
[Cancer Research 60, 4245-4250, August 1, 2000]
© 2000 American Association for Cancer Research
Increased Expression of Fibroblast Growth Factor 6 in Human Prostatic Intraepithelial Neoplasia and Prostate Cancer1
Frederic Ropiquet,
Dipak Giri,
Bernard Kwabi-Addo,
Alka Mansukhani and
Michael Ittmann2
Department of Pathology, Baylor College of Medicine and Department of Veterans Affairs Medical Center, Houston, Texas 77030 [F. R., D. G., B. K- A., M. I.], and Department of Microbiology, New York University School of Medicine, New York, New York 10016 [A. M.]
 |
ABSTRACT
|
|---|
Fibroblast growth factors (FGFs) are known to play an important role in
the growth of normal prostatic epithelial cells. In addition to their
effects on proliferation, FGFs can promote cell motility, increase
tumor angiogenesis, and inhibit apoptosis, all of which play an
important role in tumor progression. To determine whether FGFs are
overexpressed in human prostate cancers, we analyzed 26 prostate cancer
RNAs by reverse transcription-PCR for expression of FGF3, FGF4, and
FGF6, which cannot be detected in normal prostate tissue by this
technique. Fourteen of 26 prostate cancers expressed FGF6 mRNA. No
expression of FGF3 or FGF4 was detected. An ELISA of tissue extracts of
normal prostate, high-grade prostatic intraepithelial neoplasia (PIN),
and prostate cancer for FGF6 showed that this growth factor was
undetectable in normal prostate but was present at elevated levels in 4
of 9 PIN lesions and in 15 of 24 prostate cancers. Immunohistochemical
analysis with anti-FGF6 antibody revealed weak staining of prostatic
basal cells in normal prostate that was markedly elevated in PIN. In
the prostate cancers, the majority of cases revealed expression of FGF6
by the prostate cancer cells themselves. In two cases, expression was
present in prostatic stromal cells. Exogenous FGF6 was able to
stimulate proliferation of primary prostatic epithelial and stromal
cells, immortalized prostatic epithelial cells, and prostate cancer
cell lines in tissue culture. FGF receptor 4, which is the most potent
FGF receptor for FGF6, is expressed in the human prostate in
vivo and in all of the cultured cell lines. Thus, FGF6 is
increased in PIN and prostate cancer and can promote the proliferation
of the transformed prostatic epithelial cells via paracrine and
autocrine mechanisms.
 |
INTRODUCTION
|
|---|
The
FGF3
gene family consists of at least 19 different genes encoding
related polypeptide mitogens. These growth factors interact with a
family of four distinct, high-affinity tyrosine kinase receptors
designated FGFRs 14 (for review, see Ref. 1
). These
receptors consist of an extracellular portion containing three
immunoglobulin-like domains and an intracellular tyrosine kinase domain
and have variable affinities for the different FGFs. In addition, FGFRs
13 all undergo an alternative splicing event in which two alternative
exons (IIIb and IIIc) can be used to encode the COOH-terminal portion
of the third immunoglobulin-like loop, which results in receptor
isoforms with dramatically altered binding specificity. Considerable
progress has been made in defining the relative affinities of FGFs 19
for the various receptors and their isoforms (2)
, although
much less is known about FGFs 1019.
The FGFs are mitogenic for a many cell types, both epithelial and
mesenchymal. In addition, FGFs have a variety of other biological
activities. Some FGFs, like FGF2, have potent angiogenic activity and
have been implicated as promoters of tumor angiogenesis (3
, 4)
. FGFs have also been shown to increase the motility and
invasiveness of a variety of cell types including prostatic epithelial
cells (3
, 5, 6, 7)
. Finally, it has been shown that FGFs can
inhibit apoptosis in the appropriate context (8)
. Thus,
FGFs have a broad range of biological activities that can play an
important role in tumorigenesis.
We have shown previously that FGF2, FGF7, and FGF9 are present in high
concentrations in normal human prostate (9, 10, 11)
. They are
produced by prostatic stromal cells and can act as paracrine growth
factors for prostatic epithelial cells and, except for FGF7, as
autocrine growth factors for stromal cells. Thus, FGFs are important
growth factors for maintenance of the normal prostate in
vivo.
Evidence for the importance of FGFs in prostate cancer comes from
studies of the Dunning rat model system. Yan et al.
(12)
have shown that as these transplantable tumors
progress from a mixed stromal-epithelial phenotype to a stromal
independent phenotype, expression of FGFs not originally present in the
tumors (such as FGF3 and FGF5) occurs, and there are changes in the
isoforms of FGFRs expressed, consistent with autocrine stimulation of
growth. We therefore sought to determine whether a similar autocrine
production of FGFs occurs in human prostate cancers.
We have found that approximately half of human prostate cancers contain
increased amounts of FGF6, and, in the majority of such cases, FGF6 is
expressed in the cancer cells. In PIN, the precursor lesion for
prostate cancer, the prostatic basal cells express a markedly increased
level of FGF6. The biological importance of this overexpression is
shown by our finding that FGF6 is a potent growth factor for normal and
neoplastic prostatic epithelial cells in culture. Thus, FGF6 may play
an important role as both a paracrine and an autocrine growth factor in
the initiation and progression of human prostate cancer.
 |
MATERIALS AND METHODS
|
|---|
Tissue Acquisition and Analysis.
Prostate cancer tissues and samples of the uninvolved peripheral and
transitional zone of the prostate were taken from radical
prostatectomies performed for treatment of clinical stage T1cN0 or T2N0
prostate cancer. Tissues were received fresh, and portions were
snap-frozen in liquid nitrogen or used to establish primary cell
cultures (see below). Additional cancer tissues were obtained from
three transurethral resections of prostate performed to treat
obstruction in advanced prostate cancer and from a pelvic lymph node
metastasis. The frozen tissues were then analyzed by frozen section to
confirm the presence or absence of carcinoma or high-grade PIN, and, if
present, the percentage of the tissue involved in these processes. The
carcinoma tissues contained 3080% cancer, and tissues with PIN
contained 3050% PIN. To obtain nine tissues with such extensive
high-grade PIN, it was necessary to select tissues from over 800 frozen
sections performed previously on prostate tissues harvested from
radical prostatectomies and, in some cases, to microdissect the tissue
to enrich for PIN. All normal peripheral and transition zone tissues
were free of cancer and PIN. Additional frozen sections were prepared
for immunohistochemistry in some cases, and the remaining tissue was
used to prepare cell extracts or RNA.
RNA Extraction, RT-PCR, and Northern Blotting.
RNAs were extracted from tissues and cultured cells using the guanidine
isothiocyanate procedure, and reverse transcription was performed as
described previously using 2 µg of total RNA (9)
. The
cDNA product, corresponding to 0.1 µg of total RNA, was used for PCR
amplification as described previously. Primers for FGF6 were
CACGAGGAGAACCCCTACA (forward primer, exon 1) and TCCCTTGGTACAAGTCTGA
(reverse primer, exon 3). Positive control for FGF6 was skeletal muscle
mRNA from Clontech Laboratories, Inc. (Palo Alto, CA). FGFR-4 primers
were CTTGACCTCCAGCAACGATGA (forward primer) and
GCACATCTAGCAGGTAGTTATAGCGG (reverse primer). For each set of PCR
reactions, a control in which water was added rather than cDNA was
included, and this reaction was uniformly negative. FGF3 and FGF4
primers, Southern blotting of PCR products, Northern blotting, and
specific probes for FGF3, FGF4, and FGF6 were as described previously
(9)
. The FGFR-4 probe was a 600-bp BamHI
fragment from the 3' end of the human FGFR-4 plasmid SV2SE
(13)
. This probe consists primarily of a 3' untranslated
sequence to eliminate cross-hybridization with other FGFR transcripts.
Cell Proliferation Assays.
Primary epithelial cell cultures were established using prostatic
tissue samples from areas in the peripheral zone of radical
prostatectomy specimens that were free from carcinoma. Primary
epithelial cells were plated on collagen-coated 35-mm dishes at
5 x 104
cells/dish in complete
epithelial growth medium that includes bovine pituitary extract (a
source of FGFs), EGF, insulin, dexamethasone, cholera toxin, and BSA,
as described previously (9)
. We have previously shown such
cultures to be of prostatic epithelial origin by immunohistochemistry
(9)
. The next day, medium was changed to epithelial growth
medium without bovine pituitary extract or EGF. Cells were kept in this
incomplete medium as controls or were supplemented with 10 ng/ml
recombinant FGF6 (R&D Systems, Minneapolis, MN). Cells were then
trypsinized and counted using a Coulter counter at 2-day intervals.
Prostate cancer cell lines (DU145, PC3, and LNCaP) were maintained in
RPMI 1640 with 10% FCS. Cells were plated at 5 x 104
cells/35-mm dish, and the next day, cells
were refed with 0.2% FCS with or without 10 ng/ml FGF6. Cells were
counted at 2 or 4 days after growth factor addition. PNT1A, an
immortalized normal prostatic epithelial cell line (14)
,
was maintained in RPMI 1640 containing 5% FCS. Cell were plated at
2.5 x 104
cells/35-mm dish and
refed the next day with RPMI 1640 supplemented with 1% ITS (insulin,
transferrin, and selenium; Sigma, St. Louis, MO) with or without 10
ng/ml FGF6. Cells were then counted on days 3 and 5.
Preparation of Cell Extracts.
Prostatic tissue samples were weighed, pulverized in liquid nitrogen,
and then homogenized by three strokes (each for 10 s) on ice in a
lysis buffer, as described previously (10)
, using 0.5 ml
lysis buffer/200 mg tissue. The homogenate was then incubated
for 30 min on ice, and insoluble material was removed by centrifugation
for 1 min in a microcentrifuge at 4°C.
Immunohistochemistry.
Frozen tissue sections were fixed in acetone for 10 min, postfixed in
methanol for an additional minute, and stored at -80°C.
Immunohistochemical localization of FGF6 was carried out by the
avidin-biotin complex method as described previously (10)
.
All sections were treated with Autoblocker (R&D Systems) to inhibit
endogenous peroxidase and avidin/biotin (Vector Laboratories,
Burlingame, CA) to block endogenous biotin. The sections were incubated
with rabbit polyclonal anti-FGF6 antibody (200 ng/ml; R&D Systems) at
4°C for 12 h. After liberal washing with PBS (pH 7.4), sections
were incubated with the appropriate biotinylated secondary antibody at
a 1:200 dilution (Vector Laboratories). Sections were then washed with
PBS containing 0.1% Tween 20 and incubated with avidin-biotin complex
(Vectastain Elite; Vector Laboratories) for 15 min. The
antigen-antibody reaction was demonstrated using diaminobenzidine as a
substrate, and the sections were then counterstained with hematoxylin.
Staining of the cancer cells was graded as 1+ (weak), 2+ (moderate), or
3+ (strong). The specificity of staining was confirmed by preincubation
of a 1 µg/ml solution of anti-FGF6 antibody with an equal volume of
recombinant FGF6 at 10 µg/ml for 1 h at room temperature before
immunohistochemistry. This pretreatment completely abolished
immunostaining for this antibody.
ELISA of FGF6 Concentration.
Each well of a 96-well plate was coated with 100 µl of a solution of
anti-FGF6 monoclonal antibody (MAB 238; R&D Systems) at a concentration
of 4 µg/ml overnight at room temperature in a sealed bag. The next
day, wells were washed three times with PBS containing 0.05% Tween 20
and incubated overnight at 4°C with 300 µl of a blocking solution
(Kirkegaard and Perry Laboratories, Gaithersburg, MD). The plate
was then washed as described above, and standards and samples were
added (100 µl/well). Samples were 100 µl of pure tissue extract.
Wells were then incubated for 3 h at room temperature. After
washing as described above, biotinylated polyclonal anti-FGF6 antibody
(BAF 238; R&D Systems) was added at a concentration of 400 ng/ml
for 2 h at room temperature. After washing as described above,
detection was carried out by adding 100 µl/well of a 1:4000 dilution
of streptavidin/horseradish peroxidase (Zymed, San Francisco, CA) and
incubating for 20 min at room temperature. Wells were washed and
incubated with a substrate consisting of a 1:1 solution of
H2O2 and
tetramethylbenzidine (Sigma) at a concentration of 0.1 mg/ml. Stop
solution (H2SO4) was added
within 30 min, and absorbance at 450 nm was determined using an ELISA
plate reader. The sensitivity of this ELISA was found to be less than 1
pg/ml. No cross-reactivity with FGF2, FGF7, and FGF9 was detected when
these growth factors were added at 10 ng/well.
 |
RESULTS
|
|---|
RT-PCR Analysis of FGF6 Expression in Prostate Cancers.
Our initial goal was to screen prostate cancer RNAs for expression of
FGF RNAs that were not expressed by normal prostate. To maximize the
sensitivity and specificity of this screening, we analyzed the prostate
cancer RNAs by RT-PCR using primers for FGFs 19 followed by Southern
blotting of the PCR products and hybridization with a probe
corresponding to the specific product of RT-PCR reaction. Using this
extremely sensitive technique, FGFs 1, 2, 5, 7, 8, and 9 gave
detectable bands in normal tissues (data not shown) and thus were not
useful for this qualitative study to determine whether new FGFs were
expressed in the prostate cancer tissues. However, no expression of
FGFs 3, 4, or 6 was detected by this technique in RNA from the normal
peripheral zone. To determine whether these FGFs are expressed in human
prostate cancers, we analyzed a total of 26 clinically localized
prostate cancer RNAs from tissues containing 3080% carcinoma on
frozen section by RT-PCR followed by Southern blotting of the PCR
products. Expression of FGF6 mRNA was detectable in variable amounts in
a subset of prostate cancers (Fig. 1
) and no FGF6 was detected in the control normal prostate tissue. No
expression of FGF3 or FGF4 was seen (data not shown). Overall, 14 of 26
prostate cancers had detectable FGF6 mRNA by this RT-PCR analysis.

View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. Expression of FGF6 mRNA in human prostate cancer. RNAs
from normal prostatic peripheral zone (Lane N) or
clinically localized prostate cancers (Lanes 112) were
isolated and reverse transcribed, and cDNAs were analyzed by PCR with
FGF6-specific primers, followed by transfer of PCR products to nylon
membranes and hybridization with a radiolabeled FGF6 probe. The washed
blot was exposed to X-ray film for approximately 30 min. The FGF6
product was 207 bp.
|
|
ELISA of FGF6 Concentration.
To determine whether the expression detected by RT-PCR corresponded to
increased expression of biologically significant quantities of FGF6, we
analyzed tissue extracts from a total of 24 prostate cancers for FGF6
content by ELISA. These samples included 20 clinically localized
cancers, a pelvic lymph node metastasis, and 3 locally advanced,
androgen-independent cancers. All tissue extracts contained 4090%
cancer by frozen section analysis. As controls, we also analyzed eight
tissue extracts from the normal peripheral zone and four extracts from
the normal transition zone. In addition, nine extracts from prostate
tissue with high-grade PIN, which is widely believed to be the
precursor lesion for invasive prostate carcinoma, were analyzed. As
shown in Fig. 2
the normal control tissues did not express detectable quantities of
FGF6, whereas 15 of 24 prostate cancers contained between 0.5 and 2.6
ng FGF6/g tissue. No correlation between FGF6 content and
differentiation, as determined by the Gleason score or clinical or
pathological stage, was apparent, but the number of cases is small, and
more extensive analysis will need to be performed to definitively
determine whether FGF6 expression is correlated with clinical or
pathological parameters. We also detected between 0.4 and 0.9 ng FGF6/g
tissue in four of nine high-grade PIN lesions. Thus, we found
expression of FGF6 protein in approximately one-half of PIN lesions and
invasive prostate carcinomas, which is similar to the percentage of
prostate cancers expressing FGF6 mRNA by RT-PCR analysis.

View larger version (9K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. FGF6 content of normal and neoplastic prostate tissues.
Tissue extracts were prepared as described in "Materials and
Methods" from normal peripheral and transition zone tissues
(NL), prostate tissues with high-grade PIN, or prostate
cancer tissues (CA), and the FGF6 content was determined
by ELISA. For the cancer tissues, open circles are the
values for a metastasis to a pelvic lymph node (the highest value) and
three transurethral resections in men with locally advanced,
androgen-independent prostate cancer, and closed circles are
the values for clinically localized cancers.
|
|
Immunohistochemical Analysis of FGF6 Expression.
To determine the cellular localization of FGF6 in the prostatic
tissues, we examined normal peripheral zone, PIN, and cancers by
immunohistochemistry with affinity-purified rabbit polyclonal anti-FGF6
antibodies. As shown in Fig. 3
, in the normal peripheral zone, weak staining of the basal cell layer
was detectable (Fig. 3A
). In one sample, we also found
staining of skeletal muscle fibers (data not shown). It is well known
that occasional skeletal muscle fibers can be found in normal prostate,
and FGF6 has previously been shown to be expressed by skeletal muscle
at other sites (15)
; therefore, the positive staining
observed is consistent with prior observations. In the high-grade PIN
lesions, we found a marked increase in the staining of the basal cells
in the dysplastic acini (Fig. 3 and C
). This
staining was distinctly stronger than that seen in adjacent, normal
acini in the same section. Preincubation of the anti-FGF6 antibody with
excess recombinant FGF6 completely abolished immunostaining (Fig. 3D
). A total of 10 carcinomas with detectable FGF6 by ELISA
were examined by immunohistochemistry. In eight of these carcinomas,
staining of the cytoplasm of the cancer cells was identified. This
staining varied from light but diffuse (1+) to intense and diffuse
(3+). The single case with 1+ staining was derived from a metastatic
cancer to a pelvic lymph node that was >90% cancer on frozen section
and contained 2.6 ng FGF6/g tissue by ELISA. In six of eight cases,
there was 2+ staining for FGF6, characterized by variable weak to
intense staining of the tumor cytoplasm. Finally, a single case of 3+
staining with uniform intense staining of the prostate cancer
epithelial cells was found (Fig. 3E
). In two prostate
cancers, there was no staining of the cancer epithelial cells, but
staining of stromal cells with fibroblastic morphology was seen (Fig. 3F
).

View larger version (132K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Immunohistochemistry of prostate, PIN, and prostate
cancer with anti-FGF6 antibody. Frozen sections of prostatic tissues
were analyzed by immunohistochemistry using anti-FGF6 antibody as
described in "Materials and Methods." A, normal
prostate showing weak staining of basal epithelial cells (x400).
B, low-power view of high-grade PIN showing intense
staining of basal epithelial cells (x40). C, high-power
view of a PIN lesion (x400). D, high-power view of a
PIN lesion stained with antibody preincubated with excess recombinant
FGF6 (negative control; x400). E, prostate carcinoma
showing strong staining of the cytoplasm of the cancer cells (x400).
F, prostate cancer with staining of the spindle-shaped
fibroblastic cells within the cancer tissue (x200).
|
|
Mitogenic Activity of FGF6 on Prostatic Cells.
To determine the role of FGF6 in the proliferation of normal and
neoplastic prostatic epithelial cells, we assessed the ability of
exogenous recombinant FGF6 to induce proliferation in primary cultures
of prostatic cells and in normal and neoplastic prostatic epithelial
cells lines. As seen in Fig. 4A
, FGF6 was mitogenic for both primary cultures of prostatic
epithelial and stromal cells. The differences seen are highly
statistically significant (P < 0.001,
t test) at 4 and 6 days of treatment for both epithelial and
stromal cells. Similar results were seen with PNT1A cells, a cell line
derived from normal prostatic epithelial cells immortalized by SV40
large T antigen (Fig. 4B
). In addition, a marked
proliferative response to exogenous FGF6 was also seen in the prostate
cancer cell lines DU145 and LNCaP, which was again highly statistically
significant by day 4 of treatment (P < 0.001, t test). The PC3 prostate cancer cell line had only a
slight (but statistically significant) proliferative response to FGF6.
Thus, with the exception of PC3 cells, the normal and transformed
prostatic epithelial cells tested showed a marked proliferative
response to exogenous FGF6.

View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. Cell proliferation in response to FGF6. Cells were plated
and treated with FGF6 (10 ng/ml) or kept in basal media containing
insulin as the only growth factor (primary cultures and PNT1A) or 0.2%
serum (prostate cancer cell lines) and counted at the indicated times.
A, primary epithelial and stromal cell cultures.
B, PNT1A, an immortalized prostatic epithelial cell
line. C, prostate cancer cell lines DU145, PC3, and
LNCaP. Error bars, SD of triplicate determinations.
|
|
Expression of FGFR-4 in Primary Prostatic Cells and Prostate Cancer
Cell Lines.
It has been shown by Ornitz et al. (2)
that the
FGFR with the most potent mitogenic response to FGF6 is FGFR-4. We
therefore examined the expression of FGFR-4 in the normal peripheral
zone of human prostate and in DU145, PC3, and LNCaP prostate cancer
cell lines by RT-PCR. The breast cancer cell line MDA-MB231, which has
been shown to express FGFR-4 (16
, 17)
, was included as a
positive control. As can be seen in Fig. 5A
, all four prostate samples and the prostate and breast
cancer cell lines express FGFR-4. A control in which genomic DNA was
added results in a larger 1.2-kb product, confirming that the primers
span an intron and the product seen in the RT-PCR reactions is not due
to genomic DNA contamination. To determine the site of FGFR-4
expression in normal prostate, RNAs from primary cultures of prostatic
epithelial and stromal cells were analyzed by RT-PCR. As seen in Fig. 5B
, both epithelial and stromal cells express FGFR-4.
Northern blotting using 1 µg of polyadenylated RNA from the three
prostate cancer cell lines and the immortalized normal prostatic
epithelial cell line PNT1A reveals a low but detectable expression
FGFR-4 in all four cell lines, with PC3 cells having the lowest FGFR-4
expression (Fig. 6
).

View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Expression of FGFR-4 by RT-PCR. cDNAs corresponding to 0.1
µg of total RNA were used for PCR with FGFR-4-specific primers,
analyzed by gel electrophoresis in 2% agarose gels, and stained with
ethidium bromide. A, control, no cDNA
(Lane C); prostate peripheral zone tissue
(Prostate, Lanes 14); DU145 (Lane
D), PC3 (Lane P), and
LNCaP (Lane L) prostate cancer cell
lines; MDA-MB231 breast cancer cells (Lane
M); and 1 µg of human genomic DNA (Lane
G). B, control, no cDNA
(Lane C), primary epithelial cultures
(Lane E), and primary stromal cell
cultures (Lane S). R4
indicates the product of the predicted size for FGFR-4 amplified from
cDNA (364 bp). The larger (1200-bp) product in the genomic control lane
is amplified across introns (leading to a larger product), thus
confirming that the smaller product in the cDNA lanes is not a result
of genomic DNA contamination of the cDNAs.
|
|

View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Northern blot analysis of FGFR-4 expression. Northern blot
using 1 µg of polyadenylated mRNA from DU145, PC3, and LNCaP cell
lines and immortalized normal prostate epithelial cells (PNT1A) was
probed with a FGFR-4 probe from the 3'-untranslated region of this
gene, washed, and exposed to X-ray film for 2 days. The indicated
FGFR-4 band is approximately 3.5 kb. The same filter was stripped and
reprobed with glyceraldehyde 3-phosphate dehydrogenase probe
(GAPDH), washed, and exposed to X-ray film overnight.
|
|
 |
DISCUSSION
|
|---|
Members of the FGF family are known to play an important role as
growth factors in the normal human prostate (9, 10, 11)
. We
report here our finding of increased expression of FGF6 in PIN, the
precursor of invasive prostate cancer, and in localized and metastatic
prostate cancers. FGF6 is expressed at an extremely low level in the
basal cells of normal human prostate that is undetectable by RT-PCR or
ELISA but can be detected by immunohistochemistry. Given that the basal
cells constitute only a small fraction of the total cells in the
prostate and that the expression of FGF6 was quite low on
immunohistochemistry, it is certainly conceivable that FGF6 expression
in normal prostate is below the limits of detection of RT-PCR, although
this is a very sensitive technique. In a significant proportion of
cases of high-grade PIN, we observed an increased expression of FGF6 by
the basal cells that was obvious by immunohistochemistry, and we have
confirmed this overexpression by the detection of FGF6 using ELISA.
Because the basal cells in PIN are not neoplastic, it is likely that
the dysplastic luminal cells directly or indirectly induce the
expression of FGF6 by the basal cells. Because FGF6 contains a signal
peptide and is actively secreted, the increased production of FGF6 by
the basal cells may play a role in the increased proliferation of the
dysplastic epithelial cells seen in PIN (18)
. To our
knowledge, this is the first report of expression of a growth factor by
prostatic basal cells in adult prostate and of the increased expression
of such a growth factor in PIN.
In the prostate cancer tissues, we have shown increased expression of
both FGF6 mRNA and protein. In most cases, FGF6 was localized in the
cancer cells by immunohistochemistry, consistent with an autocrine
growth stimulation. In two cases, we observed immunoreactive FGF6
primarily in fibroblastic cells, consistent with the induction of FGF6
production by these cells with potential paracrine effects on adjacent
cancer cells. A similar mixture of overexpression by both epithelial
and stromal cells has been described by Kornmann et
al. (19)
for the increased expression of FGF5 seen in
pancreatic cancer; therefore, this observation is not without
precedent. Thus, in prostate cancers, FGF6 that is normally secreted by
the basal cells is no longer available as a paracrine growth factor,
and in many cases, the cancers appear to have developed mechanisms to
compensate for this loss either by autocrine production of FGF6 or by
inducing adjacent stromal cells to produce it and, in fact, produce it
in larger amounts than in normal tissues. The potential biological
importance of the FGF6 overexpression observed is shown by the ability
of exogenous FGF6 to promote proliferation of normal, immortalized, and
fully transformed prostatic epithelial cells. In addition, by promoting
the growth of stromal cells, FGF6 may enhance the production of
paracrine growth factors by tumor stroma (20)
, which can
further promote tumor progression.
FGF6 is normally expressed in the skeletal muscle and may play an
important role as a growth factor in that tissue. Studies by
Penault-Llorca et al. (21)
have shown
expression of FGF6 in 3 of 10 breast cancer cell lines and in 15% of
primary breast cancer tissues. No FGF6 expression was detected in
normal breast tissue. These same authors detected overexpression of
FGFR-4 in 32% of primary breast cancers. Expression of FGFR-4 has been
shown by others to be present in the majority of breast cancer cell
lines (16
, 17)
. Given that FGFR-4 is the most potent
receptor for FGF6 (2)
, a potential autocrine loop
involving FGF6 and FGFR-4 may be established in a subset of breast
cancers. We have also found expression of FGFR-4 in all three prostate
cancer cell lines and in primary prostate epithelial cultures. It
should be noted that this expression is relatively low, and we did not
detect it previously in the normal prostate (9)
; however,
using improved PCR primers allowed us to detect this expression.
Chandler et al. (16)
have also reported
expression of FGFR-4 in DU145 cells using a RNase protection assay,
which is consistent with our results, but they found barely detectable
expression of FGFR-4 in PC3 cells, whereas we found FGFR-4 expression
that was lower than but similar to that seen in DU145 cells.
Whether this difference reflects the use of different probes and
methods for RNA analysis or differences in the PC3 cells between
different laboratories is not clear. It is of interest to note that
both prostate (22, 23, 24)
and breast cancers
(25)
have been reported to have increased expression of
FGF8, a potent activator of FGFR-4. Thus, in both breast and prostate
cancer, there is evidence that autocrine stimulation of FGFR-4 by FGF6
and FGF8 may occur. It is known that the signaling properties of FGFR-4
differ from those of the other FGFRs (26, 27, 28, 29)
in that
FGFR-4 only weakly stimulates mitogen-activated protein kinase
activation (27)
and is associated with a unique
Mr 85,000 serine kinase (27
, 28)
that may be important in FGFR-4 signaling. Johnston et
al. (29)
have shown that FGFR-4 is the only FGFR that
can promote membrane ruffling when tranfected into COS-7 cells. Such
membrane ruffling is associated with changes in the actin cytoskeleton
related to increased motility. Thus, FGFR-4 activation by autocrine
stimulation may be more important in altering motility or other
properties when compared with similar stimulation of other FGFRs and
may therefore play a unique role in tumor progression.
In addition to FGFR-4, other FGFR isoforms that can respond to FGF6,
such as FGFR-1 IIIc and FGFR-2 IIIc (2)
are also expressed
in prostate cancer cells. We have shown that expression of FGFR-1 is
increased, particularly in poorly differentiated prostate cancers
(20)
, and we have recently found that FGFR-1 is present
only as the IIIc isoform in prostate
cancers.4
FGFR-1 IIIc could markedly enhance response to FGF6 in those cases
where it is expressed. Similarly, there is evidence that the DU145
prostate cancer cell line and some prostate cancer xenografts express
the FGFR-2 IIIc isoform (30)
that can bind FGF6. However,
FGFR-1 IIIc and FGFR-2 IIIc are not expressed in cultured primary
prostatic epithelial cells (9)
; therefore, in normal
prostatic epithelial cells, most of the mitogenic effect of FGF6 must
be through activation of FGFR-4. Additional studies are needed to
define the expression of the various FGFR isoforms that bind FGF6 in
prostate cancer cells in vivo and the relative importance of
each of these receptors in the biological response of prostate cancer
cells to FGF6.
In summary, we have found that FGF6 is expressed by normal prostatic
basal cells in extremely small amounts, and expression in basal cells
is markedly increased in PIN lesions. Approximately half of prostate
cancers express FGF6 in the cancer cell themselves or in the tumor
stroma. The acquisition of FGF6 expression by the prostate cancers
implies but does not prove that it may play a role in cancer cell
proliferation or perhaps in other aspects of tumor progression. Other
FGFs, such as FGF2 (20)
and FGF8 (22, 23, 24)
,
have also been shown to be increased in prostate cancer, and a number
of other growth factors, including EGF and transforming growth factor
(31)
, have also been implicated in prostate cancer.
The relative importance of each of these growth factors in prostate
cancer progression has yet to be elucidated. Further work will be
needed to define the role of the increased expression of FGF6 in human
prostate cancer.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Karen Schmidt for skilled technical assistance.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by Department of Veterans Affairs
Merit Review funding. 
2 To whom requests for reprints should be
addressed, at Research Service, Houston Veterans Affairs Medical
Center, 2002 Holcombe Boulevard, Houston, TX 77030. Phone:
(713) 791-1414, ext. 4008; Fax: (713) 794-7938; E-mail: mittmann{at}bcm.tmc.edu 
3 The abbreviations used are: FGF, fibroblast
growth factor; FGFR, FGF receptor; RT-PCR, reverse transcription-PCR;
PIN, prostatic intraepithelial neoplasia; EGF, epidermal growth
factor. 
4 Unpublished data. 
Received 11/ 5/99.
Accepted 6/ 2/00.
 |
REFERENCES
|
|---|
-
Johnson D., Williams L. Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res., 60: 1-41, 1993.[Medline]
-
Ornitz D., Xu J., Colvin J., McEwen D., MacArthur C., Coulier F., Gao G., Goldfarb M. Receptor specificity of the fibroblast growth factor family. J. Biol. Chem., 271: 15292-15297, 1996.[Abstract/Free Full Text]
-
Basilico C., Moscatelli D. The FGF family of growth factors and oncogenes. Adv. Cancer Res., 59: 115-165, 1992.[Medline]
-
Hector-Schulz S., Haghayegh S. Basic fibroblast growth factor expression in human and murine squamous cell carcinomas and its relationship to regional endothelial cell proliferation. Cancer Res., 53: 1444-1449, 1993.[Abstract/Free Full Text]
-
Miyake H., Yoshimura K., Hara I., Eto H., Arakawa S., Kamidono S. Basic fibroblast growth factor regulates matrix metalloproteinases production and in vitro invasiveness in human bladder cancer cell lines. J. Urol., 157: 2351-2355, 1997.[Medline]
-
Galzie Z., Fernig D., Smith J., Poston G., Kinsella A. Invasion of human colorectal carcinoma cells is promoted by endogenous basic fibroblast growth factor. Int. J. Cancer, 71: 390-395, 1997.[Medline]
-
Ropiquet F., Huguenin S., Villette J. M., Ronfle V., Le Brun G., Maitland N. J., Cussenot O., Fiet J., Berthon P. FGF7/KGF triggers cell transformation and invasion on immortalized human prostatic epithelial PNT1A cells. Int. J. Cancer, 82: 237-243, 1999.[Medline]
-
Fox J., Shanley J. Antisense inhibition of basic fibroblast growth factor induces apoptosis in vascular smooth muscle cells. J. Biol. Chem., 271: 12578-12584, 1996.[Abstract/Free Full Text]
-
Ittmann M., Mansukhani A. Expression of fibroblast growth factors (FGFs) and FGF receptors in human prostate. J. Urol., 157: 351-356, 1997.[Medline]
-
Giri D., Ropiquet F., Ittmann M. FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J. Cell. Physiol., 180: 53-60, 1999.[Medline]
-
Ropiquet F., Giri D., Lamb D., Ittmann M. FGF7 and FGF2 are increased in benign prostatic hyperplasia and are associated with increased proliferation. J. Urol., 162: 595-599, 1999.[Medline]
-
Yan G., Fukobori Y., McBride G., Nikolaropolous S., McKeehan W. Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Mol. Cell. Biol., 8: 4513-4522, 1993.
-
Partanen J., Makela T. P., Eerola E., Korhonen J., Hirvonen H., Claesson-Welsh L., Alitalo K. FGFR-4, a novel acidic fibroblast growth factor receptor with a distinct expression pattern. EMBO J., 10: 1347-1354, 1991.[Medline]
-
Cussenot O., Berthon P., Berger R., Mowszowicz I., Faille A., Hojman F., Teillac P., Le Duc A., Calvo F. Immortalization of human adult normal prostatic epithelial cells by liposomes containing large T-SV40 gene. J. Urol., 146: 881-886, 1991.[Medline]
-
de Lapeyriere O., Rosnet O., Benharroch D., Raybaud F., Marchetto S., Planche J., Galland F., Mattei M., Copeland N. G., Jenkins N. A., Coulier F., Birnbaum D. Structure, chromosome mapping and expression of the murine Fgf-6 gene. Oncogene, 5: 823-831, 1990.[Medline]
-
Chandler L. A., Sosnowski B. A., Greenlees L., Aukerman S. L., Baird A., Pierce G. F. Prevalent expression of fibroblast growth factor (FGF) receptors and FGF2 in human tumor cell lines. Int. J. Cancer, 81: 451-458, 1999.[Medline]
-
Ron D., Reich R., Chedid M., Lengel C., Cohen O. E., Chan A. M., Neufeld G., Miki T., Tronick S. R. Fibroblast growth factor receptor 4 is a high affinity receptor for both acidic and basic fibroblast growth factor but not for keratinocyte growth factor. J. Biol. Chem., 268: 5388-5394, 1993.[Abstract/Free Full Text]
-
Harper M. E., Glynne-Jones E., Goddard L., Mathews P., Nicholson R. I. Expression of androgen receptor and growth factors in premalignant lesions of the prostate. J. Pathol., 186: 169-177, 1998.[Medline]
-
Kornmann M., Ishiwata T., Beger H., Korc M. Fibroblast growth factor-5 stimulates mitogenic signaling and is overexpressed in human pancreatic cancer: evidence for autocrine and paracrine actions. Oncogene, 15: 1417-1424, 1997.[Medline]
-
Giri D., Ropiquet F., Ittmann M. Alterations in expression of FGF2 and its receptor FGFR-1 in human prostate cancer. Clin. Cancer Res., 5: 1063-1071, 1999.[Abstract/Free Full Text]
-
Penault-Llorca F., Bertucci F., Adelaide J., Parc P., Coulier F., Jacquemier J., Birnbaum D., DeLapeyiere O. Expression of FGF and FGF receptor genes in human breast cancer. Int. J. Cancer, 61: 170-176, 1995.[Medline]
-
Leung H., Dickson C., Robson C., Neal D. Overexpression of fibroblast growth factor-8 in human prostate carcinoma. Oncogene, 12: 1833-1835, 1996.[Medline]
-
Tanaka A., Furuya A., Yamasaki M., Hanai N., Kuriki K., Kamiakito T., Kobayashi Y., Yoshida H., Koike M., Fukayama M. High frequency of fibroblast growth factor (FGF) 8 expression in clinical prostate cancers and breast tissues: immunohistochemically demonstrated by a newly established neutralizing monoclonal antibody against FGF 8. Cancer Res., 58: 2053-2056, 1998.[Abstract/Free Full Text]
-
Dorkin T. J., Robinson M. C., Marsh C., Bjartell A., Neal D. E., Leung H. Y. FGF8 over-expression in prostate cancer is associated with decreased patient survival and persists in androgen independent disease. Oncogene, 18: 2755-2761, 1999.[Medline]
-
Marsh S. K., Bansal G. S., Zammit C., Barnard R., Coope R., Roberts-Clarke D., Gomm J. J., Coombes R. C., Johnston C. L. Increased expression of fibroblast growth factor 8 in human breast cancer. Oncogene, 18: 1053-1060, 1999.[Medline]
-
Wang J. K., Gao G., Goldfarb M. Fibroblast growth factor receptors have different signaling and mitogenic potentials. Mol. Cell. Biol., 14: 181-188, 1994.[Abstract/Free Full Text]
-
Vainikka S., Joukov V., Wennstrom S., Bergman M., Pelicci P. G., Alitalo K. Signal transduction by fibroblast growth factor receptor-4 (FGFR-4): comparison with FGFR-1. J. Biol. Chem., 269: 18320-18326, 1994.[Abstract/Free Full Text]
-
Vainikka S., Joukov V., Klint P., Alitalo K. Association of a 85-kDa serine kinase with activated fibroblast growth factor receptor-4. J. Biol. Chem., 271: 1270-1273, 1996.[Abstract/Free Full Text]
-
Johnston C. L., Cox H. C., Gomm J. J., Coombes R. C. bFGF and aFGF induce membrane ruffling in breast cancer cells but not in normal breast epithelial cells: FGFR-4 involvement. Biochem. J., 306: 609-616, 1995.
-
Carstens R. P., Eaton J. V., Krigman H. R., Walther P. J., Garcia-Blanco M. A. Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer. Oncogene, 15: 3059-3065, 1997.[Medline]
-
Sherwood E. R., Lee C. Epidermal growth factor-related peptides and the epidermal growth factor receptor in normal and malignant prostate. World J. Urol., 13: 290-296, 1995.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton
Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction
Endocr. Rev.,
April 1, 2008;
29(2):
193 - 216.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lin, G. Liu, Y. Zhang, Y.-P. Hu, K. Yu, C. Lin, K. McKeehan, J. W. Xuan, D. M. Ornitz, M. M. Shen, et al.
Fibroblast growth factor receptor 2 tyrosine kinase is required for prostatic morphogenesis and the acquisition of strict androgen dependency for adult tissue homeostasis
Development,
February 15, 2007;
134(4):
723 - 734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. J. Tebben, K. R. Kalli, W. A. Cliby, L. C. Hartmann, J. P. Grande, R. J. Singh, and R. Kumar
Elevated Fibroblast Growth Factor 23 in Women With Malignant Ovarian Tumors
Mayo Clin. Proc.,
June 1, 2005;
80(6):
745 - 751.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
D M Peehl
Primary cell cultures as models of prostate cancer development
Endocr. Relat. Cancer,
March 1, 2005;
12(1):
19 - 47.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B Kwabi-Addo, M Ozen, and M Ittmann
The role of fibroblast growth factors and their receptors in prostate cancer
Endocr. Relat. Cancer,
December 1, 2004;
11(4):
709 - 724.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, D. W. Stockton, and M. Ittmann
The Fibroblast Growth Factor Receptor-4 Arg388 Allele Is Associated with Prostate Cancer Initiation and Progression
Clin. Cancer Res.,
September 15, 2004;
10(18):
6169 - 6178.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Kwabi-Addo, J. Wang, H. Erdem, A. Vaid, P. Castro, G. Ayala, and M. Ittmann
The Expression of Sprouty1, an Inhibitor of Fibroblast Growth Factor Signal Transduction, Is Decreased in Human Prostate Cancer
Cancer Res.,
July 15, 2004;
64(14):
4728 - 4735.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Polnaszek, B. Kwabi-Addo, L. E. Peterson, M. Ozen, N. M. Greenberg, S. Ortega, C. Basilico, and M. Ittmann
Fibroblast Growth Factor 2 Promotes Tumor Progression in an Autochthonous Mouse Model of Prostate Cancer
Cancer Res.,
September 15, 2003;
63(18):
5754 - 5760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. L. Weber and M. C. Gebhardt
What's New in Musculoskeletal Oncology
J. Bone Joint Surg. Am.,
March 31, 2003;
85(4):
761 - 767.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ozen, D. Giri, F. Ropiquet, A. Mansukhani, and M. Ittmann
Role of Fibroblast Growth Factor Receptor Signaling in Prostate Cancer Cell Survival
J Natl Cancer Inst,
December 5, 2001;
93(23):
1783 - 1790.
[Abstract]
[Full Text]
[PDF]
|
 |
|