| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Tumor Biology |
Department of Pathology, Baylor College of Medicine and Department of Veterans Affairs Medical Center, Houston, Texas 77030 [F. R., D. G., B. K- A., M. I.], and Department of Microbiology, New York University School of Medicine, New York, New York 10016 [A. M.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The FGFs are mitogenic for a many cell types, both epithelial and mesenchymal. In addition, FGFs have a variety of other biological activities. Some FGFs, like FGF2, have potent angiogenic activity and have been implicated as promoters of tumor angiogenesis (3 , 4) . FGFs have also been shown to increase the motility and invasiveness of a variety of cell types including prostatic epithelial cells (3 , 5, 6, 7) . Finally, it has been shown that FGFs can inhibit apoptosis in the appropriate context (8) . Thus, FGFs have a broad range of biological activities that can play an important role in tumorigenesis.
We have shown previously that FGF2, FGF7, and FGF9 are present in high concentrations in normal human prostate (9, 10, 11) . They are produced by prostatic stromal cells and can act as paracrine growth factors for prostatic epithelial cells and, except for FGF7, as autocrine growth factors for stromal cells. Thus, FGFs are important growth factors for maintenance of the normal prostate in vivo.
Evidence for the importance of FGFs in prostate cancer comes from studies of the Dunning rat model system. Yan et al. (12) have shown that as these transplantable tumors progress from a mixed stromal-epithelial phenotype to a stromal independent phenotype, expression of FGFs not originally present in the tumors (such as FGF3 and FGF5) occurs, and there are changes in the isoforms of FGFRs expressed, consistent with autocrine stimulation of growth. We therefore sought to determine whether a similar autocrine production of FGFs occurs in human prostate cancers.
We have found that approximately half of human prostate cancers contain increased amounts of FGF6, and, in the majority of such cases, FGF6 is expressed in the cancer cells. In PIN, the precursor lesion for prostate cancer, the prostatic basal cells express a markedly increased level of FGF6. The biological importance of this overexpression is shown by our finding that FGF6 is a potent growth factor for normal and neoplastic prostatic epithelial cells in culture. Thus, FGF6 may play an important role as both a paracrine and an autocrine growth factor in the initiation and progression of human prostate cancer.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
RNA Extraction, RT-PCR, and Northern Blotting.
RNAs were extracted from tissues and cultured cells using the guanidine
isothiocyanate procedure, and reverse transcription was performed as
described previously using 2 µg of total RNA (9)
. The
cDNA product, corresponding to 0.1 µg of total RNA, was used for PCR
amplification as described previously. Primers for FGF6 were
CACGAGGAGAACCCCTACA (forward primer, exon 1) and TCCCTTGGTACAAGTCTGA
(reverse primer, exon 3). Positive control for FGF6 was skeletal muscle
mRNA from Clontech Laboratories, Inc. (Palo Alto, CA). FGFR-4 primers
were CTTGACCTCCAGCAACGATGA (forward primer) and
GCACATCTAGCAGGTAGTTATAGCGG (reverse primer). For each set of PCR
reactions, a control in which water was added rather than cDNA was
included, and this reaction was uniformly negative. FGF3 and FGF4
primers, Southern blotting of PCR products, Northern blotting, and
specific probes for FGF3, FGF4, and FGF6 were as described previously
(9)
. The FGFR-4 probe was a 600-bp BamHI
fragment from the 3' end of the human FGFR-4 plasmid SV2SE
(13)
. This probe consists primarily of a 3' untranslated
sequence to eliminate cross-hybridization with other FGFR transcripts.
Cell Proliferation Assays.
Primary epithelial cell cultures were established using prostatic
tissue samples from areas in the peripheral zone of radical
prostatectomy specimens that were free from carcinoma. Primary
epithelial cells were plated on collagen-coated 35-mm dishes at
5 x 104
cells/dish in complete
epithelial growth medium that includes bovine pituitary extract (a
source of FGFs), EGF, insulin, dexamethasone, cholera toxin, and BSA,
as described previously (9)
. We have previously shown such
cultures to be of prostatic epithelial origin by immunohistochemistry
(9)
. The next day, medium was changed to epithelial growth
medium without bovine pituitary extract or EGF. Cells were kept in this
incomplete medium as controls or were supplemented with 10 ng/ml
recombinant FGF6 (R&D Systems, Minneapolis, MN). Cells were then
trypsinized and counted using a Coulter counter at 2-day intervals.
Prostate cancer cell lines (DU145, PC3, and LNCaP) were maintained in RPMI 1640 with 10% FCS. Cells were plated at 5 x 104 cells/35-mm dish, and the next day, cells were refed with 0.2% FCS with or without 10 ng/ml FGF6. Cells were counted at 2 or 4 days after growth factor addition. PNT1A, an immortalized normal prostatic epithelial cell line (14) , was maintained in RPMI 1640 containing 5% FCS. Cell were plated at 2.5 x 104 cells/35-mm dish and refed the next day with RPMI 1640 supplemented with 1% ITS (insulin, transferrin, and selenium; Sigma, St. Louis, MO) with or without 10 ng/ml FGF6. Cells were then counted on days 3 and 5.
Preparation of Cell Extracts.
Prostatic tissue samples were weighed, pulverized in liquid nitrogen,
and then homogenized by three strokes (each for 10 s) on ice in a
lysis buffer, as described previously (10)
, using 0.5 ml
lysis buffer/200 mg tissue. The homogenate was then incubated
for 30 min on ice, and insoluble material was removed by centrifugation
for 1 min in a microcentrifuge at 4°C.
Immunohistochemistry.
Frozen tissue sections were fixed in acetone for 10 min, postfixed in
methanol for an additional minute, and stored at -80°C.
Immunohistochemical localization of FGF6 was carried out by the
avidin-biotin complex method as described previously (10)
.
All sections were treated with Autoblocker (R&D Systems) to inhibit
endogenous peroxidase and avidin/biotin (Vector Laboratories,
Burlingame, CA) to block endogenous biotin. The sections were incubated
with rabbit polyclonal anti-FGF6 antibody (200 ng/ml; R&D Systems) at
4°C for 12 h. After liberal washing with PBS (pH 7.4), sections
were incubated with the appropriate biotinylated secondary antibody at
a 1:200 dilution (Vector Laboratories). Sections were then washed with
PBS containing 0.1% Tween 20 and incubated with avidin-biotin complex
(Vectastain Elite; Vector Laboratories) for 15 min. The
antigen-antibody reaction was demonstrated using diaminobenzidine as a
substrate, and the sections were then counterstained with hematoxylin.
Staining of the cancer cells was graded as 1+ (weak), 2+ (moderate), or
3+ (strong). The specificity of staining was confirmed by preincubation
of a 1 µg/ml solution of anti-FGF6 antibody with an equal volume of
recombinant FGF6 at 10 µg/ml for 1 h at room temperature before
immunohistochemistry. This pretreatment completely abolished
immunostaining for this antibody.
ELISA of FGF6 Concentration.
Each well of a 96-well plate was coated with 100 µl of a solution of
anti-FGF6 monoclonal antibody (MAB 238; R&D Systems) at a concentration
of 4 µg/ml overnight at room temperature in a sealed bag. The next
day, wells were washed three times with PBS containing 0.05% Tween 20
and incubated overnight at 4°C with 300 µl of a blocking solution
(Kirkegaard and Perry Laboratories, Gaithersburg, MD). The plate
was then washed as described above, and standards and samples were
added (100 µl/well). Samples were 100 µl of pure tissue extract.
Wells were then incubated for 3 h at room temperature. After
washing as described above, biotinylated polyclonal anti-FGF6 antibody
(BAF 238; R&D Systems) was added at a concentration of 400 ng/ml
for 2 h at room temperature. After washing as described above,
detection was carried out by adding 100 µl/well of a 1:4000 dilution
of streptavidin/horseradish peroxidase (Zymed, San Francisco, CA) and
incubating for 20 min at room temperature. Wells were washed and
incubated with a substrate consisting of a 1:1 solution of
H2O2 and
tetramethylbenzidine (Sigma) at a concentration of 0.1 mg/ml. Stop
solution (H2SO4) was added
within 30 min, and absorbance at 450 nm was determined using an ELISA
plate reader. The sensitivity of this ELISA was found to be less than 1
pg/ml. No cross-reactivity with FGF2, FGF7, and FGF9 was detected when
these growth factors were added at 10 ng/well.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
) and no FGF6 was detected in the control normal prostate tissue. No
expression of FGF3 or FGF4 was seen (data not shown). Overall, 14 of 26
prostate cancers had detectable FGF6 mRNA by this RT-PCR analysis.
|
the normal control tissues did not express detectable quantities of
FGF6, whereas 15 of 24 prostate cancers contained between 0.5 and 2.6
ng FGF6/g tissue. No correlation between FGF6 content and
differentiation, as determined by the Gleason score or clinical or
pathological stage, was apparent, but the number of cases is small, and
more extensive analysis will need to be performed to definitively
determine whether FGF6 expression is correlated with clinical or
pathological parameters. We also detected between 0.4 and 0.9 ng FGF6/g
tissue in four of nine high-grade PIN lesions. Thus, we found
expression of FGF6 protein in approximately one-half of PIN lesions and
invasive prostate carcinomas, which is similar to the percentage of
prostate cancers expressing FGF6 mRNA by RT-PCR analysis.
|
, in the normal peripheral zone, weak staining of the basal cell layer
was detectable (Fig. 3A
). In one sample, we also found
staining of skeletal muscle fibers (data not shown). It is well known
that occasional skeletal muscle fibers can be found in normal prostate,
and FGF6 has previously been shown to be expressed by skeletal muscle
at other sites (15)
; therefore, the positive staining
observed is consistent with prior observations. In the high-grade PIN
lesions, we found a marked increase in the staining of the basal cells
in the dysplastic acini (Fig. 3 and C
). This
staining was distinctly stronger than that seen in adjacent, normal
acini in the same section. Preincubation of the anti-FGF6 antibody with
excess recombinant FGF6 completely abolished immunostaining (Fig. 3D
). A total of 10 carcinomas with detectable FGF6 by ELISA
were examined by immunohistochemistry. In eight of these carcinomas,
staining of the cytoplasm of the cancer cells was identified. This
staining varied from light but diffuse (1+) to intense and diffuse
(3+). The single case with 1+ staining was derived from a metastatic
cancer to a pelvic lymph node that was >90% cancer on frozen section
and contained 2.6 ng FGF6/g tissue by ELISA. In six of eight cases,
there was 2+ staining for FGF6, characterized by variable weak to
intense staining of the tumor cytoplasm. Finally, a single case of 3+
staining with uniform intense staining of the prostate cancer
epithelial cells was found (Fig. 3E
). In two prostate
cancers, there was no staining of the cancer epithelial cells, but
staining of stromal cells with fibroblastic morphology was seen (Fig. 3F
).
|
, FGF6 was mitogenic for both primary cultures of prostatic
epithelial and stromal cells. The differences seen are highly
statistically significant (P < 0.001,
t test) at 4 and 6 days of treatment for both epithelial and
stromal cells. Similar results were seen with PNT1A cells, a cell line
derived from normal prostatic epithelial cells immortalized by SV40
large T antigen (Fig. 4B
). In addition, a marked
proliferative response to exogenous FGF6 was also seen in the prostate
cancer cell lines DU145 and LNCaP, which was again highly statistically
significant by day 4 of treatment (P < 0.001, t test). The PC3 prostate cancer cell line had only a
slight (but statistically significant) proliferative response to FGF6.
Thus, with the exception of PC3 cells, the normal and transformed
prostatic epithelial cells tested showed a marked proliferative
response to exogenous FGF6.
|
, all four prostate samples and the prostate and breast
cancer cell lines express FGFR-4. A control in which genomic DNA was
added results in a larger 1.2-kb product, confirming that the primers
span an intron and the product seen in the RT-PCR reactions is not due
to genomic DNA contamination. To determine the site of FGFR-4
expression in normal prostate, RNAs from primary cultures of prostatic
epithelial and stromal cells were analyzed by RT-PCR. As seen in Fig. 5B
, both epithelial and stromal cells express FGFR-4.
Northern blotting using 1 µg of polyadenylated RNA from the three
prostate cancer cell lines and the immortalized normal prostatic
epithelial cell line PNT1A reveals a low but detectable expression
FGFR-4 in all four cell lines, with PC3 cells having the lowest FGFR-4
expression (Fig. 6
).
|
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In the prostate cancer tissues, we have shown increased expression of both FGF6 mRNA and protein. In most cases, FGF6 was localized in the cancer cells by immunohistochemistry, consistent with an autocrine growth stimulation. In two cases, we observed immunoreactive FGF6 primarily in fibroblastic cells, consistent with the induction of FGF6 production by these cells with potential paracrine effects on adjacent cancer cells. A similar mixture of overexpression by both epithelial and stromal cells has been described by Kornmann et al. (19) for the increased expression of FGF5 seen in pancreatic cancer; therefore, this observation is not without precedent. Thus, in prostate cancers, FGF6 that is normally secreted by the basal cells is no longer available as a paracrine growth factor, and in many cases, the cancers appear to have developed mechanisms to compensate for this loss either by autocrine production of FGF6 or by inducing adjacent stromal cells to produce it and, in fact, produce it in larger amounts than in normal tissues. The potential biological importance of the FGF6 overexpression observed is shown by the ability of exogenous FGF6 to promote proliferation of normal, immortalized, and fully transformed prostatic epithelial cells. In addition, by promoting the growth of stromal cells, FGF6 may enhance the production of paracrine growth factors by tumor stroma (20) , which can further promote tumor progression.
FGF6 is normally expressed in the skeletal muscle and may play an important role as a growth factor in that tissue. Studies by Penault-Llorca et al. (21) have shown expression of FGF6 in 3 of 10 breast cancer cell lines and in 15% of primary breast cancer tissues. No FGF6 expression was detected in normal breast tissue. These same authors detected overexpression of FGFR-4 in 32% of primary breast cancers. Expression of FGFR-4 has been shown by others to be present in the majority of breast cancer cell lines (16 , 17) . Given that FGFR-4 is the most potent receptor for FGF6 (2) , a potential autocrine loop involving FGF6 and FGFR-4 may be established in a subset of breast cancers. We have also found expression of FGFR-4 in all three prostate cancer cell lines and in primary prostate epithelial cultures. It should be noted that this expression is relatively low, and we did not detect it previously in the normal prostate (9) ; however, using improved PCR primers allowed us to detect this expression. Chandler et al. (16) have also reported expression of FGFR-4 in DU145 cells using a RNase protection assay, which is consistent with our results, but they found barely detectable expression of FGFR-4 in PC3 cells, whereas we found FGFR-4 expression that was lower than but similar to that seen in DU145 cells. Whether this difference reflects the use of different probes and methods for RNA analysis or differences in the PC3 cells between different laboratories is not clear. It is of interest to note that both prostate (22, 23, 24) and breast cancers (25) have been reported to have increased expression of FGF8, a potent activator of FGFR-4. Thus, in both breast and prostate cancer, there is evidence that autocrine stimulation of FGFR-4 by FGF6 and FGF8 may occur. It is known that the signaling properties of FGFR-4 differ from those of the other FGFRs (26, 27, 28, 29) in that FGFR-4 only weakly stimulates mitogen-activated protein kinase activation (27) and is associated with a unique Mr 85,000 serine kinase (27 , 28) that may be important in FGFR-4 signaling. Johnston et al. (29) have shown that FGFR-4 is the only FGFR that can promote membrane ruffling when tranfected into COS-7 cells. Such membrane ruffling is associated with changes in the actin cytoskeleton related to increased motility. Thus, FGFR-4 activation by autocrine stimulation may be more important in altering motility or other properties when compared with similar stimulation of other FGFRs and may therefore play a unique role in tumor progression.
In addition to FGFR-4, other FGFR isoforms that can respond to FGF6, such as FGFR-1 IIIc and FGFR-2 IIIc (2) are also expressed in prostate cancer cells. We have shown that expression of FGFR-1 is increased, particularly in poorly differentiated prostate cancers (20) , and we have recently found that FGFR-1 is present only as the IIIc isoform in prostate cancers.4 FGFR-1 IIIc could markedly enhance response to FGF6 in those cases where it is expressed. Similarly, there is evidence that the DU145 prostate cancer cell line and some prostate cancer xenografts express the FGFR-2 IIIc isoform (30) that can bind FGF6. However, FGFR-1 IIIc and FGFR-2 IIIc are not expressed in cultured primary prostatic epithelial cells (9) ; therefore, in normal prostatic epithelial cells, most of the mitogenic effect of FGF6 must be through activation of FGFR-4. Additional studies are needed to define the expression of the various FGFR isoforms that bind FGF6 in prostate cancer cells in vivo and the relative importance of each of these receptors in the biological response of prostate cancer cells to FGF6.
In summary, we have found that FGF6 is expressed by normal prostatic
basal cells in extremely small amounts, and expression in basal cells
is markedly increased in PIN lesions. Approximately half of prostate
cancers express FGF6 in the cancer cell themselves or in the tumor
stroma. The acquisition of FGF6 expression by the prostate cancers
implies but does not prove that it may play a role in cancer cell
proliferation or perhaps in other aspects of tumor progression. Other
FGFs, such as FGF2 (20)
and FGF8 (22, 23, 24)
,
have also been shown to be increased in prostate cancer, and a number
of other growth factors, including EGF and transforming growth factor
(31)
, have also been implicated in prostate cancer.
The relative importance of each of these growth factors in prostate
cancer progression has yet to be elucidated. Further work will be
needed to define the role of the increased expression of FGF6 in human
prostate cancer.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 Supported by Department of Veterans Affairs
Merit Review funding. 
2 To whom requests for reprints should be
addressed, at Research Service, Houston Veterans Affairs Medical
Center, 2002 Holcombe Boulevard, Houston, TX 77030. Phone:
(713) 791-1414, ext. 4008; Fax: (713) 794-7938; E-mail: mittmann{at}bcm.tmc.edu
3 The abbreviations used are: FGF, fibroblast
growth factor; FGFR, FGF receptor; RT-PCR, reverse transcription-PCR;
PIN, prostatic intraepithelial neoplasia; EGF, epidermal growth
factor.
Received 11/ 5/99. Accepted 6/ 2/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  L. M. Cotton, M. K. O'Bryan, and B. T. Hinton Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction Endocr. Rev., April 1, 2008; 29(2): 193 - 216. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Lin, G. Liu, Y. Zhang, Y.-P. Hu, K. Yu, C. Lin, K. McKeehan, J. W. Xuan, D. M. Ornitz, M. M. Shen, et al. Fibroblast growth factor receptor 2 tyrosine kinase is required for prostatic morphogenesis and the acquisition of strict androgen dependency for adult tissue homeostasis Development, February 15, 2007; 134(4): 723 - 734. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D M Peehl Primary cell cultures as models of prostate cancer development Endocr. Relat. Cancer, March 1, 2005; 12(1): 19 - 47. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B Kwabi-Addo, M Ozen, and M Ittmann The role of fibroblast growth factors and their receptors in prostate cancer Endocr. Relat. Cancer, December 1, 2004; 11(4): 709 - 724. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, D. W. Stockton, and M. Ittmann The Fibroblast Growth Factor Receptor-4 Arg388 Allele Is Associated with Prostate Cancer Initiation and Progression Clin. Cancer Res., September 15, 2004; 10(18): 6169 - 6178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Kwabi-Addo, J. Wang, H. Erdem, A. Vaid, P. Castro, G. Ayala, and M. Ittmann The Expression of Sprouty1, an Inhibitor of Fibroblast Growth Factor Signal Transduction, Is Decreased in Human Prostate Cancer Cancer Res., July 15, 2004; 64(14): 4728 - 4735. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Polnaszek, B. Kwabi-Addo, L. E. Peterson, M. Ozen, N. M. Greenberg, S. Ortega, C. Basilico, and M. Ittmann Fibroblast Growth Factor 2 Promotes Tumor Progression in an Autochthonous Mouse Model of Prostate Cancer Cancer Res., September 15, 2003; 63(18): 5754 - 5760. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. L. Weber and M. C. Gebhardt What's New in Musculoskeletal Oncology J. Bone Joint Surg. Am., March 31, 2003; 85(4): 761 - 767. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Ozen, D. Giri, F. Ropiquet, A. Mansukhani, and M. Ittmann Role of Fibroblast Growth Factor Receptor Signaling in Prostate Cancer Cell Survival J Natl Cancer Inst, December 5, 2001; 93(23): 1783 - 1790. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
