is further supported by the absence of this fragment in the OPM-2 cell line, for which the breakpoint has been localized 886 bp downstream of exon 4a (2) .



View larger version (44K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. RT-PCR detection of the IGH/MMSET hybrid transcripts. A, analysis of MM patients; all of the positive cases are shown together with some representative negative cases. B, nested PCR analysis in representative MGUS patients; case 11 showed the presence of a MB4-2 breakpoint. Left, the length of the HaeIII-digested {phi}{chi} molecular markers is shown.

 
FISH Analysis in MM Patients.
FISH analysis was performed in all of the 53 MM patients as described previously (8) . Twenty-three of the cases included in this study have already been investigated by FISH in our laboratoty, and 4 cases were found to be positive (8) ; of the remaining 30 cases, we found 7 positive cases (data not shown). All of these 11 cases were positive for the presence of the IGH-MMSET hybrid transcripts, thus indicating that the specificity and sensitivity of the two approaches are comparable in MM.

RT-PCR Analysis in MGUS Patients.
The presence of the IGH-MMSET fusion transcripts was investigated in bone marrow samples taken from 16 MGUS patients. No hybrid transcripts were detected in first PCR with both the JH6-ms6r and 1-ms6r combinations of primers. Nested PCR analysis (Fig. 2BCitation ) revealed the presence of an amplified fragment (breakpoint MB4-2 type) in only one case [1 of 16 cases (7%)].

Correlation with Clinicopathological Features.
We did not find any significant correlations between the presence of t(4;14) and the clinicopathological characteristics of our MM patients. Of the 35 patients evaluated at diagnosis, 8 cases were positive for the translocation (3 of 18 patients with stage I disease, 3 of 14 patients with stage II/III disease, and 2 of 3 patients with plasma cell leukemia); of the 18 patients evaluated during disease relapse or progression, 3 were found to be positive for the translocation. No correlation was found with age, monoclonal component, sex, or lactate dehydrogenase levels (<=460 or >460 units/liter) and ß2-microglobulin (<=2.6 or >2.6 mg/ml). The MGUS patient positive for the translocation is still in this clinical phase after 60 months of follow-up.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The t(4;14)(p16.3;q32) translocation is a recurrent lesion in MM that leads to the apparent deregulation of the FGFR3 and WHSC1/MMSET genes, which are closely associated on 4p16.3 (4 , 5 , 7, 8, 9) . In particular, the 4p16.3 breakpoints occur within the 5' introns or regulatory regions of the MMSET gene, leading to the juxtaposition of IGH sequences in the same transcriptional orientation in both the der(4) and (der)14 chromosomes (9) . It has also been demonstrated in MM cell lines that these recombinations generate both MMSET-IGH and IGH-MMSET chimeric transcripts, but the JH-MMSET and -MMSET hybrid transcripts arising from the IGH promoters relocated on the der(4) chromosome seem to be more frequently expressed (9) . Gene deregulation due to a similar mechanism of promoter substitution has been reported previously in the t(3;14)(q27;q32) translocation involving the BCL-6 gene in diffuse large cell lymphomas (18) . Regardless of the functional consequences of these alterations in the deregulation of MMSET expression, the IGH-MMSET transcripts may be a reliable marker for the detection of t(4;14) in MM; this is particularly important because, as we and others have recently shown (5 , 8) , FISH is the only valid means of detecting this translocation.

To the best of our knowledge, there are no previously published reports concerning the investigation of chimeric IGH-MMSET transcripts in MM and/or MGUS patients. In this study, we began by attempting to develop a RT-PCR assay to detect the chimeric transcripts from all of the 4p16.3 breakpoints identified thus far, and then we used it to investigate a representative panel of 53 MM and 16 MGUS patients; we also performed comparative FISH analyses in all of the MM cases. Eleven of the 53 (20%) MM cases were found to be positive for IGH-MMSET transcripts, and the use of two-color FISH detected the presence of a t(4;14) translocation in all of them. These findings in a larger series confirm our previous data concerning the frequency of FISH-detected t(4;14) in MM [5 of 30 MM cases (17%), Ref. 8 ] and indicate that the sensitivity and specificity of the two approaches are comparable. Given that RT-PCR is an easier, less expensive, and routinely available procedure in most (if not all) laboratories, our data strongly suggest that it should be considered the method of choice for detecting the t(4;14) translocation in MM. These considerations are even more valid in the case of MGUS because chromosomal analyses (including the more sensitive FISH) are still difficult to perform as a result of the small number of clonal plasma cells (usually less than 5%). Furthermore, because MGUS is considered to be a preneoplastic stage that has a 25% chance of progression to overt myeloma, the early identification of genetic lesions may have important implications in terms of clinical management. Our RT-PCR analysis revealed the presence of IGH-MMSET transcripts in only 1 of 16 (6%) of our MGUS patients, and, although our MM and MGUS series are not numerically comparable, it seems that the incidence of t(4;14) is lower in MGUS than in MM. These findings are quite similar to those recently reported by Avet-Loiseau et al., whose FISH studies have revealed the translocation in 2% (2 of 100) of their MGUS patients (19) but in 12% (12 of 102) of their MM patients (5) . They have suggested that in MGUS patients, t(4;14) may directly precipitate clonal plasma cells into true myeloma cells, but our single MGUS patient harboring t(4;14) showed no progression of the disease after a 60-month follow-up period.

The analysis of IGH-MMSET transcripts in MM also makes it possible to characterize the relative position of 4p16.3 breakpoints. Our study confirms that they do not occur within the coding sequences of the MMSET gene and that most of them (6 of 11) occur 5' to exon 3. The chimeric IGH-MMSET allele in patients with a MB4-1 breakpoint may produce an overexpressed full-length MMSET protein, whereas those in patients with MB4-2 or MB4-3 breakpoints may give rise to putative truncated MMSET proteins lacking the 238 or 323 NH2-terminal amino acids, respectively (9) . We also found that appreciable levels of MMSET transcripts are detected by RT-PCR in translocated MM cell lines and tumors as well as in normal and neoplastic leukocytes (data not shown); this finding suggests that the major consequence of the t(4;14) translocation with regard to the MMSET gene may be homotypic deregulation. The functional role of normal and tumor-associated MMSET forms remains to be investigated.

The RT-PCR detection of t(4;14) may also have implications in terms of the molecular monitoring of minimal residual disease in MM: its specificity and sensitivity could make it a fast and simple alternative to current immunoglobulin-based methods in the subset of patients harboring the translocation.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Associazione Italiana Ricerca sul Cancro (to A. N.) and the Ministero della Sanità (to the Ospedale Maggiore IRCCS, Milan, Italy), and Ministero dell’Università e della Ricerca Scientifica e Tecnologica (MURST) 1999 Grant 9906038391-010. Back

2 To whom requests for reprints should be addressed, at Servizio Ematologia, Dipartimento di Scienze Mediche, Università di Milano, Ospedale Maggiore di Milano, IRCCS, Via Francesco Sforza 35, 20122 Milan, Italy. Phone: 39-02-55033327; Fax: 39-02-55012111; E-mail: neri1{at}utenti.unimi.it Back

3 The abbreviations used are: MM, multiple myeloma; RT-PCR, reverse transcription-PCR; MGUS, monoclonal gammopathy of uncertain significance; FISH, fluorescence in situ hybridization; MB4, myeloma breakpoint chromosome 4. Back

Received 3/17/00. Accepted 6/16/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Hallek M., Bergsagel P. L., Anderson K. C. Multiple myeloma: increasing evidence for a multistep transformation process. Blood, 91: 3-21, 1998.[Free Full Text]
  2. Bergsagel P. L., Chesi M., Nardini E., Brents L. A., Kirby S. L., Kuehl W. M. Promiscuous translocations into immunoglobulin heavy chain switch regions in multiple myeloma. Proc. Natl. Acad. Sci. USA, 93: 13931-13936, 1996.[Abstract/Free Full Text]
  3. Nishida K., Tamura A., Nakazawa N., Ueda Y., Abe T., Matsuda F., Kashima K., Taniwaki M. The Ig heavy chain gene is frequently involved in chromosomal translocations in multiple myeloma and plasma cell leukemia as detected by in situ hybridization. Blood, 90: 526-534, 1997.[Abstract/Free Full Text]
  4. Richelda R., Ronchetti D., Baldini L., Cro L., Viggiano L., Marzella R., Rocchi M., Otsuki T., Lombardi L., Maiolo A. T., Neri A. A novel chromosomal translocation t(4;14)(p16. 3;q32) in multiple myeloma involves the fibroblast growth-factor receptor 3 gene. Blood, 90: 4062-4069, 1997.[Abstract/Free Full Text]
  5. Avet-Loiseau H., Li J-Y., Facon T., Brigaudeau C., Morineau N., Maloisel F., Rapp M-J., Talmant P., Trimoreau F., Jaccard A., Harousseau J-L., Bataille R. High incidence of translocations t(11;14)(q13;q32) and t(4;14)(p16;q32) in patients with plasma cell malignancies. Cancer Res., 58: 5640-5645, 1998.[Abstract/Free Full Text]
  6. Ronchetti D., Finelli P., Richelda R., Baldini L., Rocchi M., Viggiano L., Cuneo A., Bogni S., Fabris S., Lombardi L., Maiolo A. T., Neri A. Molecular analysis of 11q13 breakpoints in multiple myeloma. Blood, 93: 1330-1337, 1999.[Abstract/Free Full Text]
  7. Chesi M., Nardini E., Brents L. A., Schroch E., Ried T., Kuehl W. M., Bergsagel P. L. Frequent translocation t(4;14)(p16. 3;q32.3) in multiple myeloma is associated with increased expression and activating mutations of fibroblast growth factor receptor 3. Nat. Genet., 16: 260-264, 1997.[Medline]
  8. Finelli P., Fabris S., Zagano S., Baldini L., Intini D., Nobili L., Lombardi L., Maiolo A. T., Neri A. Detection of t(4;14)(p16. 3;q32) chromosomal translocation in multiple myeloma by double-color fluorescent in situ hybridization. Blood, 94: 724-732, 1999.[Abstract/Free Full Text]
  9. Chesi M., Nardini E., Lim R. S. C., Smith K. D., Kuehl M. W., Bergsagel P. L. The t(4;14) translocation in myeloma dysregulates both FGFR3 and a novel gene, MMSET, resulting in IgH/MMSET hybrid transcripts. Blood, 92: 3025-3034, 1998.[Abstract/Free Full Text]
  10. Chesi M., Bergsagel P. L., Shonukan O. O., Martelli M. L., Brents L. A., Chen T., Schrock E., Ried T., Kuehl M. W. Frequent dysregulation of the c-maf proto-oncogene at 16q23 by translocation to an Ig locus in multiple myeloma. Blood, 91: 4457-4463, 1998.[Abstract/Free Full Text]
  11. Iida S., Rao P. H., Butler M., Corradini P., Boccadoro M., Klein B., Chaganti R. S. K., Dalla-Favera R. Deregulation of MUM1/IRF4 by chromosomal translocation in multiple myeloma. Nat. Genet., 17: 226-230, 1997.[Medline]
  12. Thompson L. M., Plummer S., Schalling M., Altherr M. R., Gusella J. F., Housman D. E., Wasmuth J. J. A gene encoding a fibroblast growth factor receptor isolated from the Huntington disease gene region of human chromosome 4. Genomics, 11: 1133-1142, 1991.[Medline]
  13. Stec I., Wright T. J., van Ommen G. B., de Boer P. A. J., van Haeringer A., Moorman A. F. M., Altherr M. R., den Dunnen J. T. WHSC1, a 90 kb SET domain-containing gene, expressed in early development and homologous to a Drosophila dysmorphy gene maps in the Wolf-Hirschhorn syndrome critical region and is fused to IgH in t(4;14) multiple myeloma. Hum. Mol. Genet., 7: 1071-1082, 1998.[Abstract/Free Full Text]
  14. Johnson D. E., Williams L. T. Structural and functional diversity in the fgf receptor multigene family. Adv. Cancer Res., 60: 1-41, 1993.[Medline]
  15. Fracchiolla N. S., Luminari S., Baldini L., Lombardi L., Maiolo A. T., Neri A. FGFR3 gene mutations associated with human skeletal disorders are rarely involved in multiple myeloma. Blood, 92: 2987-2989, 1998.[Free Full Text]
  16. Durie B. G. M., Salmon S. A clinical staging system for multiple myeloma. Cancer (Phila.), 36: 842-854, 1975.[Medline]
  17. Baxendale S., MacDonald M. E., Mott R., Francis F., Lin C., James M., Zehetner G., Hummerich H., Valdes J., Collins F. S., Deaven L. J., Gusella J. F., Lehrach H., Bates G. P. A cosmid conting and high resolution restriction map of the 2 megabase region containing the Huntington’s disease gene. Nat. Genet., 4: 181-186, 1993.[Medline]
  18. Ye B. H., Chaganti S., Chang C-C., Niu H., Corradini P., Chaganti R. S. K., Dalla-Favera R. Chromosomal translocations cause deregulated BCL6 expression by promoter substitution in B cell lymphoma. EMBO J., 14: 6209-6217, 1995.[Medline]
  19. Avet-Loiseau H., Facon T., Daviet A., Godon C., Rapp M-J., Harousseau J-L., Grosbois B., Bataille R. 14q32 translocations and monosomy 13 observed in monoclonal gammopathy of undetermined significance delineate a multistep process for the oncogenesis of multiple myeloma. Cancer Res., 59: 4546-4550, 1999.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
haematolHome page
J. L.R. Brito, B. Walker, M. Jenner, N. J. Dickens, N. J.M. Brown, F. M. Ross, A. Avramidou, J. A.E. Irving, D. Gonzalez, F. E. Davies, et al.
MMSET deregulation affects cell cycle progression and adhesion regulons in t(4;14) myeloma plasma cells
Haematologica, January 1, 2009; 94(1): 78 - 86.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. Lauring, A. M. Abukhdeir, H. Konishi, J. P. Garay, J. P. Gustin, Q. Wang, R. J. Arceci, W. Matsui, and B. H. Park
The multiple myeloma associated MMSET gene contributes to cellular adhesion, clonogenic growth, and tumorigenicity
Blood, January 15, 2008; 111(2): 856 - 864.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
J. VanDijken, G. V. Kaigala, J. Lauzon, A. Atrazhev, S. Adamia, B. J. Taylor, T. Reiman, A. R. Belch, C. J. Backhouse, and L. M. Pilarski
Microfluidic Chips for Detecting the t(4;14) Translocation and Monitoring Disease during Treatment Using Reverse Transcriptase-Polymerase Chain Reaction Analysis of IgH-MMSET Hybrid Transcripts
J. Mol. Diagn., July 1, 2007; 9(3): 358 - 367.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
J. Ren, D. Raina, W. Chen, G. Li, L. Huang, and D. Kufe
MUC1 Oncoprotein Functions in Activation of Fibroblast Growth Factor Receptor Signaling
Mol. Cancer Res., November 1, 2006; 4(11): 873 - 883.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
X. Xin, T. J. Abrams, P. W. Hollenbach, K. G. Rendahl, Y. Tang, Y. A. Oei, M. G. Embry, D. E. Swinarski, E. N. Garrett, N. K. Pryer, et al.
CHIR-258 Is Efficacious in A Newly Developed Fibroblast Growth Factor Receptor 3-Expressing Orthotopic Multiple Myeloma Model in Mice.
Clin. Cancer Res., August 15, 2006; 12(16): 4908 - 4915.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. J. Keats, C. A. Maxwell, B. J. Taylor, M. J. Hendzel, M. Chesi, P. L. Bergsagel, L. M. Larratt, M. J. Mant, T. Reiman, A. R. Belch, et al.
Overexpression of transcripts originating from the MMSET locus characterizes all t(4;14)(p16;q32)-positive multiple myeloma patients
Blood, May 15, 2005; 105(10): 4060 - 4069.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Rasmussen, M. Kuehl, M. Lodahl, H. E. Johnsen, and I. M. S. Dahl
Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transition in some plasma cell tumors
Blood, January 1, 2005; 105(1): 317 - 323.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. M. Dring, F. E. Davies, J. A. L. Fenton, P. L. Roddam, K. Scott, D. Gonzalez, S. Rollinson, A. C. Rawstron, K. S. Rees-Unwin, C. Li, et al.
A Global Expression-based Analysis of the Consequences of the t(4;14) Translocation in Myeloma
Clin. Cancer Res., September 1, 2004; 10(17): 5692 - 5701.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Fonseca, B. Barlogie, R. Bataille, C. Bastard, P. L. Bergsagel, M. Chesi, F. E. Davies, J. Drach, P. R. Greipp, I. R. Kirsch, et al.
Genetics and Cytogenetics of Multiple Myeloma: A Workshop Report
Cancer Res., February 15, 2004; 64(4): 1546 - 1558.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. N. Onwuazor, X.-Y. Wen, D.-Y. Wang, L. Zhuang, E. Masih-Khan, J. Claudio, B. Barlogie, J. D. Shaughnessy Jr, and A. K. Stewart
Mutation, SNP, and isoform analysis of fibroblast growth factor receptor 3 (FGFR3) in 150 newly diagnosed multiple myeloma patients
Blood, July 15, 2003; 102(2): 772 - 773.
[Full Text] [PDF]


Home page
BloodHome page
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski
In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression
Blood, February 15, 2003; 101(4): 1520 - 1529.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
G Pratt
Molecular aspects of multiple myeloma
Mol. Pathol., October 1, 2002; 55(5): 273 - 283.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Fonseca, R. J. Bailey, G. J. Ahmann, S. V. Rajkumar, J. D. Hoyer, J. A. Lust, R. A. Kyle, M. A. Gertz, P. R. Greipp, and G. W. Dewald
Genomic abnormalities in monoclonal gammopathy of undetermined significance
Blood, July 30, 2002; 100(4): 1417 - 1424.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Avet-Loiseau, T. Facon, B. Grosbois, F. Magrangeas, M.-J. Rapp, J.-L. Harousseau, S. Minvielle, and R. Bataille
Oncogenesis of multiple myeloma: 14q32 and 13q chromosomal abnormalities are not randomly distributed, but correlate with natural history, immunological features, and clinical presentation
Blood, March 15, 2002; 99(6): 2185 - 2191.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. Perfetti, A. M. L. Coluccia, D. Intini, U. Malgeri, M. C. Vignarelli, S. Casarini, G. Merlini, and A. Neri
Translocation t(4;14)(p16.3;q32) Is a Recurrent Genetic Lesion in Primary Amyloidosis
Am. J. Pathol., May 1, 2001; 158(5): 1599 - 1603.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Avet-Loiseau, A. Daviet, C. Brigaudeau, E. Callet-Bauchu, C. Terre, M. Lafage-Pochitaloff, F. Desangles, S. Ramond, P. Talmant, and R. Bataille
Cytogenetic, interphase, and multicolor fluorescence in situ hybridization analyses in primary plasma cell leukemia: a study of 40 patients at diagnosis, on behalf of the Intergroupe Francophone du Myelome and the Groupe Francais de Cytogenetique Hematologique
Blood, February 1, 2001; 97(3): 822 - 825.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malgeri, U.
Right arrow Articles by Neri, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malgeri, U.
Right arrow Articles by Neri, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online