This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xinarianos, G. Articles by Field, J. K. Search for Related Content PubMed PubMed Citation Articles by Xinarianos, G. Articles by Field, J. K.

hMLH1 and hMSH2 Expression Correlates with Allelic Imbalance on Chromosome 3p in Non-Small Cell Lung Carcinomas¹

Molecular Oncology Unit, Roy Castle International Centre for Lung Cancer Research, Liverpool L3 9TA, Merseyside [G. X., T. L., W. P., P. M., J. C., P. F., J. K. F.]; Molecular Genetics and Oncology Group, Department of Clinical Dental Sciences, The University of Liverpool, Liverpool L69 3BX [G. X., T. L., P. M., J. C., P. F., J. K. F.]; and Department of Pathology, Medical School, The University of Liverpool, Liverpool L69 3GA [W. P., J. R. G.], United Kingdom

	ABSTRACT

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
DNA mismatch repair genes have been implicated in the pathogenesis and predisposition of certain malignancies through a mutator phenotype. In this study, we investigated, in 150 non-small cell lung carcinomas, the expression levels of hMLH1 and hMSH2 proteins in relation to loss of heterozygosity on chromosomes 3p and 2p, the mutational status of these genes’ promoters and the hot spot exons. We have demonstrated that 88 of 150 (58.6%) tumor specimens had reduced expression levels of the hMLH1 protein, whereas 85 of 147 (57.8%) specimens had reduced expression levels of the hMSH2 protein. Reduced expression levels of both proteins were observed in 51 of 150 (34%) specimens. In adenocarcinomas, the reduction of hMSH2 expression was more frequently observed than that of hMLH1 (P < 0.003), whereas in squamous cell carcinoma of the lung hMLH1 expression was more frequently reduced than hMSH2 (P < 0.006). Reduced expression of hMLH1 correlated with allelic imbalance on loci D3S1289 (P < 0.0002) and D2S391 (P < 0.05). It is of note that an inverse correlation was found between hMSH2 reduced expression and loss of heterozygosity at locus D3S1300 (P = 0.016). In addition, hMLH1 reduced expression was more frequently associated with heavy smokers, assessed by daily tobacco uptake (P = 0.018) and total smoking exposure (pack-years; P < 0.05). In addition, a correlation between hMLH1 reduced expression and nodal metastasis in squamous cell carcinoma of the lung was observed (P = 0.015). No mutations were identified in the promoters or exons examined in these two genes. These findings indicate that hMLH1 and hMSH2 gene inactivation is a common event in the development of non-small cell lung carcinoma and allelic loss seems to be a major genetic event involved in hMLH1 silencing. In addition, we propose that a putative negative regulator of hMSH2 gene may be located at the locus 3p14.

	INTRODUCTION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
hMLH1 and hMSH2 are two of the genes known to be implicated in the DNA MMR³ system. Inactivation of the MMR machinery has been closely associated with a mutator phenotype that is a hallmark of almost all human cancers (1) . Molecular defects in one or both of the genes account for a significant proportion of HNPCCs and a small proportion of sporadic colorectal cancer cases (2 , 3) . Inactivation of DNA MMR genes occurs in two steps, following the same pattern as in tumor suppressor genes (4) . Previous studies have demonstrated that LOH at the DNA MMR loci is a frequent genetic event in human cancers, including lung cancer (5, 6, 7, 8, 9) . It has also been shown that methylation of the promoter region of the hMLH1 gene leads to lack of expression of the encoding protein (10, 11, 12) . However, hMSH2 promoter methylation has not been demonstrated in tumors lacking expression of the relative protein (13, 14, 15) . Recent reports have indicated that reduced expression levels of the DNA MMR genes may be implicated in the pathogenesis of certain human cancers and may predict disease-free survival after primary chemotherapy (16, 17, 18, 19, 20, 21, 22) . A possible role of hMLH1 and hMSH2 overexpression in the induction of apoptosis has also been suggested (23) .

Multiple molecular defects have been identified to play a role in the molecular pathogenesis of lung tumors, including alterations in oncogenes and tumor suppressor genes (24, 25) . Mutations in the p53 and K-ras genes as well as allelic losses and deletions at chromosomes 3p and 9p seem to be among the most commonly found genetic defects in carcinomas of the lung (25, 26, 27, 28, 29) . Although the role of the hMLH1 and hMSH2 genes in the molecular pathogenesis of HNPCC and sporadic colorectal carcinoma has been well studied, little is known about the involvement of these genes in lung cancer. In this study, we investigated the expression levels of hMLH1 and hMSH2 proteins in relation to LOH at chromosomes 2p and 3p in NSCLC. We also examined the mutational status of the promoter regions and the most frequently mutated exons reported of the hMLH1 and hMSH2 genes.

	MATERIALS AND METHODS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
Patients.
Lung tumor tissue samples were obtained from 150 patients, 59 males and 91 females, who were operated in the Cardiothoracic Center of Broadgreen (Liverpool, Merseyside, United Kingdom). The age of the patients ranged from 41–95 years (median, 65). The histology of the specimens included in this investigation was: 49 adenocarcinomas, 85 squamous cell carcinomas, 8 adenosquamous, 6 large cell carcinomas, and 2 unclassified NSCLCs. Smoking history (daily consumption, current status) was available for 111 individuals: fifty-four current smokers, 16 recently stopped smokers (1–4 years prior to presentation), 35 former smokers (5 years prior to presentation), and 6 nonsmokers. However, complete data for calculating the total smoking exposure was available for only 65 smokers. Total smoking exposure is expressed in pack-years:

pack-years = [(age at operation) - (age started) - (years stopped)] x (packs/day).

In this study, the patients’ pack-years ranged from 17–165 (median, 69).

Immunohistochemical Detection of hMLH1 and hMSH2 Protein Expression.
Protein expression was demonstrated immunohistochemically by a modified avidin-biotin complex method. Formalin-fixed paraffin process tissues were sectioned at 4-µm thickness, mounted on APES-coated slides, and dried at 37°C overnight. Sections were deparaffinized in xylene and rehydrated in a series of graded alcohols to tap water. Heat-mediated antigen retrieval was required to expose the epitopes and was performed by microwaving the sections on full power in 0.01 M citrate buffer (pH 6.0) for 15 min in a 800-W microwave oven. The sections were left to stand for 15 min to cool and then rinsed for 5 min in running tap water. Endogenous peroxidase activity was blocked by 1.5% hydrogen peroxide in methanol for 10 min. Sections were incubated in the primary antibody buffer (5% goat serum in PBS) for 20 min. Monoclonal antibodies against hMLH1 and hMSH2 (Serotec Ltd., Oxford, United Kingdom) were diluted 1:10 and 1:20, respectively, in the primary antibody buffer and incubated for 1 h at room temperature. The primary antibodies were visualized with Dako LSAB 2 Peroxidase kit (DAKO, Cambridgeshire, United Kingdom). The secondary and tertiary reagents were incubated for 30 min each and rinsed in-between each stage with 0.05 M Tris-buffered saline (pH 7.6). The signal was developed with diaminobenzidine (Merck, Dorset, United Kingdom) and hydrogen peroxide. The sections were counterstained with Gill’s Hematoxylin. Normal mouse IgG replaced the primary antibody as a negative control. The frequency of the nuclear staining was scored on a scale from (-) to (+++) [as absent (-), weak (+), moderate (++), and strong (+++)] without the knowledge of clinical, pathological, and 3p LOH status data. The staining was scored by two of the authors independently.

DNA Extraction.
Paired tumor-normal frozen tissue specimens were available from 85 individuals. Five 10-µm sections of each sample were microdissected to ensure presence of >75% tumor cells. Sections were lysed in 400 mM Tris-HCl pH, 150 mM NaCl, 60 mM EDTA, 1% SDS, and 100µg/ml proteinase K and incubated at 42°C for 16 h in an orbital shaker. Deproteinization included extraction with phenol/chloroform and chloroform. DNA was precipitated by the addition of an equal volume of isopropanol. DNA was spooled onto sterile microbiology loops, washed with 70% ethanol, and resuspended in 200 µl of 10 mM Tris (pH 8)-1 mM EDTA. Working stocks were prepared by 5-fold dilution in double distilled H₂O.

LOH Analysis.
Four markers located proximal and distal to hMLH1 gene (D3S1289, D3S1266, D3S1300, and D3S1304) and one marker proximal to hMSH2 gene (D2S391) were available for 85 individuals from a previous study of ours (30) . An additional marker (D2S2259) also located on 2p16 was examined in this study and added in the existing database. All fluorescent microsatellite markers were selected from the Linkage Mapping Set V2.0 (PE Applied Biosystems, Warrington, United Kingdom), and analysis was performed on a 377 ABI-PRISM automatic sequencer. The reaction conditions, details, and analysis parameters have been previously described (30) .

Mutational Analysis.
Mutational analysis was performed on 120 samples. Screening of the hMLH1 promoter region and exons 9, 13, and 16 and the hMSH2 promoter region and exons 5, 7, and 8 was performed by PCR, followed by SSCP and HA. The primers used for hMLH1 (exons 9, 13, and 16) and hMSH2 (exons 5, 7, and 8) and PCR amplification parameters have been described previously (31) . The primers used for the amplification of the promoter regions of hMLH1 and hMSH2 are:

hMLH1 promoter: 5' AGGCTCCACCACCAAATAAC 3' (sense),

5' CGCTGTCCGCTCTTCCTATT 3' (antisense);

hMSH2 promoter: 5' CCTTGCATACACCCCACCCA 3' (sense),

5' GCGACCCCACACCCACTAA 3' (antisense).

PCR reactions were performed in a 25-µl reaction volume and contained 100 ng of genomic DNA, 200 µM of each dNTP, 8 pM of each primer, 0.6 unit of BIOPRO polymerase (Bioline, London, United Kingdom), and 2.5 µl of 10x buffer [50 mM KCl, 10 mM Tris-HCl (pH 8.8), 0.1% Triton X-100, and 1.5 mM MgCl2]. Samples were subjected to 37 cycles of amplification.

For SSCP analysis, 2–4 µl of the PCR product were mixed with 10 µl of denaturing solution consisting of 80% formamide, 100 mM NaOH, 1 mM EDTA, 0.1% Bromphenol Blue, and 0.1% Xylene Cyanol FF. Samples were then heated at 95°C for 3 min, chilled on ice, and loaded onto 8–10% native polyacrylamide gels, containing 5–10% glycerol. Gels were run at 15°C for 2500–3500 V h and silver stained after electrophoresis. HA was performed as: 2–5 µl of the PCR product were denatured at 95°C for 5 min and allowed to cool down slowly. Samples were then analyzed on 8% native polyacrylamide gels and run for 1600–1800 V h. Gels were silver stained after electrophoresis.

Statistical Analysis.
Fisher’s exact test was used to analyze the molecular and clinicopathological data. Analysis was performed using the SPSS software.

	RESULTS

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
hMLH1 and hMSH2 Expression in Lung Tumors.
Fifteen normal lung tissues, adjacent to tumors examined in this study, were also investigated for the expression of hMLH1 and hMSH2. In all cases, normal bronchial epithelium demonstrated strong staining (+++) for both proteins (Fig. 1 and F ). Hence, tumors demonstrating strong (+++) immunoreactivity were classified as "normal expression", whereas tumors demonstrating absent, weak, and moderate immunoreactivity were classified as "reduced expression."

View larger version (104K): [in this window] [in a new window]   Fig. 1. Representative examples to assess hMLH1 and hMSH2 expression in lung carcinomas. A, absence (0) of hMLH1 expression. B, weak (+) hMLH1 expression. C, moderate (++) hMLH1 expression. D, strong (+++) hMLH1 expression. E, absence (0) of hMSH2 expression. F, weak (+) hMSH2 expression. G, moderate (++) hMSH2 expression. H, strong (+++) hMSH2 expression.

The comparative analysis of expression levels of hMSH2 and hMLH1 in different histological types (Table 1) demonstrated that, in adenocarcinomas, hMSH2 was more frequently reduced than hMLH1, 40 of 49 and 26 of 49, respectively (P < 0.003). In contrast, in SqCCL, hMLH1 expression was more frequently reduced than hMSH2, 56 of 85 and 37 of 82, respectively (P < 0.006; Fig. 2 ). Simultaneous reduced expression of both hMLH1 and hMSH2 was found in 51 of 150 (34%) samples examined (Fig. 3 ). Samples with reduced expression of both MMR proteins, comparatively with samples with reduced expression of only one of the examined proteins, did not show additional associations with any of the clinicopathological parameters examined.

View larger version (40K): [in this window] [in a new window]   Fig. 2. Histological type-specific reduced expression of hMLH1 and hMSH2 in lung adenocarcinomas and SqCCL. hMSH2 expression was reduced more than hMLH1 in lung adenocarcinomas, whereas hMLH1 expression was reduced more than hMSH2 in SqCCL.

View larger version (72K): [in this window] [in a new window]   Fig. 3. Combined hMLH1/hMSH2 expression in NSCLC included in this study.

hMLH1 and hMSH2 Expression Correlates with Allelic Imbalance at Chromosomes 2p and 3p.
Eighty-five of the 150 samples examined in the current study were previously investigated for allelic imbalance using fluorescent microsatellite markers and analysis on a 377 ABI PRISM automatic sequencer (30) . In this study, we have also examined an additional marker on 2p16 (D2S2259). LOH for the latter was identified in 26 of 60 (43%) informative cases. The comparative analysis of expression of hMLH1 and hMSH2 with allelic imbalance data of four markers on chromosome 3p (Table 3) showed that hMLH1 reduced expression correlated with allelic imbalance at the D3S1289 locus on 3p21 (Fisher’s exact test, P = 0.00019). No such correlation was found with the loci D3S1304 (3p26; P = 0.14), D3S1266 (3p24; P = 0.1), and D3S1300 (3p14; P = 0.57). However, an inverse correlation was found between LOH at locus D3S1300 (Fisher’s exact, P = 0.016) and expression of hMSH2 protein (Table 3) . In addition, a trend was observed between a higher expression level of the hMSH2 protein and LOH at loci D3S1266 (P = 0.063) and D3S1289 (P = 0.059), but not with locus D3S1304 (P = 0.55).

	DISCUSSION

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 
The hMLH1 and hMSH2 DNA MMR genes are known to be implicated in human cancer, with colon cancer being the most well studied model. However, the information of the status of these two genes in lung cancer is limited. In this study, we have investigated the expression of the hMLH1 and hMSH2 DNA MMR genes in NSCLC lesions. The immunohistochemical analysis demonstrated that 59% of the examined tumors had reduced expression of hMLH1 and 58% had reduced expression of hMSH2, whereas 34% demonstrated reduction of expression in both of these genes (Fig. 3 ). It is of note that 82% of all examined lung tumors showed reduced expression of at least one of the two investigated genes. This is the first report on the protein expression levels of the above mentioned genes in NSCLC, and the results suggest a critical role for these DNA MMR genes in lung carcinogenesis.

It is of note that the reduction of expression of these two genes is associated with the histological subtypes; in adenocarcinomas hMSH2 expression was more frequently reduced than that of hMLH1, while the converse was observed in SqCCL (Fig. 2 ). Because both genes are considered to be inactivated in a two-hit model (4) , we investigated the relationship between MMR gene expression levels and allelic imbalance (LOH) on 3p and 2p chromosome arms, the locations of these genes. The results indicated that reduced hMLH1 expression correlated with LOH at the D3S1289 (3p21) locus (P = 0.00019). This suggests that loss of one allele of the hMLH1 gene may be one of the major genetic events involved in its inactivation. This may explain the finding that hMLH1 expression is more frequently reduced in SqCCL than in adenocarcinomas, because the former have demonstrated a greater incidence of LOH on chromosome 3p (29, 30 , 32) . Hypermethylation of the hMLH1 promoter has been demonstrated in human tumors (10, 11, 12, 13, 14) , and this most likely also contributes to changes in the gene’s expression. However, such analysis was not performed on this set of our samples and remains to be elucidated in future studies. The mutational analysis of the hMLH1 promoter region and the hot spot exons did not reveal any mutations, which is in agreement with previous reports (8 , 33) and suggests that mutations are unlikely to be a major cause of hMLH1 inactivation in lung carcinogenesis. A correlation was found between the reduced expression of hMLH1 and LOH at the D2S391 (2p16) locus, which may suggest that hMLH1 expression regulatory gene(s) are located in this region but further studies are required to clarify this aspect.

It is of particular note that an inverse relationship between LOH at the D3S1300 locus and hMSH2 expression was identified where hMSH2 reduced expression was more prevalent in samples retaining heterozygosity at this locus. This may imply the presence of a negative hMSH2 regulatory gene on 3p, suggestive of negative feedback mechanism; however, additional studies are required to elucidate the nature of this relationship. This inverse correlation provides a possible explanation for the lower incidence of reduced hMSH2 expression in SqCCL compared with adenocarcinomas (Fig. 2 ). This is possibly due to the relatively higher incidence of LOH on 3p found in SqCCL (29, 30 , 32) .

We found no association between hMSH2 expression and LOH at the D2S391 and D2S2259 (2p16) loci, which suggests that allelic loss at these loci is not the main event contributing to the reduction of hMSH2 expression in NSCLC. Our results indicated no mutations in the promoter and the hot spot exons of hMSH2, which is in agreement with previous reports (33, 34, 35) . Furthermore, no hypermethylation of hMSH2 promoter has been demonstrated in certain human tumors (13, 14, 15) , thus, inactivation of the hMSH2 gene may rely on alternative mechanisms involving changes in its upstream regulatory genes. Recent reports have revealed p53-binding sites on the hMSH2 promoter (36) and a possible hMSH2 expression regulatory role of p53 in leukemias (37) .

hMLH1 reduced expression correlated with both higher daily tobacco uptake and total tobacco exposure (pack-years), indicating that tobacco carcinogens are implicated in hMLH1 inactivation and, moreover, that they may have an additive effect. The lack of association with the current/former smoking status argues that smoking-related MMR inactivation may be irreversible and it is in agreement with the fact that smoking cessation does not reduce risk for lung cancer development in chronic smokers to the baseline of nonsmokers. Moreover, hMLH1 expression levels did not seem to differ between smokers and nonsmokers. Although only six nonsmokers were included in this study and a "passive smoker" status is difficult to assess, the above finding indicates that carcinogens apart from those found in tobacco may also affect hMLH1 expression. Reduced expression of hMLH1 in SqCCL correlated with nodal metastasis, suggesting that the hMLH1 gene may contribute to a more aggressive tumor phenotype in this histological subtype. Thus, hMLH1 expression may be a useful molecular marker for the clinician when developing a treatment regimen.

The comparative analysis of hMLH1 and hMSH2 expression in the tumors in this study did not reveal any associations between the expression of these two genes. Furthermore, tumor specimens with combined reduced expression of both hMLH1 and hMSH2 proteins did not correlate with any clinicopathological parameters. Thus, no complementary role of these two proteins was demonstrated. The frequencies of the reduced expression of these two genes are different in SqCCL and adenocarcinomas, and this may be due to the different incidence of LOH on chromosome 3p in these tumor subtypes. Also, smoking seems to affect hMLH1 but not hMSH2, whereas hMLH1, but not hMSH2, correlates with nodal metastasis in SqCCL. All of the above findings support distinct roles for the two genes in lung carcinogenesis. The results suggest that at least some of the environmental and endogenous factors involved in their inactivation pathway are different. Further investigation is required to elucidate the complete pathways of inactivation of these two genes in NSCLC and reveal additional factors implicated in their regulation.

	ACKNOWLEDGMENTS

 
We are indebted to all of the clinical staff at the Cardiothoracic Center of Broadgreen (Liverpool, Merseyside, United Kingdom) for access to their patients.

	FOOTNOTES

 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

¹ Supported by a research grant from the Roy Castle Lung Cancer Foundation (Liverpool, United Kingdom).

² To whom requests for reprints should be addressed, at Roy Castle International Centre for Lung Cancer Research, 200 London Road, Liverpool, Merseyside L3 9TA, United Kingdom. Phone: 44-151-794-8900; Fax: 44-151-794-8989; E-mail: J.K.Field{at}liv.ac.uk

³ The abbreviations used are: MMR, mismatch repair; NSCLC, non-small cell lung carcinoma; LOH, loss of heterozygosity; SqCCL, squamous cell carcinoma of the lung; HNPCC, hereditary non polyposis colorectal carcinoma; SSCP, single-strand conformational polymorphism; HA, heteroduplex analysis.

Received 12/10/99. Accepted 6/ 2/00.

	REFERENCES

Top ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

 

1. Loeb L. A. Cancer cells exhibit a mutator phenotype. Adv. Cancer Res., 72: 22-56, 1998.
2. Peltomaki P., de la Chapelle A. Mutations predisposing to hereditary nonpolyposis colorectal cancer. Adv. Cancer Res., 71: 93-119, 1997.[Medline]
3. Rhyu M. S. Molecular mechanisms underlying hereditary nonpolyposis colorectal carcinoma. J. Natl. Cancer Inst., 88: 240-251, 1996.[Abstract/Free Full Text]
4. Kolodner R. Biochemistry and genetics of eukaryotic mismatch repair. Genet. Dev., 10: 1433-1442, 1996.
5. Benachenhou N., Guiral S., Gorska-Flipot I., Michalski R., Labuda D., Sinnett D. Allelic losses and DNA methylation at DNA mismatch repair loci in sporadic colorectal cancer. Carcinogenesis (Lond.), 19: 1925-1929, 1998.[Abstract/Free Full Text]
6. Benachenhou N., Guiral S., Gorska-Flipot I., Labuda D., Sinnett D. Frequent allele loss of heterozygosity at the DNA mismatch-repair loci hMLH1 and hMSH3 in sporadic breast cancer. Br. J. Cancer, 79: 1012-1017, 1999.[Medline]
7. MacDonald G. A., Greenson J. K., Saito K., Cherian S. P., Appelman H. D., Boland C. R. Microsatellite instability and loss of heterozygosity at DNA mismatch repair gene loci occurs during hepatic carcinogenesis. Hepatology, 28: 90-97, 1998.[Medline]
8. Benachenhou N., Guiral S., Gorska-Flipot I., Labuda D., Sinnett D. High resolution deletion mapping reveals frequent allelic losses at the DNA mismatch repair loci hMLH1 and hMSH3 in non-small cell lung cancer. Int. J. Cancer, 77: 173-180, 1998.[Medline]
9. Wieland I., Ammermuller T., Bohm M., Totzeck B., Rajewsky M. F. Microsatellite instability and loss of heterozygosity at the hMLH1 locus on chromosome 3p21 occur in a subset of non-small cell lung carcinomas. Oncol. Res., 8: 1-5, 1996.[Medline]
10. Fleisher A. S., Esteller M., Wang S., Tamura G., Suzuki H., Yin J., Zou T. T., Abraham J. M., Kong D., Smolinski K. N., Shi Y. Q., Rhyu M. G., Powell S. M., James S. P., Wilson K. T., Herman J. G., Meltzer S. J. Hypermethylation of the hMLH1 gene promoter in human gastric cancers with microsatellite instability. Cancer Res., 59: 1090-1095, 1999.[Abstract/Free Full Text]
11. Simpkins S. B., Bocker T., Swisher E. M., Mutch D. G., Gersell D. J., Kovatich A. J., Palazzo J. P., Fishel R., Goodfellow P. J. MLH1 promoter methylation and gene silencing is the primary cause of microsatellite instability in sporadic endometrial cancers. Hum. Mol. Genet., 8: 661-666, 1999.[Abstract/Free Full Text]
12. Kane M. F., Loda M., Gaida G. M., Lipman J., Mishra R., Goldman H., Jessup J. M., Kolodner R. Methylation of the hMLH1 promoter correlates with lack of expression of hMLH1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res., 57: 808-811, 1997.[Abstract/Free Full Text]
13. Herman J. G., Umar A., Polyak K., Graff J. R., Ahuja N., Issa J. P. J., Markowitz S., Willson J. K. V., Hamilton S. R., Kinzler K. W., Kane M. F., Kolodner R. D., Vogelstein B., Kunkel T. A., Baylin S. B. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma. Proc. Natl. Acad. Sci. USA, 95: 6870-6875, 1998.[Abstract/Free Full Text]
14. Cunningham J. M., Christensen E. R., Tester D. J., Kim C. Y., Roche P. C., Burgart L. J., Thibodeau S. N. Hypermethylation of the hMLH1 promoter in colon cancer with microsatellite instability. Cancer Res., 58: 3455-3460, 1998.[Abstract/Free Full Text]
15. Esteller M., Levine R., Baylin S. B., Ellenson L. H., Herman J. G. MLH1 promoter hypermethylation is associated with the microsatellite instability phenotype in sporadic endometrial carcinomas. Oncogene, 16: 2413-2417, 1998.[Medline]
16. Thibodeau S. N., French A. J., Roche P. C., Cunningham J. M., Tester D. J., Lindor N. M., Moslein G., Baker S. M., Liskay R. M., Burgart L. J., Honchel R., Halling K. C. Altered expression of hMSH2 and hMLH1 in tumors with microsatellite instability and genetic alterations in mismatch repair genes. Cancer Res., 56: 4836-4840, 1996.[Abstract/Free Full Text]
17. Wei Q., Eicher S. A., Guan Y., Cheng L., Xu J., Young L. N., Saunders K. C., Jiang H., Hong W. K., Spitz M. R., Strom S. S. Reduced expression of hMLH1 and hGTBP2/hMSH6: a risk factor for head and neck cancer. Cancer Epidemiol. Biomark. Prev., 7: 309-314, 1998.[Abstract]
18. Wei Q., Bondy M. L., Mao L., Guan Y., Cheng L., Cunningham J., Fan Y., Bruner J. M., Yung W. K. A., Levin V. A., Kyritsis A. P. Reduced expression of mismatch repair genes measured by multiplex reverse transcription-polymerase chain reaction in human gliomas. Cancer Res., 57: 1673-1677, 1997.[Abstract/Free Full Text]
19. Soliman, A. S., Bondy, M. L., Guan, Y., El Badawi, S., Mokhtar, N., Bayomi, S., Raouf, A. A., Ismail, S., McPherson, R. S., Abdel Hakim, T. F., Beasley, R. P., Levin, B., and Wei, Q. Y. Reduced expression of mismatch repair genes in colorectal cancer patients in Egypt. Int. J. Oncol., 12: 1315–1319, 1998.
20. Shin K. H., Yang Y. M., Park J. G. Absence or decreased levels of the hMLH1 protein in human gastric carcinoma cell lines: implications of hMLH1 in alkylation tolerance. J. Cancer Res. Clin. Oncol., 124: 421-426, 1998.[Medline]
21. Mackay H. J., Cameron D., Rawhilly M., McKean M., Paul J., Kaye S. B., Brown R. Reduced MLH1 expression predicts disease free survival in breast cancer following primary chemotherapy. Br. J. Cancer, 80(Suppl.2): 13 1999.
22. Curia M. C., Palmirotta R., Aceto G., Messerini L., Veri M. C., Crognale S., Valanzano R., Ficari F., Fracasso P., Stigliano V., Tonelli F., Casale V., Guadagni F., Battista P., Mariani-Constantini R., Cama A. Unbalanced germ-line expression of hMLH1 and hMSH2 alleles in hereditary nonpolyposis colorectal cancer. Cancer Res., 59: 3570-3575, 1999.[Abstract/Free Full Text]
23. Zhang H., Richards B., Wilson T., Lloyd M., Cranston A., Thornburn A., Fishel R., Meuth M. Apoptosis induced by overexpression of hMSH2 or hMLH1. Cancer Res., 59: 3021-3027, 1999.[Abstract/Free Full Text]
24. Field J. K., Ross H., Liloglou T., Scott F., Prime W., Gosney J. R., Youngson J., Donnelly R. J. Molecular pathological mechanisms in NSCLC and the assessment of individuals with a high risk of developing lung cancer Martinet Y. Hirsch F. R. Martinet N. Vignaud J. M. Mulshine J. L. eds. . Clinical and Biological Basis of Lung Cancer Prevention, : 247-261, Birkhauser Verlag Basel 1998.
25. Sekido Y., Fong K. M., Minna J. D. Progress in understanding the molecular pathogenesis of human lung cancer. Biochim. Biophys. Acta–Rev. Cancer, 1378: F21-F59, 1998.[Medline]
26. Liloglou T., Ross H., Prime W., Donnelly R. J., Spandidos D. A., Gosney J. R., Field J. K. p53 gene aberrations in non-small-cell lung carcinomas from a smoking population. Br. J. Cancer, 75: 1119-1124, 1997.[Medline]
27. Neville E. M., Ellison G., Kiaris H., Stewart M., Spandidos D. A., Fox J. C., Field J. K. Detection of K-ras mutations in non-small cell lung carcinomas. Int. J. Oncol., 7: 511-514, 1995.
28. Neville E. M., Stewart M., Myskow M., Donelly R. J., Field J. K. Loss of heterozygosity at 9p23 defines a novel locus in non-small cell lung cancer. Oncogene, 11: 581-585, 1995.[Medline]
29. Neville E. M., Stewart M. P., Swift A., Liloglou T., Ross H., Gosney J. R., Donnelly R. J., Field J. K. Allelotype of non-small cell lung cancer. Int. J. Oncol., 9: 533-539, 1996.
30. Liloglou T., Maloney P., Xinarianos G., Fear S., Field J. K. Sensitivity and limitations of high throughput fluorescent microsatellite analysis for the detection of allelic imbalance. Application in lung tumours. Int. J. Oncol., 16: 5-14, 2000.[Medline]
31. Wijnen, J., Khan, P. M., Vasen, H., Menko, F., vanderKlift, H., vandenBroek, M., vanLeeuwen Cornelisse, I., Nagengast, F., Meijers Heijboer, E. J., Lindhout, D., Griffioen, G., Cats, A., Kleibeuker, J., Varesco, L., Bertario, L., Bisgaard, M. L., Mohr, J., Kolodner, R., and Fodde, R. Majority of hMLH1 mutations responsible for hereditary nonpolyposis colorectal cancer cluster at the exonic region 15–16. Am. J. Hum. Genet., 58: 300–307, 1996.
32. Tsuchiya E., Nakamura Y., Weng S. Y., Nakagawa K., Sugano H., Kitagawa T. Allelotype of non-small cell lung carcinoma—comparison between loss of heterozygosity in squamous cell carcinoma and adenocarcinoma. Cancer Res., 52: 2478-2481, 1992.[Abstract/Free Full Text]
33. Hatta Y., Wada M., Takeuchi S., Tasaka T., Lee E., Lee Y. Y., Kim B. K., Bang Y. J., Lee S., Yamada Y., Tomonaga M., Wilczynski S. P., Said J. W., Koeffler H. P. Mutational analysis of the hMSH2 gene in a wide variety of tumours. Int. J. Oncol., 11: 465-469, 1997.
34. Gotoh K., Yatabe Y., Sugiura T., Takagi K., Ogawa M., Takahashi T., Mitsudomi T. Frameshift mutations in TGFß RII, IGFIIR, BAX, hMSH3 and hMSH6 are absent in lung tumours. Carcinogenesis (Lond.), 20: 499-502, 1999.[Abstract/Free Full Text]
35. Anbazhagan R., Merlo A., Sidransky D., Gabrielson E. Absence of intragenic mismatch mutations in small cell lung cancers with microsatellite instability. Int. J. Cancer, 80: 944-945, 1999.[Medline]
36. Scherer S. J., Welter C., Zang K., Dooley S. Specific in vitro binding of p53 to the promoter region of the human mismatch repair gene hMSH2. Biochem. Biophys. Res. Commun., 221: 722-728, 1996.[Medline]
37. Zhu Y. M., DasGupta E. P., Russell N. H. Microsatellite instability and p53 mutations are associated with abnormal expression of the MSH2 gene in adult acute leukemia. Blood, 94: 733-740, 1999.[Abstract/Free Full Text]

This article has been cited by other articles:

				S. Landi, F. Gemignani, F. Canzian, V. Gaborieau, R. Barale, D. Landi, N. Szeszenia-Dabrowska, D. Zaridze, J. Lissowska, P. Rudnai, et al. DNA Repair and Cell Cycle Control Genes and the Risk of Young-Onset Lung Cancer. Cancer Res., November 15, 2006; 66(22): 11062 - 11069. [Abstract] [Full Text] [PDF]

				C. Y. Jung, J. E. Choi, J. M. Park, M. H. Chae, H.-G. Kang, K. M. Kim, S. J. Lee, W. K. Lee, S. Kam, S. I. Cha, et al. Polymorphisms in the hMSH2 Gene and the Risk of Primary Lung Cancer. Cancer Epidemiol. Biomarkers Prev., April 1, 2006; 15(4): 762 - 768. [Abstract] [Full Text] [PDF]

				H.-S. Hsu, C.-K. Wen, Y.-A. Tang, R.-K. Lin, W.-Y. Li, W.-H. Hsu, and Y.-C. Wang Promoter Hypermethylation Is the Predominant Mechanism in hMLH1 and hMSH2 Deregulation and Is a Poor Prognostic Factor in Nonsmoking Lung Cancer Clin. Cancer Res., August 1, 2005; 11(15): 5410 - 5416. [Abstract] [Full Text] [PDF]

				F. Chiappini, M. Gross-Goupil, R. Saffroy, D. Azoulay, J.-F. Emile, L.-A. Veillhan, V. Delvart, S. Chevalier, H. Bismuth, B. Debuire, et al. Microsatellite instability mutator phenotype in hepatocellular carcinoma in non-alcoholic and non-virally infected normal livers Carcinogenesis, April 1, 2004; 25(4): 541 - 547. [Abstract] [Full Text] [PDF]

				T. J. Koh, J. K. Field, A. Varro, T. Liloglou, P. Fielding, G. Cui, J. Houghton, G. J. Dockray, and T. C. Wang Glycine-Extended Gastrin Promotes the Growth of Lung Cancer Cancer Res., January 1, 2004; 64(1): 196 - 201. [Abstract] [Full Text] [PDF]

				P. Peltomaki Role of DNA Mismatch Repair Defects in the Pathogenesis of Human Cancer J. Clin. Oncol., March 15, 2003; 21(6): 1174 - 1179. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Xinarianos, G. Articles by Field, J. K. Search for Related Content PubMed PubMed Citation Articles by Xinarianos, G. Articles by Field, J. K.