| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Hematology Service [U. M., L. B., S. F., V. L., S. C., S. B., L. L., A. T. M., A. N.] and 3rd Division of Internal Medicine [G. C.], Università degli Studi di Milano, Ospedale Maggiore IRCCS, 20122 Milan, and Department of Internal Medicine [V. P.] and Biotechnology Research Laboratories [M. C. V.], Policlinico San Matteo IRCCS, 27100 Pavia, Italy
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
|
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
The t(4;14)(p16.3;q32) chromosomal translocation has not been described previously in reports based on conventional cytogenetics, probably because of the involvement of the telomeric portions of chromosomes 4p16.3 and 14q32; however, we and others have identified this translocation in MM by cloning the "illegitimate" switch-rearranged IGH alleles suggestive of translocation events. Molecular analyses of the 4p16.3 breakpoints (4 , 7 , 9) have shown that they occur 50–100 kb centromeric to the fibroblast growth factor receptor 3 gene (FGFR3; Ref. 12 ) and within the 5' regions of a novel gene called WHSC1/MMSET (9 , 13) . The FGFR3 gene is a member of the tyrosine kinase receptor family (fibroblast growth factor receptors 1–4), whose ability to bind a large number of related mitogenic fibroblast growth factors leads to the activation of complex signaling pathways regulating cell proliferation, differentiation, and migration in many different tissues (14) . The gene is overexpressed in the translocated cases, and activating point mutations have been found in the deregulated FGFR3 genes of some MM cell lines (4 , 7 , 15) , suggesting that it may play a critical role in tumorigenesis. The WHSC1/MMSET gene, which has been proposed as a candidate for Wolf-Hirschhorn malformation syndrome (13) , contains several functional domains, is expressed in early development (particularly in rapidly growing tissues), and is thought to play a role in transcriptional regulation. It extends over about 120 kb on the genome, and its 5' untranslated region lies approximately 50 kb centromeric of FGFR3. The 4p16.3 breakpoints directly involve the WHSC1/MMSET gene because they occur within 5' introns or upstream of its coding sequence, probably in the transcription regulatory regions. Finally, the gene is expressed at relatively low levels in MM cell lines but is overexpressed in the majority of those carrying the translocation (9 , 13) . The t(4;14)(p16.3;q32) translocation may therefore lead to the deregulation of two different potential oncogenes in MM.
The detection of t(4;14) is difficult by means of conventional cytogenetics or Southern blotting because of the poor sensitivity of karyotype analyses and the relatively large dispersion of 4p16.3 breakpoints. We and others have recently developed a two-color FISH assay using IGH- and 4p16.3-specific probes, which has revealed this lesion in 12–17% of the studied MM cases (5 , 8) . Chesi et al. (9) have shown that the presence of t(4;14) in MM cell lines leads to the formation of IGH-MMSET hybrid transcripts, which may therefore represent a specific marker of the translocation. In this study, we developed a RT-PCR assay for the detection of IGH-MMSET transcripts, investigated their presence in total mRNAs from pathological samples of 53 MM patients and 16 patients with MGUS, and compared the results of the RT-PCR and two-color FISH analyses in MM patients. Our data indicate that RT-PCR is a sensitive and reliable method for the detection of the t(4;14) translocation in MM.
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
. The pathological samples from 35 MM patients (including three cases
with plasma cell leukemia) were obtained at diagnosis; the samples from
the remaining 18 MM patients were obtained during phases of disease
relapse or progression. The Durie-Salmon clinical stage of all of the
MM patients shown in Table 1
refers to that recorded at the time of
diagnosis. The pathological samples from all of the MGUS patients were
obtained at diagnosis.
|
, and their sequences (5' to 3') are as follows:
(a) JH6, ACCACGGTCACCGTCTCCTCA (sense primer);
(b) Iµ1, AGCCCTTGTTAATGGACTTG (sense
primer); (c) Iµ2,
CTTTGCAAGGCTCGCAGTGAC (sense primer); (d) ms4f,
ATTCCAGCTCCGAAAGAGTC (sense primer); (e) ms6r,
CCTCAATTTCCCTGAAATTGGTT (antisense primer); (f)
ms5r, AAGAACTGTACGTGATACTG (antisense primer); and
(g) ms4r, TAAGTTTGGTATAGCTGTGA (antisense
primer). In the case of the reactions using the
JH6-ms6r or Iµ1-ms6r primers,
35 amplification cycles were performed at 94°C for 30 s, 50°C
for 30 s, and 72°C for 1 min. For the nested-PCR, 1 µl of a
first amplification reaction carried out with the
Iµ1-ms6r set of primers was used in 30
amplification cycles performed at 94°C for 30 s, 58°C for
30 s, and 72°C for 30 s with the internal
Iµ2 and ms5r primers.
|
FISH Analysis.
Detection of the t(4;14) translocation was performed by two-color FISH
as recently described by Finelli et al. (8)
.
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
). As a
result, the der(4)
chromosome leads to the formation of
IGH-MMSET hybrid transcripts (Fig. 1B
). The
RT-PCR used to detect these transcripts in our series of patients was
based on IGH and MMSET primers, some of which
have been reported previously [see "Materials and Methods" and the
scheme in Fig. 1B
(9)
]. The primers were
tested on the MM-derived KMS-11, NCI-H929, and OPM-2 cell lines
representative of the three 4p16.3 breakpoint patterns described thus
far: (a) 5' to exon 3 (KMS-11); (b) within intron
3 (NCI-H929); or (c) within intron 4 (OPM-2) of the
MMSET gene (see the scheme in Fig. 1B
). For
practical purposes, we called these breakpoints MB4-1, MB4-2, and
MB4-3, respectively.
In an attempt to assess a RT-PCR capable of detecting all of the
breakpoint types, we performed two separate PCRs on reverse-transcribed
cDNAs from the three cell lines using the JH6-ms6r or
Iµ1-ms6r set of primers (Fig. 1B
). IGH-MMSET fusion transcripts were detected
with both sets of primers (Fig. 1C
and the scheme in Fig. 1D
). A single amplified fragment of the expected size was
detected in the OPM-2 cell line in each reaction, whereas two fragments
were constantly found in the NCI-H929 cells (the lower and stronger
fragment was of the expected size); this pattern was also detected
using the ms5r but not the ms4r antisense primer
(see the scheme in Fig. 1B
; data not shown). In the KMS-11 cells,
amplification with JH6-ms6r primers showed the
presence of a fragment of the expected size plus a faint upper fragment
that was still present when the ms5r but not the
ms4r primer was used (data not shown). The fragments of the
expected size were separated by agarose gel and analyzed by
direct sequencing. The fainter upper fragments observed in NCI-H929 and
KMS-11 were sequenced and found to contain an additional 104-nucleotide
stretch between exon 4 and exon 5 (data not shown). A data bank
search indicated that this 104-bp sequence is located 7654 nucleotides
downstream of exon 4 of the MMSET gene [position
24666–24562 of the L190b4 cosmid clone described by Baxendale et
al. (17)
]; this sequence is flanked by canonical
acceptor and donor splice sites and may therefore represent a novel
putative MMSET exon (which we called exon 4a). MMSET
transcripts, including those containing the putative exon 4a, are
constantly detected by RT-PCR in both normal and neoplastic leukocytes
(data not shown); the analysis of the open reading frame containing
exon 4a revealed that it leads to a putative MMSET truncated protein of
273 amino acids (data not shown).
Because t(4;14) represents a specific molecular marker suitable for the
molecular monitoring of the minimal residual disease in MM, we tried to
develop a more sensitive nested PCR assay by using the internal
Iµ2 and ms5r primers specific for
the Iµ-MMSET transcript. KMS-11, NCI-H929, or
OPM-2 cells were serially diluted with the KG1 cell line negative for
the translocation; under our nested PCR conditions, we were able to
detect the amplified fragment specific for each cell line in 1 positive
cell in 1 x 105 negative cells
(see Fig. 1E
; data not shown).
RT-PCR Analysis in MM Patients.
RT-PCR analysis was performed in 53 patients using the
JH6-ms6r (data not shown) or
Iµ1-ms6r (Fig. 2A
) primers in
separate reactions. Hybrids transcripts were found in 11 cases with
both sets of
primers . MB4-1, MB4-2, and MB4-3 breakpoints were found in six cases, three
cases, and one case, respectively; in the remaining case
(LB109 in Fig. 2A
), two amplified fragments of
similar intensity were detected, with the lower fragment having the
size specific for the MB4-3 type. The amplified fragments were
sequenced in all of the positive cases, confirming the type of
breakpoint in the first 10 patients; in case LB109, the sequence of the
lower fragment was specific for the MB4-3 type, whereas the sequence of
the upper fragment contained the 104-nucleotide stretch from the
putative exon 4a. The latter findings suggest that the
breakpoint in this case is 5' to exon 4a, a hypothesis that is further
supported by the absence of this fragment in the OPM-2 cell line, for
which the breakpoint has been localized 886 bp downstream of exon 4a
(2)
.
|
RT-PCR Analysis in MGUS Patients.
The presence of the IGH-MMSET fusion transcripts was
investigated in bone marrow samples taken from 16 MGUS patients. No
hybrid transcripts were detected in first PCR with both the
JH6-ms6r and
Iµ1-ms6r combinations of primers.
Nested PCR analysis (Fig. 2B
) revealed the presence of an
amplified fragment (breakpoint MB4-2 type) in only one case [1 of 16
cases (7%)].
Correlation with Clinicopathological Features.
We did not find any significant correlations between the presence of
t(4;14) and the clinicopathological characteristics of our MM patients.
Of the 35 patients evaluated at diagnosis, 8 cases were positive for
the translocation (3 of 18 patients with stage I disease, 3 of 14
patients with stage II/III disease, and 2 of 3 patients with plasma
cell leukemia); of the 18 patients evaluated during disease relapse or
progression, 3 were found to be positive for the translocation.
No correlation was found with age, monoclonal component, sex, or
lactate dehydrogenase levels (
460 or >460 units/liter) and
ß2-microglobulin (2.6 or >2.6 mg/ml). The MGUS patient positive
for the translocation is still in this clinical phase after 60 months
of follow-up.
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
To the best of our knowledge, there are no previously published reports concerning the investigation of chimeric IGH-MMSET transcripts in MM and/or MGUS patients. In this study, we began by attempting to develop a RT-PCR assay to detect the chimeric transcripts from all of the 4p16.3 breakpoints identified thus far, and then we used it to investigate a representative panel of 53 MM and 16 MGUS patients; we also performed comparative FISH analyses in all of the MM cases. Eleven of the 53 (20%) MM cases were found to be positive for IGH-MMSET transcripts, and the use of two-color FISH detected the presence of a t(4;14) translocation in all of them. These findings in a larger series confirm our previous data concerning the frequency of FISH-detected t(4;14) in MM [5 of 30 MM cases (17%), Ref. 8 ] and indicate that the sensitivity and specificity of the two approaches are comparable. Given that RT-PCR is an easier, less expensive, and routinely available procedure in most (if not all) laboratories, our data strongly suggest that it should be considered the method of choice for detecting the t(4;14) translocation in MM. These considerations are even more valid in the case of MGUS because chromosomal analyses (including the more sensitive FISH) are still difficult to perform as a result of the small number of clonal plasma cells (usually less than 5%). Furthermore, because MGUS is considered to be a preneoplastic stage that has a 25% chance of progression to overt myeloma, the early identification of genetic lesions may have important implications in terms of clinical management. Our RT-PCR analysis revealed the presence of IGH-MMSET transcripts in only 1 of 16 (6%) of our MGUS patients, and, although our MM and MGUS series are not numerically comparable, it seems that the incidence of t(4;14) is lower in MGUS than in MM. These findings are quite similar to those recently reported by Avet-Loiseau et al., whose FISH studies have revealed the translocation in 2% (2 of 100) of their MGUS patients (19) but in 12% (12 of 102) of their MM patients (5) . They have suggested that in MGUS patients, t(4;14) may directly precipitate clonal plasma cells into true myeloma cells, but our single MGUS patient harboring t(4;14) showed no progression of the disease after a 60-month follow-up period.
The analysis of IGH-MMSET transcripts in MM also makes it possible to characterize the relative position of 4p16.3 breakpoints. Our study confirms that they do not occur within the coding sequences of the MMSET gene and that most of them (6 of 11) occur 5' to exon 3. The chimeric IGH-MMSET allele in patients with a MB4-1 breakpoint may produce an overexpressed full-length MMSET protein, whereas those in patients with MB4-2 or MB4-3 breakpoints may give rise to putative truncated MMSET proteins lacking the 238 or 323 NH2-terminal amino acids, respectively (9) . We also found that appreciable levels of MMSET transcripts are detected by RT-PCR in translocated MM cell lines and tumors as well as in normal and neoplastic leukocytes (data not shown); this finding suggests that the major consequence of the t(4;14) translocation with regard to the MMSET gene may be homotypic deregulation. The functional role of normal and tumor-associated MMSET forms remains to be investigated.
The RT-PCR detection of t(4;14) may also have implications in terms of the molecular monitoring of minimal residual disease in MM: its specificity and sensitivity could make it a fast and simple alternative to current immunoglobulin-based methods in the subset of patients harboring the translocation.
|
FOOTNOTES |
|---|
1 Supported by grants from the Associazione
Italiana Ricerca sul Cancro (to A. N.) and the Ministero della
Sanità (to the Ospedale Maggiore IRCCS, Milan, Italy), and
Ministero dell’Università e della Ricerca Scientifica e
Tecnologica (MURST) 1999 Grant 9906038391-010. 
2 To whom requests for reprints should be
addressed, at Servizio Ematologia, Dipartimento di Scienze Mediche,
Università di Milano, Ospedale Maggiore di Milano, IRCCS,
Via Francesco Sforza 35, 20122 Milan, Italy. Phone: 39-02-55033327;
Fax: 39-02-55012111; E-mail: neri1{at}utenti.unimi.it
3 The abbreviations used are: MM, multiple
myeloma; RT-PCR, reverse transcription-PCR; MGUS, monoclonal gammopathy
of uncertain significance; FISH, fluorescence in situ
hybridization; MB4, myeloma breakpoint chromosome 4.
Received 3/17/00. Accepted 6/16/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  J. Lauring, A. M. Abukhdeir, H. Konishi, J. P. Garay, J. P. Gustin, Q. Wang, R. J. Arceci, W. Matsui, and B. H. Park The multiple myeloma associated MMSET gene contributes to cellular adhesion, clonogenic growth, and tumorigenicity Blood, January 15, 2008; 111(2): 856 - 864. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. VanDijken, G. V. Kaigala, J. Lauzon, A. Atrazhev, S. Adamia, B. J. Taylor, T. Reiman, A. R. Belch, C. J. Backhouse, and L. M. Pilarski Microfluidic Chips for Detecting the t(4;14) Translocation and Monitoring Disease during Treatment Using Reverse Transcriptase-Polymerase Chain Reaction Analysis of IgH-MMSET Hybrid Transcripts J. Mol. Diagn., July 1, 2007; 9(3): 358 - 367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ren, D. Raina, W. Chen, G. Li, L. Huang, and D. Kufe MUC1 Oncoprotein Functions in Activation of Fibroblast Growth Factor Receptor Signaling Mol. Cancer Res., November 1, 2006; 4(11): 873 - 883. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Xin, T. J. Abrams, P. W. Hollenbach, K. G. Rendahl, Y. Tang, Y. A. Oei, M. G. Embry, D. E. Swinarski, E. N. Garrett, N. K. Pryer, et al. CHIR-258 Is Efficacious in A Newly Developed Fibroblast Growth Factor Receptor 3-Expressing Orthotopic Multiple Myeloma Model in Mice. Clin. Cancer Res., August 15, 2006; 12(16): 4908 - 4915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Keats, C. A. Maxwell, B. J. Taylor, M. J. Hendzel, M. Chesi, P. L. Bergsagel, L. M. Larratt, M. J. Mant, T. Reiman, A. R. Belch, et al. Overexpression of transcripts originating from the MMSET locus characterizes all t(4;14)(p16;q32)-positive multiple myeloma patients Blood, May 15, 2005; 105(10): 4060 - 4069. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Rasmussen, M. Kuehl, M. Lodahl, H. E. Johnsen, and I. M. S. Dahl Possible roles for activating RAS mutations in the MGUS to MM transition and in the intramedullary to extramedullary transition in some plasma cell tumors Blood, January 1, 2005; 105(1): 317 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Dring, F. E. Davies, J. A. L. Fenton, P. L. Roddam, K. Scott, D. Gonzalez, S. Rollinson, A. C. Rawstron, K. S. Rees-Unwin, C. Li, et al. A Global Expression-based Analysis of the Consequences of the t(4;14) Translocation in Myeloma Clin. Cancer Res., September 1, 2004; 10(17): 5692 - 5701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Fonseca, B. Barlogie, R. Bataille, C. Bastard, P. L. Bergsagel, M. Chesi, F. E. Davies, J. Drach, P. R. Greipp, I. R. Kirsch, et al. Genetics and Cytogenetics of Multiple Myeloma: A Workshop Report Cancer Res., February 15, 2004; 64(4): 1546 - 1558. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. N. Onwuazor, X.-Y. Wen, D.-Y. Wang, L. Zhuang, E. Masih-Khan, J. Claudio, B. Barlogie, J. D. Shaughnessy Jr, and A. K. Stewart Mutation, SNP, and isoform analysis of fibroblast growth factor receptor 3 (FGFR3) in 150 newly diagnosed multiple myeloma patients Blood, July 15, 2003; 102(2): 772 - 773. [Full Text] [PDF]
|
|
|
|
|
|
J. J. Keats, T. Reiman, C. A. Maxwell, B. J. Taylor, L. M. Larratt, M. J. Mant, A. R. Belch, and L. M. Pilarski In multiple myeloma, t(4;14)(p16;q32) is an adverse prognostic factor irrespective of FGFR3 expression Blood, February 15, 2003; 101(4): 1520 - 1529. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G Pratt Molecular aspects of multiple myeloma Mol. Pathol., October 1, 2002; 55(5): 273 - 283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Fonseca, R. J. Bailey, G. J. Ahmann, S. V. Rajkumar, J. D. Hoyer, J. A. Lust, R. A. Kyle, M. A. Gertz, P. R. Greipp, and G. W. Dewald Genomic abnormalities in monoclonal gammopathy of undetermined significance Blood, July 30, 2002; 100(4): 1417 - 1424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Avet-Loiseau, T. Facon, B. Grosbois, F. Magrangeas, M.-J. Rapp, J.-L. Harousseau, S. Minvielle, and R. Bataille Oncogenesis of multiple myeloma: 14q32 and 13q chromosomal abnormalities are not randomly distributed, but correlate with natural history, immunological features, and clinical presentation Blood, March 15, 2002; 99(6): 2185 - 2191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Perfetti, A. M. L. Coluccia, D. Intini, U. Malgeri, M. C. Vignarelli, S. Casarini, G. Merlini, and A. Neri Translocation t(4;14)(p16.3;q32) Is a Recurrent Genetic Lesion in Primary Amyloidosis Am. J. Pathol., May 1, 2001; 158(5): 1599 - 1603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Avet-Loiseau, A. Daviet, C. Brigaudeau, E. Callet-Bauchu, C. Terre, M. Lafage-Pochitaloff, F. Desangles, S. Ramond, P. Talmant, and R. Bataille Cytogenetic, interphase, and multicolor fluorescence in situ hybridization analyses in primary plasma cell leukemia: a study of 40 patients at diagnosis, on behalf of the Intergroupe Francophone du Myelome and the Groupe Francais de Cytogenetique Hematologique Blood, February 1, 2001; 97(3): 822 - 825. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
) and the IGH region
(Iµ, 
; JH, 
) are indicated. The approximate locations of the
primers used (see "Materials and Methods") are shown
below the map. C, RT-PCR analysis of the
IGH/MMSET hybrid transcripts in the KMS-11, NCI-H929,
and OPM-2 cell lines using the Iµ1 and
ms6r (Lane 1) or JH6 and
ms6r (Lane 2) primers; the length of the
HaeIII-digested 
molecular markers is indicated in
bp. D, schematic representation of the
IGH/MMSET hybrid transcripts shown in C
and their respective lengths in bp. E, nested PCR
analysis. cDNA obtained from serial dilutions of the NCI-H929 cells and
negative control KG1 cells was amplified with the
Iµ1 and ms6r primers
(left). The nested PCR amplifications using the
Iµ2 and ms5r internal
primers are shown on the right. The length of the
amplified fragments (the one at the top contains the putative exon 4a;
see the text) is indicated in bp.