Cancer Research Meeting Calendar  Genetics and Biology of Brain Cancer
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ropiquet, F.
Right arrow Articles by Ittmann, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ropiquet, F.
Right arrow Articles by Ittmann, M.
[Cancer Research 60, 4245-4250, August 1, 2000]
© 2000 American Association for Cancer Research


Tumor Biology

Increased Expression of Fibroblast Growth Factor 6 in Human Prostatic Intraepithelial Neoplasia and Prostate Cancer1

Frederic Ropiquet, Dipak Giri, Bernard Kwabi-Addo, Alka Mansukhani and Michael Ittmann2

Department of Pathology, Baylor College of Medicine and Department of Veterans Affairs Medical Center, Houston, Texas 77030 [F. R., D. G., B. K- A., M. I.], and Department of Microbiology, New York University School of Medicine, New York, New York 10016 [A. M.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fibroblast growth factors (FGFs) are known to play an important role in the growth of normal prostatic epithelial cells. In addition to their effects on proliferation, FGFs can promote cell motility, increase tumor angiogenesis, and inhibit apoptosis, all of which play an important role in tumor progression. To determine whether FGFs are overexpressed in human prostate cancers, we analyzed 26 prostate cancer RNAs by reverse transcription-PCR for expression of FGF3, FGF4, and FGF6, which cannot be detected in normal prostate tissue by this technique. Fourteen of 26 prostate cancers expressed FGF6 mRNA. No expression of FGF3 or FGF4 was detected. An ELISA of tissue extracts of normal prostate, high-grade prostatic intraepithelial neoplasia (PIN), and prostate cancer for FGF6 showed that this growth factor was undetectable in normal prostate but was present at elevated levels in 4 of 9 PIN lesions and in 15 of 24 prostate cancers. Immunohistochemical analysis with anti-FGF6 antibody revealed weak staining of prostatic basal cells in normal prostate that was markedly elevated in PIN. In the prostate cancers, the majority of cases revealed expression of FGF6 by the prostate cancer cells themselves. In two cases, expression was present in prostatic stromal cells. Exogenous FGF6 was able to stimulate proliferation of primary prostatic epithelial and stromal cells, immortalized prostatic epithelial cells, and prostate cancer cell lines in tissue culture. FGF receptor 4, which is the most potent FGF receptor for FGF6, is expressed in the human prostate in vivo and in all of the cultured cell lines. Thus, FGF6 is increased in PIN and prostate cancer and can promote the proliferation of the transformed prostatic epithelial cells via paracrine and autocrine mechanisms.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The FGF3 gene family consists of at least 19 different genes encoding related polypeptide mitogens. These growth factors interact with a family of four distinct, high-affinity tyrosine kinase receptors designated FGFRs 1–4 (for review, see Ref. 1 ). These receptors consist of an extracellular portion containing three immunoglobulin-like domains and an intracellular tyrosine kinase domain and have variable affinities for the different FGFs. In addition, FGFRs 1–3 all undergo an alternative splicing event in which two alternative exons (IIIb and IIIc) can be used to encode the COOH-terminal portion of the third immunoglobulin-like loop, which results in receptor isoforms with dramatically altered binding specificity. Considerable progress has been made in defining the relative affinities of FGFs 1–9 for the various receptors and their isoforms (2) , although much less is known about FGFs 10–19.

The FGFs are mitogenic for a many cell types, both epithelial and mesenchymal. In addition, FGFs have a variety of other biological activities. Some FGFs, like FGF2, have potent angiogenic activity and have been implicated as promoters of tumor angiogenesis (3 , 4) . FGFs have also been shown to increase the motility and invasiveness of a variety of cell types including prostatic epithelial cells (3 , 5, 6, 7) . Finally, it has been shown that FGFs can inhibit apoptosis in the appropriate context (8) . Thus, FGFs have a broad range of biological activities that can play an important role in tumorigenesis.

We have shown previously that FGF2, FGF7, and FGF9 are present in high concentrations in normal human prostate (9, 10, 11) . They are produced by prostatic stromal cells and can act as paracrine growth factors for prostatic epithelial cells and, except for FGF7, as autocrine growth factors for stromal cells. Thus, FGFs are important growth factors for maintenance of the normal prostate in vivo.

Evidence for the importance of FGFs in prostate cancer comes from studies of the Dunning rat model system. Yan et al. (12) have shown that as these transplantable tumors progress from a mixed stromal-epithelial phenotype to a stromal independent phenotype, expression of FGFs not originally present in the tumors (such as FGF3 and FGF5) occurs, and there are changes in the isoforms of FGFRs expressed, consistent with autocrine stimulation of growth. We therefore sought to determine whether a similar autocrine production of FGFs occurs in human prostate cancers.

We have found that approximately half of human prostate cancers contain increased amounts of FGF6, and, in the majority of such cases, FGF6 is expressed in the cancer cells. In PIN, the precursor lesion for prostate cancer, the prostatic basal cells express a markedly increased level of FGF6. The biological importance of this overexpression is shown by our finding that FGF6 is a potent growth factor for normal and neoplastic prostatic epithelial cells in culture. Thus, FGF6 may play an important role as both a paracrine and an autocrine growth factor in the initiation and progression of human prostate cancer.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Tissue Acquisition and Analysis.
Prostate cancer tissues and samples of the uninvolved peripheral and transitional zone of the prostate were taken from radical prostatectomies performed for treatment of clinical stage T1cN0 or T2N0 prostate cancer. Tissues were received fresh, and portions were snap-frozen in liquid nitrogen or used to establish primary cell cultures (see below). Additional cancer tissues were obtained from three transurethral resections of prostate performed to treat obstruction in advanced prostate cancer and from a pelvic lymph node metastasis. The frozen tissues were then analyzed by frozen section to confirm the presence or absence of carcinoma or high-grade PIN, and, if present, the percentage of the tissue involved in these processes. The carcinoma tissues contained 30–80% cancer, and tissues with PIN contained 30–50% PIN. To obtain nine tissues with such extensive high-grade PIN, it was necessary to select tissues from over 800 frozen sections performed previously on prostate tissues harvested from radical prostatectomies and, in some cases, to microdissect the tissue to enrich for PIN. All normal peripheral and transition zone tissues were free of cancer and PIN. Additional frozen sections were prepared for immunohistochemistry in some cases, and the remaining tissue was used to prepare cell extracts or RNA.

RNA Extraction, RT-PCR, and Northern Blotting.
RNAs were extracted from tissues and cultured cells using the guanidine isothiocyanate procedure, and reverse transcription was performed as described previously using 2 µg of total RNA (9) . The cDNA product, corresponding to 0.1 µg of total RNA, was used for PCR amplification as described previously. Primers for FGF6 were CACGAGGAGAACCCCTACA (forward primer, exon 1) and TCCCTTGGTACAAGTCTGA (reverse primer, exon 3). Positive control for FGF6 was skeletal muscle mRNA from Clontech Laboratories, Inc. (Palo Alto, CA). FGFR-4 primers were CTTGACCTCCAGCAACGATGA (forward primer) and GCACATCTAGCAGGTAGTTATAGCGG (reverse primer). For each set of PCR reactions, a control in which water was added rather than cDNA was included, and this reaction was uniformly negative. FGF3 and FGF4 primers, Southern blotting of PCR products, Northern blotting, and specific probes for FGF3, FGF4, and FGF6 were as described previously (9) . The FGFR-4 probe was a 600-bp BamHI fragment from the 3' end of the human FGFR-4 plasmid SV2SE (13) . This probe consists primarily of a 3' untranslated sequence to eliminate cross-hybridization with other FGFR transcripts.

Cell Proliferation Assays.
Primary epithelial cell cultures were established using prostatic tissue samples from areas in the peripheral zone of radical prostatectomy specimens that were free from carcinoma. Primary epithelial cells were plated on collagen-coated 35-mm dishes at 5 x 104 cells/dish in complete epithelial growth medium that includes bovine pituitary extract (a source of FGFs), EGF, insulin, dexamethasone, cholera toxin, and BSA, as described previously (9) . We have previously shown such cultures to be of prostatic epithelial origin by immunohistochemistry (9) . The next day, medium was changed to epithelial growth medium without bovine pituitary extract or EGF. Cells were kept in this incomplete medium as controls or were supplemented with 10 ng/ml recombinant FGF6 (R&D Systems, Minneapolis, MN). Cells were then trypsinized and counted using a Coulter counter at 2-day intervals.

Prostate cancer cell lines (DU145, PC3, and LNCaP) were maintained in RPMI 1640 with 10% FCS. Cells were plated at 5 x 104 cells/35-mm dish, and the next day, cells were refed with 0.2% FCS with or without 10 ng/ml FGF6. Cells were counted at 2 or 4 days after growth factor addition. PNT1A, an immortalized normal prostatic epithelial cell line (14) , was maintained in RPMI 1640 containing 5% FCS. Cell were plated at 2.5 x 104 cells/35-mm dish and refed the next day with RPMI 1640 supplemented with 1% ITS (insulin, transferrin, and selenium; Sigma, St. Louis, MO) with or without 10 ng/ml FGF6. Cells were then counted on days 3 and 5.

Preparation of Cell Extracts.
Prostatic tissue samples were weighed, pulverized in liquid nitrogen, and then homogenized by three strokes (each for 10 s) on ice in a lysis buffer, as described previously (10) , using 0.5 ml lysis buffer/200 mg tissue. The homogenate was then incubated for 30 min on ice, and insoluble material was removed by centrifugation for 1 min in a microcentrifuge at 4°C.

Immunohistochemistry.
Frozen tissue sections were fixed in acetone for 10 min, postfixed in methanol for an additional minute, and stored at -80°C. Immunohistochemical localization of FGF6 was carried out by the avidin-biotin complex method as described previously (10) . All sections were treated with Autoblocker (R&D Systems) to inhibit endogenous peroxidase and avidin/biotin (Vector Laboratories, Burlingame, CA) to block endogenous biotin. The sections were incubated with rabbit polyclonal anti-FGF6 antibody (200 ng/ml; R&D Systems) at 4°C for 12 h. After liberal washing with PBS (pH 7.4), sections were incubated with the appropriate biotinylated secondary antibody at a 1:200 dilution (Vector Laboratories). Sections were then washed with PBS containing 0.1% Tween 20 and incubated with avidin-biotin complex (Vectastain Elite; Vector Laboratories) for 15 min. The antigen-antibody reaction was demonstrated using diaminobenzidine as a substrate, and the sections were then counterstained with hematoxylin. Staining of the cancer cells was graded as 1+ (weak), 2+ (moderate), or 3+ (strong). The specificity of staining was confirmed by preincubation of a 1 µg/ml solution of anti-FGF6 antibody with an equal volume of recombinant FGF6 at 10 µg/ml for 1 h at room temperature before immunohistochemistry. This pretreatment completely abolished immunostaining for this antibody.

ELISA of FGF6 Concentration.
Each well of a 96-well plate was coated with 100 µl of a solution of anti-FGF6 monoclonal antibody (MAB 238; R&D Systems) at a concentration of 4 µg/ml overnight at room temperature in a sealed bag. The next day, wells were washed three times with PBS containing 0.05% Tween 20 and incubated overnight at 4°C with 300 µl of a blocking solution (Kirkegaard and Perry Laboratories, Gaithersburg, MD). The plate was then washed as described above, and standards and samples were added (100 µl/well). Samples were 100 µl of pure tissue extract. Wells were then incubated for 3 h at room temperature. After washing as described above, biotinylated polyclonal anti-FGF6 antibody (BAF 238; R&D Systems) was added at a concentration of 400 ng/ml for 2 h at room temperature. After washing as described above, detection was carried out by adding 100 µl/well of a 1:4000 dilution of streptavidin/horseradish peroxidase (Zymed, San Francisco, CA) and incubating for 20 min at room temperature. Wells were washed and incubated with a substrate consisting of a 1:1 solution of H2O2 and tetramethylbenzidine (Sigma) at a concentration of 0.1 mg/ml. Stop solution (H2SO4) was added within 30 min, and absorbance at 450 nm was determined using an ELISA plate reader. The sensitivity of this ELISA was found to be less than 1 pg/ml. No cross-reactivity with FGF2, FGF7, and FGF9 was detected when these growth factors were added at 10 ng/well.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
RT-PCR Analysis of FGF6 Expression in Prostate Cancers.
Our initial goal was to screen prostate cancer RNAs for expression of FGF RNAs that were not expressed by normal prostate. To maximize the sensitivity and specificity of this screening, we analyzed the prostate cancer RNAs by RT-PCR using primers for FGFs 1–9 followed by Southern blotting of the PCR products and hybridization with a probe corresponding to the specific product of RT-PCR reaction. Using this extremely sensitive technique, FGFs 1, 2, 5, 7, 8, and 9 gave detectable bands in normal tissues (data not shown) and thus were not useful for this qualitative study to determine whether new FGFs were expressed in the prostate cancer tissues. However, no expression of FGFs 3, 4, or 6 was detected by this technique in RNA from the normal peripheral zone. To determine whether these FGFs are expressed in human prostate cancers, we analyzed a total of 26 clinically localized prostate cancer RNAs from tissues containing 30–80% carcinoma on frozen section by RT-PCR followed by Southern blotting of the PCR products. Expression of FGF6 mRNA was detectable in variable amounts in a subset of prostate cancers (Fig. 1Citation ) and no FGF6 was detected in the control normal prostate tissue. No expression of FGF3 or FGF4 was seen (data not shown). Overall, 14 of 26 prostate cancers had detectable FGF6 mRNA by this RT-PCR analysis.



View larger version (20K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Expression of FGF6 mRNA in human prostate cancer. RNAs from normal prostatic peripheral zone (Lane N) or clinically localized prostate cancers (Lanes 1–12) were isolated and reverse transcribed, and cDNAs were analyzed by PCR with FGF6-specific primers, followed by transfer of PCR products to nylon membranes and hybridization with a radiolabeled FGF6 probe. The washed blot was exposed to X-ray film for approximately 30 min. The FGF6 product was 207 bp.

 
ELISA of FGF6 Concentration.
To determine whether the expression detected by RT-PCR corresponded to increased expression of biologically significant quantities of FGF6, we analyzed tissue extracts from a total of 24 prostate cancers for FGF6 content by ELISA. These samples included 20 clinically localized cancers, a pelvic lymph node metastasis, and 3 locally advanced, androgen-independent cancers. All tissue extracts contained 40–90% cancer by frozen section analysis. As controls, we also analyzed eight tissue extracts from the normal peripheral zone and four extracts from the normal transition zone. In addition, nine extracts from prostate tissue with high-grade PIN, which is widely believed to be the precursor lesion for invasive prostate carcinoma, were analyzed. As shown in Fig. 2Citation the normal control tissues did not express detectable quantities of FGF6, whereas 15 of 24 prostate cancers contained between 0.5 and 2.6 ng FGF6/g tissue. No correlation between FGF6 content and differentiation, as determined by the Gleason score or clinical or pathological stage, was apparent, but the number of cases is small, and more extensive analysis will need to be performed to definitively determine whether FGF6 expression is correlated with clinical or pathological parameters. We also detected between 0.4 and 0.9 ng FGF6/g tissue in four of nine high-grade PIN lesions. Thus, we found expression of FGF6 protein in approximately one-half of PIN lesions and invasive prostate carcinomas, which is similar to the percentage of prostate cancers expressing FGF6 mRNA by RT-PCR analysis.



View larger version (9K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. FGF6 content of normal and neoplastic prostate tissues. Tissue extracts were prepared as described in "Materials and Methods" from normal peripheral and transition zone tissues (NL), prostate tissues with high-grade PIN, or prostate cancer tissues (CA), and the FGF6 content was determined by ELISA. For the cancer tissues, open circles are the values for a metastasis to a pelvic lymph node (the highest value) and three transurethral resections in men with locally advanced, androgen-independent prostate cancer, and closed circles are the values for clinically localized cancers.

 
Immunohistochemical Analysis of FGF6 Expression.
To determine the cellular localization of FGF6 in the prostatic tissues, we examined normal peripheral zone, PIN, and cancers by immunohistochemistry with affinity-purified rabbit polyclonal anti-FGF6 antibodies. As shown in Fig. 3Citation , in the normal peripheral zone, weak staining of the basal cell layer was detectable (Fig. 3ACitation ). In one sample, we also found staining of skeletal muscle fibers (data not shown). It is well known that occasional skeletal muscle fibers can be found in normal prostate, and FGF6 has previously been shown to be expressed by skeletal muscle at other sites (15) ; therefore, the positive staining observed is consistent with prior observations. In the high-grade PIN lesions, we found a marked increase in the staining of the basal cells in the dysplastic acini (Fig. 3 and CCitation ). This staining was distinctly stronger than that seen in adjacent, normal acini in the same section. Preincubation of the anti-FGF6 antibody with excess recombinant FGF6 completely abolished immunostaining (Fig. 3DCitation ). A total of 10 carcinomas with detectable FGF6 by ELISA were examined by immunohistochemistry. In eight of these carcinomas, staining of the cytoplasm of the cancer cells was identified. This staining varied from light but diffuse (1+) to intense and diffuse (3+). The single case with 1+ staining was derived from a metastatic cancer to a pelvic lymph node that was >90% cancer on frozen section and contained 2.6 ng FGF6/g tissue by ELISA. In six of eight cases, there was 2+ staining for FGF6, characterized by variable weak to intense staining of the tumor cytoplasm. Finally, a single case of 3+ staining with uniform intense staining of the prostate cancer epithelial cells was found (Fig. 3ECitation ). In two prostate cancers, there was no staining of the cancer epithelial cells, but staining of stromal cells with fibroblastic morphology was seen (Fig. 3FCitation ).



View larger version (132K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Immunohistochemistry of prostate, PIN, and prostate cancer with anti-FGF6 antibody. Frozen sections of prostatic tissues were analyzed by immunohistochemistry using anti-FGF6 antibody as described in "Materials and Methods." A, normal prostate showing weak staining of basal epithelial cells (x400). B, low-power view of high-grade PIN showing intense staining of basal epithelial cells (x40). C, high-power view of a PIN lesion (x400). D, high-power view of a PIN lesion stained with antibody preincubated with excess recombinant FGF6 (negative control; x400). E, prostate carcinoma showing strong staining of the cytoplasm of the cancer cells (x400). F, prostate cancer with staining of the spindle-shaped fibroblastic cells within the cancer tissue (x200).

 
Mitogenic Activity of FGF6 on Prostatic Cells.
To determine the role of FGF6 in the proliferation of normal and neoplastic prostatic epithelial cells, we assessed the ability of exogenous recombinant FGF6 to induce proliferation in primary cultures of prostatic cells and in normal and neoplastic prostatic epithelial cells lines. As seen in Fig. 4ACitation , FGF6 was mitogenic for both primary cultures of prostatic epithelial and stromal cells. The differences seen are highly statistically significant (P < 0.001, t test) at 4 and 6 days of treatment for both epithelial and stromal cells. Similar results were seen with PNT1A cells, a cell line derived from normal prostatic epithelial cells immortalized by SV40 large T antigen (Fig. 4BCitation ). In addition, a marked proliferative response to exogenous FGF6 was also seen in the prostate cancer cell lines DU145 and LNCaP, which was again highly statistically significant by day 4 of treatment (P < 0.001, t test). The PC3 prostate cancer cell line had only a slight (but statistically significant) proliferative response to FGF6. Thus, with the exception of PC3 cells, the normal and transformed prostatic epithelial cells tested showed a marked proliferative response to exogenous FGF6.



View larger version (28K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Cell proliferation in response to FGF6. Cells were plated and treated with FGF6 (10 ng/ml) or kept in basal media containing insulin as the only growth factor (primary cultures and PNT1A) or 0.2% serum (prostate cancer cell lines) and counted at the indicated times. A, primary epithelial and stromal cell cultures. B, PNT1A, an immortalized prostatic epithelial cell line. C, prostate cancer cell lines DU145, PC3, and LNCaP. Error bars, SD of triplicate determinations.

 
Expression of FGFR-4 in Primary Prostatic Cells and Prostate Cancer Cell Lines.
It has been shown by Ornitz et al. (2) that the FGFR with the most potent mitogenic response to FGF6 is FGFR-4. We therefore examined the expression of FGFR-4 in the normal peripheral zone of human prostate and in DU145, PC3, and LNCaP prostate cancer cell lines by RT-PCR. The breast cancer cell line MDA-MB231, which has been shown to express FGFR-4 (16 , 17) , was included as a positive control. As can be seen in Fig. 5ACitation , all four prostate samples and the prostate and breast cancer cell lines express FGFR-4. A control in which genomic DNA was added results in a larger 1.2-kb product, confirming that the primers span an intron and the product seen in the RT-PCR reactions is not due to genomic DNA contamination. To determine the site of FGFR-4 expression in normal prostate, RNAs from primary cultures of prostatic epithelial and stromal cells were analyzed by RT-PCR. As seen in Fig. 5BCitation , both epithelial and stromal cells express FGFR-4. Northern blotting using 1 µg of polyadenylated RNA from the three prostate cancer cell lines and the immortalized normal prostatic epithelial cell line PNT1A reveals a low but detectable expression FGFR-4 in all four cell lines, with PC3 cells having the lowest FGFR-4 expression (Fig. 6Citation ).



View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Expression of FGFR-4 by RT-PCR. cDNAs corresponding to 0.1 µg of total RNA were used for PCR with FGFR-4-specific primers, analyzed by gel electrophoresis in 2% agarose gels, and stained with ethidium bromide. A, control, no cDNA (Lane C); prostate peripheral zone tissue (Prostate, Lanes 1–4); DU145 (Lane D), PC3 (Lane P), and LNCaP (Lane L) prostate cancer cell lines; MDA-MB231 breast cancer cells (Lane M); and 1 µg of human genomic DNA (Lane G). B, control, no cDNA (Lane C), primary epithelial cultures (Lane E), and primary stromal cell cultures (Lane S). R4 indicates the product of the predicted size for FGFR-4 amplified from cDNA (364 bp). The larger (1200-bp) product in the genomic control lane is amplified across introns (leading to a larger product), thus confirming that the smaller product in the cDNA lanes is not a result of genomic DNA contamination of the cDNAs.

 


View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Northern blot analysis of FGFR-4 expression. Northern blot using 1 µg of polyadenylated mRNA from DU145, PC3, and LNCaP cell lines and immortalized normal prostate epithelial cells (PNT1A) was probed with a FGFR-4 probe from the 3'-untranslated region of this gene, washed, and exposed to X-ray film for 2 days. The indicated FGFR-4 band is approximately 3.5 kb. The same filter was stripped and reprobed with glyceraldehyde 3-phosphate dehydrogenase probe (GAPDH), washed, and exposed to X-ray film overnight.

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Members of the FGF family are known to play an important role as growth factors in the normal human prostate (9, 10, 11) . We report here our finding of increased expression of FGF6 in PIN, the precursor of invasive prostate cancer, and in localized and metastatic prostate cancers. FGF6 is expressed at an extremely low level in the basal cells of normal human prostate that is undetectable by RT-PCR or ELISA but can be detected by immunohistochemistry. Given that the basal cells constitute only a small fraction of the total cells in the prostate and that the expression of FGF6 was quite low on immunohistochemistry, it is certainly conceivable that FGF6 expression in normal prostate is below the limits of detection of RT-PCR, although this is a very sensitive technique. In a significant proportion of cases of high-grade PIN, we observed an increased expression of FGF6 by the basal cells that was obvious by immunohistochemistry, and we have confirmed this overexpression by the detection of FGF6 using ELISA. Because the basal cells in PIN are not neoplastic, it is likely that the dysplastic luminal cells directly or indirectly induce the expression of FGF6 by the basal cells. Because FGF6 contains a signal peptide and is actively secreted, the increased production of FGF6 by the basal cells may play a role in the increased proliferation of the dysplastic epithelial cells seen in PIN (18) . To our knowledge, this is the first report of expression of a growth factor by prostatic basal cells in adult prostate and of the increased expression of such a growth factor in PIN.

In the prostate cancer tissues, we have shown increased expression of both FGF6 mRNA and protein. In most cases, FGF6 was localized in the cancer cells by immunohistochemistry, consistent with an autocrine growth stimulation. In two cases, we observed immunoreactive FGF6 primarily in fibroblastic cells, consistent with the induction of FGF6 production by these cells with potential paracrine effects on adjacent cancer cells. A similar mixture of overexpression by both epithelial and stromal cells has been described by Kornmann et al. (19) for the increased expression of FGF5 seen in pancreatic cancer; therefore, this observation is not without precedent. Thus, in prostate cancers, FGF6 that is normally secreted by the basal cells is no longer available as a paracrine growth factor, and in many cases, the cancers appear to have developed mechanisms to compensate for this loss either by autocrine production of FGF6 or by inducing adjacent stromal cells to produce it and, in fact, produce it in larger amounts than in normal tissues. The potential biological importance of the FGF6 overexpression observed is shown by the ability of exogenous FGF6 to promote proliferation of normal, immortalized, and fully transformed prostatic epithelial cells. In addition, by promoting the growth of stromal cells, FGF6 may enhance the production of paracrine growth factors by tumor stroma (20) , which can further promote tumor progression.

FGF6 is normally expressed in the skeletal muscle and may play an important role as a growth factor in that tissue. Studies by Penault-Llorca et al. (21) have shown expression of FGF6 in 3 of 10 breast cancer cell lines and in 15% of primary breast cancer tissues. No FGF6 expression was detected in normal breast tissue. These same authors detected overexpression of FGFR-4 in 32% of primary breast cancers. Expression of FGFR-4 has been shown by others to be present in the majority of breast cancer cell lines (16 , 17) . Given that FGFR-4 is the most potent receptor for FGF6 (2) , a potential autocrine loop involving FGF6 and FGFR-4 may be established in a subset of breast cancers. We have also found expression of FGFR-4 in all three prostate cancer cell lines and in primary prostate epithelial cultures. It should be noted that this expression is relatively low, and we did not detect it previously in the normal prostate (9) ; however, using improved PCR primers allowed us to detect this expression. Chandler et al. (16) have also reported expression of FGFR-4 in DU145 cells using a RNase protection assay, which is consistent with our results, but they found barely detectable expression of FGFR-4 in PC3 cells, whereas we found FGFR-4 expression that was lower than but similar to that seen in DU145 cells. Whether this difference reflects the use of different probes and methods for RNA analysis or differences in the PC3 cells between different laboratories is not clear. It is of interest to note that both prostate (22, 23, 24) and breast cancers (25) have been reported to have increased expression of FGF8, a potent activator of FGFR-4. Thus, in both breast and prostate cancer, there is evidence that autocrine stimulation of FGFR-4 by FGF6 and FGF8 may occur. It is known that the signaling properties of FGFR-4 differ from those of the other FGFRs (26, 27, 28, 29) in that FGFR-4 only weakly stimulates mitogen-activated protein kinase activation (27) and is associated with a unique Mr 85,000 serine kinase (27 , 28) that may be important in FGFR-4 signaling. Johnston et al. (29) have shown that FGFR-4 is the only FGFR that can promote membrane ruffling when tranfected into COS-7 cells. Such membrane ruffling is associated with changes in the actin cytoskeleton related to increased motility. Thus, FGFR-4 activation by autocrine stimulation may be more important in altering motility or other properties when compared with similar stimulation of other FGFRs and may therefore play a unique role in tumor progression.

In addition to FGFR-4, other FGFR isoforms that can respond to FGF6, such as FGFR-1 IIIc and FGFR-2 IIIc (2) are also expressed in prostate cancer cells. We have shown that expression of FGFR-1 is increased, particularly in poorly differentiated prostate cancers (20) , and we have recently found that FGFR-1 is present only as the IIIc isoform in prostate cancers.4 FGFR-1 IIIc could markedly enhance response to FGF6 in those cases where it is expressed. Similarly, there is evidence that the DU145 prostate cancer cell line and some prostate cancer xenografts express the FGFR-2 IIIc isoform (30) that can bind FGF6. However, FGFR-1 IIIc and FGFR-2 IIIc are not expressed in cultured primary prostatic epithelial cells (9) ; therefore, in normal prostatic epithelial cells, most of the mitogenic effect of FGF6 must be through activation of FGFR-4. Additional studies are needed to define the expression of the various FGFR isoforms that bind FGF6 in prostate cancer cells in vivo and the relative importance of each of these receptors in the biological response of prostate cancer cells to FGF6.

In summary, we have found that FGF6 is expressed by normal prostatic basal cells in extremely small amounts, and expression in basal cells is markedly increased in PIN lesions. Approximately half of prostate cancers express FGF6 in the cancer cell themselves or in the tumor stroma. The acquisition of FGF6 expression by the prostate cancers implies but does not prove that it may play a role in cancer cell proliferation or perhaps in other aspects of tumor progression. Other FGFs, such as FGF2 (20) and FGF8 (22, 23, 24) , have also been shown to be increased in prostate cancer, and a number of other growth factors, including EGF and transforming growth factor {alpha} (31) , have also been implicated in prostate cancer. The relative importance of each of these growth factors in prostate cancer progression has yet to be elucidated. Further work will be needed to define the role of the increased expression of FGF6 in human prostate cancer.


    ACKNOWLEDGMENTS
 
We thank Karen Schmidt for skilled technical assistance.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Department of Veterans Affairs Merit Review funding. Back

2 To whom requests for reprints should be addressed, at Research Service, Houston Veterans Affairs Medical Center, 2002 Holcombe Boulevard, Houston, TX 77030. Phone: (713) 791-1414, ext. 4008; Fax: (713) 794-7938; E-mail: mittmann{at}bcm.tmc.edu Back

3 The abbreviations used are: FGF, fibroblast growth factor; FGFR, FGF receptor; RT-PCR, reverse transcription-PCR; PIN, prostatic intraepithelial neoplasia; EGF, epidermal growth factor. Back

4 Unpublished data. Back

Received 11/ 5/99. Accepted 6/ 2/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Johnson D., Williams L. Structural and functional diversity in the FGF receptor multigene family. Adv. Cancer Res., 60: 1-41, 1993.[Medline]
  2. Ornitz D., Xu J., Colvin J., McEwen D., MacArthur C., Coulier F., Gao G., Goldfarb M. Receptor specificity of the fibroblast growth factor family. J. Biol. Chem., 271: 15292-15297, 1996.[Abstract/Free Full Text]
  3. Basilico C., Moscatelli D. The FGF family of growth factors and oncogenes. Adv. Cancer Res., 59: 115-165, 1992.[Medline]
  4. Hector-Schulz S., Haghayegh S. Basic fibroblast growth factor expression in human and murine squamous cell carcinomas and its relationship to regional endothelial cell proliferation. Cancer Res., 53: 1444-1449, 1993.[Abstract/Free Full Text]
  5. Miyake H., Yoshimura K., Hara I., Eto H., Arakawa S., Kamidono S. Basic fibroblast growth factor regulates matrix metalloproteinases production and in vitro invasiveness in human bladder cancer cell lines. J. Urol., 157: 2351-2355, 1997.[Medline]
  6. Galzie Z., Fernig D., Smith J., Poston G., Kinsella A. Invasion of human colorectal carcinoma cells is promoted by endogenous basic fibroblast growth factor. Int. J. Cancer, 71: 390-395, 1997.[Medline]
  7. Ropiquet F., Huguenin S., Villette J. M., Ronfle V., Le Brun G., Maitland N. J., Cussenot O., Fiet J., Berthon P. FGF7/KGF triggers cell transformation and invasion on immortalized human prostatic epithelial PNT1A cells. Int. J. Cancer, 82: 237-243, 1999.[Medline]
  8. Fox J., Shanley J. Antisense inhibition of basic fibroblast growth factor induces apoptosis in vascular smooth muscle cells. J. Biol. Chem., 271: 12578-12584, 1996.[Abstract/Free Full Text]
  9. Ittmann M., Mansukhani A. Expression of fibroblast growth factors (FGFs) and FGF receptors in human prostate. J. Urol., 157: 351-356, 1997.[Medline]
  10. Giri D., Ropiquet F., Ittmann M. FGF9 is an autocrine and paracrine prostatic growth factor expressed by prostatic stromal cells. J. Cell. Physiol., 180: 53-60, 1999.[Medline]
  11. Ropiquet F., Giri D., Lamb D., Ittmann M. FGF7 and FGF2 are increased in benign prostatic hyperplasia and are associated with increased proliferation. J. Urol., 162: 595-599, 1999.[Medline]
  12. Yan G., Fukobori Y., McBride G., Nikolaropolous S., McKeehan W. Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Mol. Cell. Biol., 8: 4513-4522, 1993.
  13. Partanen J., Makela T. P., Eerola E., Korhonen J., Hirvonen H., Claesson-Welsh L., Alitalo K. FGFR-4, a novel acidic fibroblast growth factor receptor with a distinct expression pattern. EMBO J., 10: 1347-1354, 1991.[Medline]
  14. Cussenot O., Berthon P., Berger R., Mowszowicz I., Faille A., Hojman F., Teillac P., Le Duc A., Calvo F. Immortalization of human adult normal prostatic epithelial cells by liposomes containing large T-SV40 gene. J. Urol., 146: 881-886, 1991.[Medline]
  15. de Lapeyriere O., Rosnet O., Benharroch D., Raybaud F., Marchetto S., Planche J., Galland F., Mattei M., Copeland N. G., Jenkins N. A., Coulier F., Birnbaum D. Structure, chromosome mapping and expression of the murine Fgf-6 gene. Oncogene, 5: 823-831, 1990.[Medline]
  16. Chandler L. A., Sosnowski B. A., Greenlees L., Aukerman S. L., Baird A., Pierce G. F. Prevalent expression of fibroblast growth factor (FGF) receptors and FGF2 in human tumor cell lines. Int. J. Cancer, 81: 451-458, 1999.[Medline]
  17. Ron D., Reich R., Chedid M., Lengel C., Cohen O. E., Chan A. M., Neufeld G., Miki T., Tronick S. R. Fibroblast growth factor receptor 4 is a high affinity receptor for both acidic and basic fibroblast growth factor but not for keratinocyte growth factor. J. Biol. Chem., 268: 5388-5394, 1993.[Abstract/Free Full Text]
  18. Harper M. E., Glynne-Jones E., Goddard L., Mathews P., Nicholson R. I. Expression of androgen receptor and growth factors in premalignant lesions of the prostate. J. Pathol., 186: 169-177, 1998.[Medline]
  19. Kornmann M., Ishiwata T., Beger H., Korc M. Fibroblast growth factor-5 stimulates mitogenic signaling and is overexpressed in human pancreatic cancer: evidence for autocrine and paracrine actions. Oncogene, 15: 1417-1424, 1997.[Medline]
  20. Giri D., Ropiquet F., Ittmann M. Alterations in expression of FGF2 and its receptor FGFR-1 in human prostate cancer. Clin. Cancer Res., 5: 1063-1071, 1999.[Abstract/Free Full Text]
  21. Penault-Llorca F., Bertucci F., Adelaide J., Parc P., Coulier F., Jacquemier J., Birnbaum D., DeLapeyiere O. Expression of FGF and FGF receptor genes in human breast cancer. Int. J. Cancer, 61: 170-176, 1995.[Medline]
  22. Leung H., Dickson C., Robson C., Neal D. Overexpression of fibroblast growth factor-8 in human prostate carcinoma. Oncogene, 12: 1833-1835, 1996.[Medline]
  23. Tanaka A., Furuya A., Yamasaki M., Hanai N., Kuriki K., Kamiakito T., Kobayashi Y., Yoshida H., Koike M., Fukayama M. High frequency of fibroblast growth factor (FGF) 8 expression in clinical prostate cancers and breast tissues: immunohistochemically demonstrated by a newly established neutralizing monoclonal antibody against FGF 8. Cancer Res., 58: 2053-2056, 1998.[Abstract/Free Full Text]
  24. Dorkin T. J., Robinson M. C., Marsh C., Bjartell A., Neal D. E., Leung H. Y. FGF8 over-expression in prostate cancer is associated with decreased patient survival and persists in androgen independent disease. Oncogene, 18: 2755-2761, 1999.[Medline]
  25. Marsh S. K., Bansal G. S., Zammit C., Barnard R., Coope R., Roberts-Clarke D., Gomm J. J., Coombes R. C., Johnston C. L. Increased expression of fibroblast growth factor 8 in human breast cancer. Oncogene, 18: 1053-1060, 1999.[Medline]
  26. Wang J. K., Gao G., Goldfarb M. Fibroblast growth factor receptors have different signaling and mitogenic potentials. Mol. Cell. Biol., 14: 181-188, 1994.[Abstract/Free Full Text]
  27. Vainikka S., Joukov V., Wennstrom S., Bergman M., Pelicci P. G., Alitalo K. Signal transduction by fibroblast growth factor receptor-4 (FGFR-4): comparison with FGFR-1. J. Biol. Chem., 269: 18320-18326, 1994.[Abstract/Free Full Text]
  28. Vainikka S., Joukov V., Klint P., Alitalo K. Association of a 85-kDa serine kinase with activated fibroblast growth factor receptor-4. J. Biol. Chem., 271: 1270-1273, 1996.[Abstract/Free Full Text]
  29. Johnston C. L., Cox H. C., Gomm J. J., Coombes R. C. bFGF and aFGF induce membrane ruffling in breast cancer cells but not in normal breast epithelial cells: FGFR-4 involvement. Biochem. J., 306: 609-616, 1995.
  30. Carstens R. P., Eaton J. V., Krigman H. R., Walther P. J., Garcia-Blanco M. A. Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer. Oncogene, 15: 3059-3065, 1997.[Medline]
  31. Sherwood E. R., Lee C. Epidermal growth factor-related peptides and the epidermal growth factor receptor in normal and malignant prostate. World J. Urol., 13: 290-296, 1995.[Medline]



This article has been cited by other articles:


Home page
Endocr. Rev.Home page
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton
Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction
Endocr. Rev., April 1, 2008; 29(2): 193 - 216.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y. Lin, G. Liu, Y. Zhang, Y.-P. Hu, K. Yu, C. Lin, K. McKeehan, J. W. Xuan, D. M. Ornitz, M. M. Shen, et al.
Fibroblast growth factor receptor 2 tyrosine kinase is required for prostatic morphogenesis and the acquisition of strict androgen dependency for adult tissue homeostasis
Development, February 15, 2007; 134(4): 723 - 734.
[Abstract] [Full Text] [PDF]


Home page
Mayo Clin Proc.Home page
P. J. Tebben, K. R. Kalli, W. A. Cliby, L. C. Hartmann, J. P. Grande, R. J. Singh, and R. Kumar
Elevated Fibroblast Growth Factor 23 in Women With Malignant Ovarian Tumors
Mayo Clin. Proc., June 1, 2005; 80(6): 745 - 751.
[Abstract] [PDF]


Home page
Endocr Relat CancerHome page
D M Peehl
Primary cell cultures as models of prostate cancer development
Endocr. Relat. Cancer, March 1, 2005; 12(1): 19 - 47.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
B Kwabi-Addo, M Ozen, and M Ittmann
The role of fibroblast growth factors and their receptors in prostate cancer
Endocr. Relat. Cancer, December 1, 2004; 11(4): 709 - 724.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Wang, D. W. Stockton, and M. Ittmann
The Fibroblast Growth Factor Receptor-4 Arg388 Allele Is Associated with Prostate Cancer Initiation and Progression
Clin. Cancer Res., September 15, 2004; 10(18): 6169 - 6178.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Kwabi-Addo, J. Wang, H. Erdem, A. Vaid, P. Castro, G. Ayala, and M. Ittmann
The Expression of Sprouty1, an Inhibitor of Fibroblast Growth Factor Signal Transduction, Is Decreased in Human Prostate Cancer
Cancer Res., July 15, 2004; 64(14): 4728 - 4735.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Polnaszek, B. Kwabi-Addo, L. E. Peterson, M. Ozen, N. M. Greenberg, S. Ortega, C. Basilico, and M. Ittmann
Fibroblast Growth Factor 2 Promotes Tumor Progression in an Autochthonous Mouse Model of Prostate Cancer
Cancer Res., September 15, 2003; 63(18): 5754 - 5760.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
K. L. Weber and M. C. Gebhardt
What's New in Musculoskeletal Oncology
J. Bone Joint Surg. Am., March 31, 2003; 85(4): 761 - 767.
[Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
M. Ozen, D. Giri, F. Ropiquet, A. Mansukhani, and M. Ittmann
Role of Fibroblast Growth Factor Receptor Signaling in Prostate Cancer Cell Survival
J Natl Cancer Inst, December 5, 2001; 93(23): 1783 - 1790.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ropiquet, F.
Right arrow Articles by Ittmann, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ropiquet, F.
Right arrow Articles by Ittmann, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online