Cancer Research Meeting Calendar  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hopkins-Donaldson, S.
Right arrow Articles by Gross, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hopkins-Donaldson, S.
Right arrow Articles by Gross, N.
[Cancer Research 60, 4315-4319, August 15, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Loss of Caspase-8 Expression in Highly Malignant Human Neuroblastoma Cells Correlates with Resistance to Tumor Necrosis Factor-related Apoptosis-inducing Ligand-induced Apoptosis1

Sally Hopkins-Donaldson, Jean-Luc Bodmer, Katia Balmas Bourloud, Christine Beretta Brognara, Jürg Tschopp and Nicole Gross2

Department of Pediatric Onco-Hematology, Centre Hospitalier Universitaire Vaudois, CH1011 Lausanne [S. H-D., K. B. B., C. B. B., N. G.], and Institute of Biochemistry, University of Lausanne, CH1066 Epalinges [J-L. B., J. T.], Switzerland


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Human neuroblastoma (NB) is a highly heterogeneous childhood cancer that is aggressively malignant or can undergo spontaneous regression that may involve apoptosis. NB-derived cell lines were tested for their sensitivity to apoptosis induced by the tumor-selective ligand tumor necrosis factor-related apoptosis-inducing ligand (TRAIL). Noninvasive S-type cell lines (NB cell lines of substrate adherent phenotype) are highly sensitive to TRAIL, whereas invasive N-type cell lines (NB cell lines of neuronal phenotype) are resistant. Whereas both S- and N-type cell lines express TRAIL-R2, FADD, and caspase-3 and -10, only S-type cells express caspase-8. Reduced levels of caspase-8 protein were also observed in a malignant stage IV NB tumor when compared with a benign ganglioneuroma. The caspase-8 gene is not deleted in either N-type NB cell lines or high-stage NB tumors. Caspase-8 expression can be induced by demethylation with 5-aza-2'deoxycytidine, which enhances sensitivity to TRAIL. Therefore, caspase-8 expression is silenced in malignant NB, which correlates to tumor severity and resistance to TRAIL-induced apoptosis.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
NB3 is one of the most frequent solid tumors of childhood. Spontaneous regressions are common in infants and in early-stage tumors, whereas NB is extremely aggressive in older children with late-stage tumors that are often amplified for the N-MYC oncogene (1) . Little progress has been made in improving the poor prognosis of patients with late-stage NB tumors because resistance to chemotherapy is common. Programmed cell death or apoptosis is associated with both drug-induced and spontaneous tumor remission (2) , and resistance to apoptosis may explain the aggressive behavior of late-stage NB tumors.

TRAIL receptors TRAIL-R1/DR4 and TRAIL-R2/DR5/TRICK are members of the TNF death receptor family that trigger a cascade of events on binding to cell surface TRAIL involving caspase activation and resulting in DNA fragmentation and cell death (3) . In contrast to FasL/CD95L and TNF, which are both toxic after systemic administration, TRAIL has no adverse effects on normal tissues and can selectively kill implanted tumor cells (4) . However, some tumor cells are resistant to TRAIL-induced apoptosis, with the expression of inhibitory molecules such as cFLIP (5) or decoy receptors TRAIL-R3/TRID/DcR1 and TRAIL-R4/DcR2 (6) being proposed as underlying mechanisms of TRAIL resistance. cFLIP overexpression blocks both Fas and TRAIL pathways by preventing the recruitment and activation of the initiator caspase-8 (7) , whereas TRAIL decoy receptors are thought to block TRAIL signaling by competing with TRAIL-R1 and TRAIL-R2. These may not be the only existing mechanisms of resistance to TRAIL because no correlation was found between TRAIL resistance and cFLIP or TRAIL decoy receptor mRNA expression in human melanoma (3 , 8) .

In this study, we investigated the sensitivity of NB cell lines of invasive (N-type) and noninvasive (S-type) phenotypes (9 , 10) to TRAIL and the underlying mechanisms used by invasive NB cells to evade apoptosis.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Cell Culture.
The NB cell lines used in this study are described in detail elsewhere (9) . Cells were cultured in RPMI 1640 and 10% FCS with 2 mM glutamine and 20 µg/ml gentamicin (Life Technologies, Inc.). AzaC was purchased from Sigma.

Primary Antibodies.
Mouse antihuman Fas antibodies were from PharMingen (Becton Dickinson), agonistic mouse antihuman Fas antibodies (clone CH11) were from Upstate Biotechnology, mouse antihuman caspase-8 antibodies were from Medical and Biological Laboratories, and rabbit antihuman caspase-8 antibodies were from Santa Cruz Biotechnology. Mouse anti-FADD and caspase-3 antibodies were obtained from Transduction Laboratories, and mouse anti-caspase-10 antibodies were obtained from Millennium Biotechnology. Anti-TRAIL-R2 (clone AL142) was generated in rabbits by injecting TRAILR2:Fc (Alexis Biochemicals). Mouse anti-N-CAM (UJ13A) was kindly provided by Dr. John Kemshead (Bristol University, Bristol, United Kingdom), and HLA-ABC (B9-12-1) has been described previously (11) .

Cell Viability Assays.
Cells (100 µl; 105 cells/well in 96-well plates) were incubated in the presence of anti-Fas CH11 or soluble recombinant TRAIL and cross-linking mouse anti-FLAG antibody M2 (Alexis Biochemicals). After 16 h, tetrazolium dye solution from the Cell titer kit (Promega) was added, and the production of blue formazan product produced by viable cells was measured at an absorbance of 570 nm. Assays were performed in quadruplicate, mean cell viability was compared with untreated controls, and SDs were calculated. The percentage of cell viability was also evaluated by staining cells with 0.5% crystal violet (Fluka). Absorbance was measured at 570 nm. Each assay was performed at least three times, and the percentage of cell viability compared with untreated controls was calculated. The percentage of cell death was calculated as 100 - the percentage of cell viability.

RT-PCR Analysis.
DNA-free RNA was prepared using the SV total RNA purification kit (Promega). RNA (1 µg) was used in RT-PCR reactions using the Promega Access RT-PCR kit. RNA samples were tested for DNA contamination by 40 cycles of PCR with each pair of primers used. Primers used to amplify Fas, TRAIL-R1, TRAIL-R2, TRAIL-R3, TRAIL-R4, and caspase-10 have been described elsewhere (12, 13, 14) . Primers used to amplify human ß-actin, cFLIP, and caspase-8 cDNA are as follows: (a) ß-actin, (5') TGACGGGGTCACCCACAC TGTGCCCATCTA and (3') CTAGAAGCATTTGCGGTGGACGATGGAGGG; (b) cFLIP, (5') GGAGGCTTATGTCTGCTGAAGTCATC and (3') GGGGAATTCCTTCTGATTCCTGAATGG; and (c) caspase-8, (5') TCTGGAGCATCTGCTGTCTG and (3') CCTGCCTGGTGTCTGAAGTT. RT-PCR reactions were performed using a thermal program of 48°C for 45 min; 94°C for 5 min; 40 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min; and then 72°C for 10 min. A total of 30% of the final PCR products were loaded onto a 1% agarose gel.

Flow Cytometric Analysis.
Cells were washed in FACS buffer (RPMI 1640, 10% FCS, and 2 mM EDTA) and then stained with antihuman Fas MAb or rabbit antihuman TRAIL-R2 antibodies, followed by goat secondary antibodies conjugated to FITC (Caltag Laboratories). A total of 10,000 events were collected on a FACScan II (Becton Dickinson).

Western and Southern Blotting.
Cellular 1% NP40 (30 µg) extracts were boiled in sample buffer and analyzed by 10% SDS-PAGE under reducing conditions and by Western blotting. Blots were saturated with 5% skim milk and 0.5% Tween 20 in PBS and revealed using mouse anti-FADD, anti-caspase-3, anti-caspase-8, or anti-caspase-10 MAbs followed by incubation with peroxidase-conjugated secondary antibody (Jackson ImmunoResearch). Bound antibodies were detected using the enhanced chemiluminescence kit (Amersham International) according to the manufacturer’s instructions. Genomic DNA was isolated by lysis in a solution of 10 mM Tris-HCl (pH 10.5), 1 mM EDTA, 150 mM NaCl, and 0.5% SDS and digested twice for 90 min in 20 mg/ml proteinase K (Boehringer Mannheim) at 56°C, and then two chloroform/phenol extractions were performed. Southern blotting was then carried out as described previously (15) , and nylon filters were hybridized with full-length caspase-8 cDNA or the pNB-1 NMYC probe kindly provided by Dr. M. Schwab (DFKZ, Heidelberg, Germany).

Caspase-3 Activity Assay.
Caspase-3 activity was assayed by mixing 10 µl of post nuclear lysate (30–40 µg protein) with 10 volumes of reaction buffer [10 mM Tris-HCl (pH 7.4), 0.1% 3-[(3-cholamidopropyl)dimethylammonio]-1 -propanesulfonic acid, 2 mM MgCl2, 1 mM DTT, 5 mM EGTA, and 150 mM NaCl] containing 50 µM of a fluorogenic caspase-3 substrate (Ac-DEVD-AMC; Alexis Biochemicals). The mixture was incubated for 60 min in a black ELISA titer plate, and fluorescence was measured in a Fluoroskan ELISA reader (excitation, 355 nm; emission, 460 nm). The caspase-3 activity was expressed as a fold increase compared with nontreated cells, and background was deduced using the lysis buffer as a control. All values are normalized with respect to the protein content in the sample measured by the Bio-Rad protein assay.

Immunohistochemistry.
Frozen sections (7 µm) were fixed in acetone, permeabilized for caspase-8 staining in 1% Triton X-100 in Tris-buffered saline, blocked in 2 g/liter BSA, and then incubated overnight with rabbit anti-caspase-8 antibodies, followed by biotinylated goat anti-rabbit antibody (DAKO) and avidin-alkaline phosphatase conjugate (ABComplex, DAKO). Color was developed using Fast Red TR/Napthol AS-MX (Sigma), followed by counterstaining with hematoxylin. For N-CAM and HLA class 1 staining, frozen sections were fixed and blocked as described above and incubated for 2 h in primary antibody followed by rabbit anti-mouse alkaline phosphatase and swine anti-rabbit antibody coupled to alkaline phosphatase (DAKO) before substrate development as described above.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
We first tested the sensitivity of NB cell lines of invasive (N-type) and noninvasive (S-type) phenotypes to TRAIL-mediated apoptosis using cell viability tests. Cells were incubated with cross-linked soluble recombinant human TRAIL or with agonistic mouse anti-Fas antibody CH11, and cell viability tests were performed after 16 h. In contrast to Jurkat T cells, all NB cell lines were resistant to Fas-mediated apoptosis (Fig. 1ACitation ). N-type cell lines that have high tumorigenic indices in nude mice (10) were also resistant to TRAIL-induced cell death. In contrast, noninvasive S-type cells were extremely sensitive to TRAIL-induced cell death, even at doses as low as 1 ng/ml (Fig. 1BCitation ).



View larger version (37K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Sensitivity of NB cell lines to Fas- and TRAIL-mediated apoptosis and expression of death receptors. A, NB cells incubated for 16 h with medium ({square}), 100 ng/ml anti-Fas MAb (), or 100 ng/ml cross-linked soluble TRAIL ({blacksquare}). Tests were performed in quadruplicate, and means and SDs were calculated. B, percentage of cell viability of S-type cell lines SH-EP ({square}), SH-310 ({circ}), and CA-2-E ({diamond}) and N-type cell line LAN-1 ({blacksquare}) after incubation with doubling dilutions of cross-linked TRAIL was calculated by comparison with untreated controls. C, RT-PCR analysis of human Fas, TRAIL-R1, TRAIL-R2, TRAIL-R3, and ß-actin RNA expression in NB cell lines. Lanes 1–3 depict S-type NB cell lines SH-EP, SH-310, and CA-2-E; Lanes 4–6 represent N-type cell lines IMR-32, LAN-1, and SH-SY5Y. The first (Lane C) and last (Lane -) lanes represent RT-PCR reactions using Jurkat T-cell RNA with and without reverse transcriptase, respectively. D, flow cytometry of Fas and TRAIL-R2 expression. Cells were labeled with primary antibodies and FITC-conjugated goat secondary antibodies (black peaks). Cells stained with secondary antibodies alone represent negative controls (white peaks).

 
We investigated the mechanisms underlying N-type NB cell resistance to TRAIL and FasL by measuring the expression of death receptors and downstream signaling molecules. The expression of TRAIL-R1, TRAIL-R2, and Fas in addition to that of decoy receptors TRAIL-R3 and TRAIL-R4 was measured in NB cell lines by RT-PCR or FACS analysis. S-type cells expressed Fas mRNA and moderate levels of surface Fas protein, whereas no expression could be detected in any of the N-type cell lines (Fig. 1 and DCitation ). Down-regulation of surface Fas expression has been described for other cancers (16) and may be a common mechanism of resistance to Fas-mediated apoptosis used by tumor cells. In contrast, TRAIL receptors could be detected on all cell types; S-type cells expressed mRNA specific for TRAIL-R1, TRAIL-R2, and TRAIL-R3, whereas N-type cells expressed only TRAIL-R2 mRNA (Fig. 1CCitation ). TRAIL-R4 mRNA was not detected in any of the cell lines, although RT-PCR of control TRAIL-R4 cDNA gave a positive signal (data not shown). FACS analysis demonstrated very high levels of surface TRAIL-R2 on S-type cells, whereas N-type cells expressed slightly lower levels that were comparable with TRAIL-R2 expression by Jurkat T cells (Fig. 1DCitation ). The findings that S-type cells express surface Fas and TRAIL receptors but are uniquely sensitive to TRAIL suggest that the Fas pathway is not functional in these cells. The lack of decoy receptor mRNA expression in N-type cells excluded the possibility that TRAIL-R3 or TRAIL-R4 was responsible for N-type cell resistance to TRAIL.

Expression of signaling molecules downstream of TRAIL death receptors was then examined. Caspase-3, caspase-8, and caspase-10 are involved in both Fas- and TRAIL-mediated apoptosis, with cFLIP being a negative regulator of both pathways. Adaptor potein FADD is essential for Fas-mediated cell death (17) and TRAIL-R2-mediated cell death (18) . Both Jurkat T cells and S-type NB cells expressed cFLIP mRNA, whereas no cFLIP mRNA could be detected in N-type cells (Fig. 2ACitation ). It is unlikely that cFLIP inhibits TRAIL-mediated apoptosis in S-type cells because they undergo extensive cell death at low doses of TRAIL. In contrast, cFLIP may contribute to the resistance of S-type cells to Fas-mediated apoptosis because its expression is known to be more crucial in reducing sensitivity to Fas-induced cell death than reduced levels of Fas on the cell surface (7 , 19) . Expression of FADD and of caspases-3 and -10 was detected by Western blotting in both S-type and N-type cells at levels comparable to those in Jurkat T cells (Fig. 2BCitation ). Surprisingly, neither caspase-8 mRNA nor protein was present in N-type cells, although they were readily detectable in S-type cells (Fig. 2 and BCitation ).



View larger version (40K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Expression of downstream signaling molecules by NB cell lines. A, RT-PCR analysis of caspase-8, caspase-10, and cFLIP expression. Lanes 1–3 depict S-type cells SH-EP, SH-310, and CA-2-E; Lanes 4–6 represent N-type cells IMR-32, LAN-1, and SH-SY5Y. The first (Lane C) and last (Lane -) lanes represent RT-PCR reactions using Jurkat T-cell RNA with and without reverse transcriptase, respectively. B, Western blot analysis of cell lysates separated by 10% SDS-PAGE. Membranes were probed with antibodies specific for human FADD, caspase-3, caspase-8, and caspase-10. Lanes 1–3 depict S-type cells SH-EP, SH-310, and CA-2-E; Lanes 4–6 represent N-type cells IMR-32, LAN-1, and SH-SY5Y. The last lane (Lane C) represents Jurkat T-cell lysate. C, TRAIL-induced cleavage of caspase-3 and caspase-8 was measured by Western blot analysis of cell lysates of SH-EP and LAN-1 cells treated with 100 ng/ml cross-linked TRAIL for the indicated times, with untreated controls in Lane C. D, TRAIL-induced caspase-3 activity in SH-EP (•) and LAN-1 cells ({circ}) after incubation with 100 ng/ml cross-linked TRAIL for the indicated times.

 
Caspases-3 and -8 were activated efficiently in S-type SH-EP cells after a 1-h incubation with TRAIL, when cleaved fragments of the activated caspases could be detected (Fig. 2CCitation ). In contrast, caspase-3 was not cleaved after incubation with TRAIL in N-type LAN-1 cells that do not express caspase-8. In agreement with these findings, caspase-3 activity after TRAIL treatment was found only in S-type cells (Fig. 2DCitation ). No caspase-10 processing was observed in either cell type (data not shown). Caspase-8 is essential for the initiation of the Fas and TNF apoptotic pathways (20) , and we propose that it is also important for TRAIL-induced cell death in NB cells because caspase-8 cleavage occurs soon after the addition of TRAIL in S-type cells and coincides with caspase-3 cleavage and activation. We tested a total of 11 NB cell lines (4 S-type and 7 N-type cell lines) for TRAIL sensitivity and caspase-8 expression, and we found that all S-type cell lines expressed caspase-8 and were sensitive to TRAIL, whereas all N-type cell lines did not express caspase-8 and were TRAIL resistant (data not shown). The amplification of the N-MYC oncogene in these cell lines did not correlate with down-regulation of caspase-8 expression or TRAIL resistance, suggesting that N-MYC is not involved in this phenomenon.

The in vivo expression of caspase-8 by malignant NB tumors was investigated by immunocytochemistry comparing a malignant NB stage IV tumor with a benign ganglioneuroma (Fig. 3CCitation ). The expression of N-CAM, a neural adhesion molecule that is strongly expressed by NB and related neuroectoderm-derived tumors (21) , and the MHC class I molecules (HLA-I), which are lacking in late-stage NB tumor cells (11) , is also shown (Fig. 3 and BCitation ). Sections of ganglioneuroma gave homogeneously positive stainings for N-CAM, HLA-I, and caspase-8. The malignant NB stage IV tumor was positive for N-CAM and negative for HLA-I and expressed only low levels of caspase-8, whereas regions of normal cells surrounding the tumor were observed to be N-CAM negative and HLA-I and caspase-8 positive. Therefore, as observed for N-type NB cells, caspase-8 expression appears to be reduced in late-stage NB tumors. In contrast, more differentiated ganglioneuromas are similar to S-type cells in that they express both caspase-8 and HLA-I. The fact that a subset of malignant NB tumors down-regulates the expression of caspase-8, which is a key initiator of death receptor-mediated apoptosis, could explain their highly aggressive behavior and thei resistance to most treatment regimens (1) . Whereas our study is the first to provide evidence that caspase-8 expression is absent in aggressive neuroblastomas, lower levels of caspase-1 and -3 have been measured in high-stage NB tumors, compared with those of lower stages (22) . In addition to the absence of HLA-I, the down-regulation of caspase expression could therefore be a general mechanism used by NB cells to evade immune attack.



View larger version (126K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Caspase-8 expression in tumors of neuroectoderm origin. Alkaline phosphatase staining of a benign ganglioneuroma and a stage IV NB tumor with antibodies specific for (A) N-CAM, (B) HLA-1, (C) caspase-8, and (D) control rabbit IgG and counterstained with hematoxylin. Note that the ganglioneuroma is homogenously positive (red) for all three markers, whereas the NB stage IV tumor has zones of N-CAM-positive and HLA-1- and caspase-8 negative (blue) tumor surrounded by N-CAM-negative and HLA-1- and caspase-8 positive normal cells (magnification, x250).

 
The caspase-8 gene is located at chromosome locus 2q33 (15 , 23) , a region of loss of heterozygosity in several cancers including neuroblastoma (24) . It was therefore possible that the absence of expression of caspase-8 observed in N-type cells and stage IV tumors was due to a homozygous deletion at this locus. However, for both N- and S-type cells, HindIII generated polymorphic DNA fragments of 4, 7 and 7.2 kb that hybridized to caspase-8 cDNA (Fig. 4Citation A), as has been described previously (15) . Genomic DNA derived from one localized stage II tumor sample and two stage IV tumor samples digested with EcoRI was also investigated for the presence of caspase-8. In all tumor samples, polymorphic fragments of 4 and 8 kb hybridized to the caspase-8 probe (Fig. 4BCitation ). Because no large homozygous deletions were detected in the caspase-8 gene, it seemed more likely that the absence of expression was due to the inhibition of caspase-8 mRNA synthesis. Indeed, incubation of N-type SH-SY5Y cells for 24 h with 3 µM AzaC, a demethylating agent, induced the expression of caspase-8 protein (Fig. 4CCitation ). This suggests that the caspase-8 promoter is hypermethylated, a mechanism of gene regulation that has been proposed for the down-regulation of Fas expression by oncogenic Ras (16) . Treatment with AzaC induced cell death in SH-SY5Y cells (Fig. 4DCitation ), probably as a result of the expression caspase-8 or other methylated genes. However, preincubation of SH-SY5Y cells with AzaC did enhance their sensitivity to TRAIL-mediated cell death, suggesting that caspase-8 expression is required for the TRAIL pathway to function in NB cells.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Detection of the caspase-8 gene in NB cell lines and tumors and the induction of caspase-8 protein synthesis by demethylation. A, Southern blot of NB cell line genomic DNA digested with HindIII and probed with full-length caspase 8 cDNA probe. Lanes 1–3 depict S-type cells SH-EP, SH-310, and CA-2-E; Lanes 4–6 represent N-type cells IMR-32, LAN-1, and SH-SY5Y. The first lane (Lane C) represents Jurkat T cells. B, Southern blot of genomic DNA derived from three NB patients with stage II or IV disease digested with EcoRI and probed with caspase-8. C, caspase-8 expression in N-type cell line SH-SY5Y after treatment with AzaC as measured by Western blot. Lanes 1 and 3 depict untreated SH-EP and SH-SY5Y cell lines, respectively, whereas Lanes 2 and 4 depict SH-EP and SH-SY5Y cell lines, respectively, after a 24-h incubation with 3 µM AzaC. D, SH-SY5Y cells were treated with 3 µM AzaC ( and {blacksquare}) or medium alone ({square}) for 24 h and then incubated in medium without AzaC for 48 h. A total of 105 cells/well in a 96-well plate were then treated with 100 ng/ml cross-linked soluble TRAIL for 16 h ({square} and {blacksquare}) or medium (), and the percentage of cell death was determined by crystal violet staining.

 
In conclusion, malignant NB cells lack caspase-8 expression, which correlates to their tumorigenicity and resistance to TRAIL and may be due to hypermethylation of the caspase-8 promoter. In contrast, noninvasive NB cells express caspase-8 and are susceptible to TRAIL. Caspase-8 down-regulation may explain the aggressive behavior of high-stage NB, whereas the high sensitivity of noninvasive NB cells to TRAIL may account for the spontaneous regression of low-stage tumors in vivo. Combined therapy including TRAIL and agents such as AzaC that induce in caspase-8 expression may be more successful, in addition to treatment with agents that induce apoptosis via caspase-8-independent mechanisms.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by grants from the Antoine Leenaards Foundation, the Swiss National Scientific Foundation, and the FORCE Foundation. Back

2 To whom requests for reprints should be addressed, at Department of Pediatric Onco-Hematology, Centre Hospitalier Universitaire Vaudois, CH-1011 Lausanne, Switzerland. Phone: 021-314-3622; Fax: 021-314-3558; E-mail: ngross{at}chuv.hospvd.ch Back

3 The abbreviations used are: NB, human neuroblastoma; TRAIL, tumor necrosis factor-related apoptosis-inducing ligand; TNF, tumor necrosis factor; RT-PCR, reverse transcription-PCR; MAb, monoclonal antibody; FACS, fluorescence-activated cell-sorting; AzaC, 5-aza-2'-deoxycytidine; c-Flip, cellular Flice inhibitory protein; FasL, Fas ligand; N-CAM, neural cell adhesion molecule; HLA-I, class I molecules. Back

Received 3/17/00. Accepted 6/28/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Brodeur G. M. Molecular basis for heterogeneity in human neuroblastomas. Eur. J. Cancer, 4: 505-510, 1995.
  2. Nakagawara A. Molecular basis of spontaneous regression of neuroblastoma: role of neurotrophic signals and genetic abnormalities. Hum. Cell., 3: 115-124, 1998.
  3. Griffith T. S., Lynch D. H. TRAIL: a molecule with multiple receptors and control mechanisms. Curr. Opin. Immunol., 10: 559-563, 1998.[Medline]
  4. Ashkenazi A., Pai R. C., Fong S., Leung S., Lawrence D. A., Marsters S. A., Blackie C., Chang L., McMurtrey A. E., Herbert A., DeForge L., Koumenis I. L., Lewis D., Harris L., Bussiere J., Koeppen H., Shahrokh Z., Schawdall R. H. Safety and antitumor activity of recombinant soluble Apo2 ligand. J. Clin. Invest., 104: 155-162, 1999.[Medline]
  5. Irmler M., Thome M., Hahne M., Schneider P., Hofmann K., Steiner V., Bodmer J-L., Schroter M., Burns K., Mattmann C., Rimoldi D., French L. E., Tschopp J. Inhibition of death receptor signals by cellular FLIP. Nature (Lond.), 388: 190-195, 1997.[Medline]
  6. Ashkenazi A., Dixit V. M. Death receptors: signaling and modulation. Science (Washington DC), 281: 1305-1308, 1998.[Abstract/Free Full Text]
  7. Medema J. P., de Jong J., van Hall T., Melief C. J., Offringa R. Immune escape of tumors in vivo by expression of cellular FLICE-inhibitory protein. J. Exp. Med., 190: 1033-1038, 1999.[Abstract/Free Full Text]
  8. Dong Zhang, X., Franco A., Myers K., Gray C., Nguyen T., Hersey P. Relation of TNF-related apoptosis-inducing ligand (TRAIL) receptor and FLICE-inhibitory protein expression to TRAIL-induced apoptosis in melanoma. Cancer Res., 59: 2747-2753, 1999.[Abstract/Free Full Text]
  9. Thiele C. J. Neuroblastoma Masters J. R. W. Palsson B. eds. . Human Cell Culture, : 21-53, Kluwer Academic Publishers United Kingdom 1999.
  10. La Quaglia M. P., Manchester K. M. A comparative analysis of neuroblastic and substrate-adherent human neuroblastoma cell lines. J. Pediatr. Surg., 31: 315-318, 1996.[Medline]
  11. Gross N., Favre S., Beck D., Meyer M. Differentiation-related expression of adhesion molecules and receptors on human neuroblastoma tissues, cell lines and variants. Int. J. Cancer, 52: 85-91, 1992.[Medline]
  12. Griffith T. S., Chin W. A., Jackson G. C., Lynch D. H., Kubin M. Z. Intracellular regulation of TRAIL-induced apoptosis in human melanoma cells. J. Immunol., 161: 2833-2840, 1998.[Abstract/Free Full Text]
  13. O’Connell J., O’Sullivan G. C., Collins J. K., Shanahan F. The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J. Exp. Med., 184: 1075-1082, 1996.[Abstract/Free Full Text]
  14. Ng P. W., Porter A. G., Janicke R. U. Molecular cloning and characterization of two novel pro-apoptotic isoforms of caspase-10. J. Biol. Chem., 274: 10301-10308, 1999.[Abstract/Free Full Text]
  15. Grenet J., Teitz T., Wei T., Valentine V., Kidd V. J. Structure and chromosome localization of the human CASP8 gene. Gene (Amst.), 226: 225-232, 1999.[Medline]
  16. Peli J., Schroter M., Rudaz C., Hahne M., Meyer C., Reichmann E., Tschopp J. Oncogenic Ras inhibits Fas ligand-mediated apoptosis by downregulating the expression of Fas. EMBO J., 18: 1824-1831, 1999.[Medline]
  17. Zhang J., Cado D., Chen A., Kabra N. H., Winoto A. Fas-mediated apoptosis and activation-induced T-cell proliferation are defective in mice lacking FADD/Mort1. Nature (Lond.), 392: 296-300, 1998.[Medline]
  18. Bodmer J. L., Holler N., Reynard S., Vinciguerra P., Schneider P., Juo P., Blenis J., Tschopp J. TRAIL receptor-2 signals apoptosis through FADD and caspase-8. Nat. Cell Biol., 2: 241-243, 2000.[Medline]
  19. Djerbi M., Screpanti V., Irinel Catrina, A., Bogen B., Biberfield P., Grandien A. The inhibitor of death receptor signaling, FLICE-inhibitory protein defines a new class of tumor progression factors. J. Exp. Med., 190: 1025-1031, 2000.[Abstract/Free Full Text]
  20. Varfolomeev E. E., Schuchmann M., Luria V., Chiannilkulchai N., Beckmann J. S., Mett I. L., Rebrikov D., Brodianski V. M., Kemper O. C., Kollet O., Lapidont T., Soffer D., Sobe T., Avraham K. B., Goncharov T., Holtmann H., Lonai P., Wallach D. Targeted disruption of the mouse caspase 8 gene ablates cell death induction by the TNF receptors, Fas/Apo1, and DR3 and is lethal prenatally. Immunity, 9: 267-276, 1998.[Medline]
  21. Cunningham B. A., Hemperly J. J., Murray B. A., Prediger E. A., Brackenbury R., Edelman G. M. Neural cell adhesion molecule: structure, immunoglobulin-like domains, cell surface modulation, and alternative RNA splicing. Science (Washington DC), 236: 799-806, 1987.[Abstract/Free Full Text]
  22. Nakagawara A., Nakamura Y., Ikeda H., Hiwasa T., Kuida K., Su M. S., Zhao H., Cnaan A., Sakiyama S. High levels of expression and nuclear localization of interleukin-1ß converting enzyme (ICE) and CPP32 in favorable human neuroblastomas. Cancer Res., 57: 4578-4584, 1997.[Abstract/Free Full Text]
  23. Rasper D., Vaillancourt J. P., Hadano S., Houtzager V. M., Seiden I., Keen S. L., Tawa P., Xanthoudakis S., Nasir J., Martindale D., Koop B. F., Peterson E. P., Thornberry N. A., Huang J., MacPherson D. P., Black S. C., Hornung F., Lenardo M. J., Hayden M. R., Roy S., Nicholson D. W. Cell death attenuation by "Usurpin," a mammalian DED-caspase homologue that precludes caspase-8 recruitment and activation by the CD95 (Fas/Apo-1) receptor complex. Cell Death Differ., 5: 271-288, 1998.[Medline]
  24. Takita J., Hayashi Y., Kohno T., Shiseki M., Yamaguchi N., Hanada R., Yamamoto K., Yokota J. Allelotype of neuroblastoma. Oncogene, 11: 1829-1834, 1995.[Medline]



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H.-L. Xu, W.-H. Xu, Q. Cai, M. Feng, J. Long, W. Zheng, Y.-B. Xiang, and X.-O. Shu
Polymorphisms and Haplotypes in the Caspase-3, Caspase-7, and Caspase-8 Genes and Risk for Endometrial Cancer: A Population-Based, Case-Control Study in a Chinese Population
Cancer Epidemiol. Biomarkers Prev., July 1, 2009; 18(7): 2114 - 2122.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Shenoy, Y. Wu, and S. Pervaiz
LY303511 Enhances TRAIL Sensitivity of SHEP-1 Neuroblastoma Cells via Hydrogen Peroxide-Mediated Mitogen-Activated Protein Kinase Activation and Up-regulation of Death Receptors
Cancer Res., March 1, 2009; 69(5): 1941 - 1950.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
L. C. Li, J. R. Sheng, N. Mulherkar, B. S. Prabhakar, and M. N. Meriggioli
Regulation of Apoptosis and Caspase-8 Expression in Neuroblastoma Cells by Isoforms of the IG20 Gene
Cancer Res., September 15, 2008; 68(18): 7352 - 7361.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. La, Y. Yang, S. K. Karnik, A. C. Silva, R. W. Schnepp, S. K. Kim, and X. Hua
Menin-mediated Caspase 8 Expression in Suppressing Multiple Endocrine Neoplasia Type 1
J. Biol. Chem., October 26, 2007; 282(43): 31332 - 31340.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
P. Yang, J. J. Peairs, R. Tano, N. Zhang, J. Tyrell, and G. J. Jaffe
Caspase-8-Mediated Apoptosis in Human RPE Cells
Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3341 - 3349.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
A. Lissat, T. Vraetz, M. Tsokos, R. Klein, M. Braun, N. Koutelia, P. Fisch, M. E. Romero, L. Long, P. Noellke, et al.
Interferon-{gamma} Sensitizes Resistant Ewing's Sarcoma Cells to Tumor Necrosis Factor Apoptosis-Inducing Ligand-Induced Apoptosis by Up-Regulation of Caspase-8 Without Altering Chemosensitivity
Am. J. Pathol., June 1, 2007; 170(6): 1917 - 1930.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. De Geer, R. Kiessling, V. Levitsky, and J. Levitskaya
Cytotoxic T Lymphocytes Induce Caspase-Dependent and -Independent Cell Death in Neuroblastomas in a MHC-Nonrestricted Fashion
J. Immunol., December 1, 2006; 177(11): 7540 - 7550.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Fulda, C. Poremba, B. Berwanger, S. Hacker, M. Eilers, H. Christiansen, B. Hero, and K.-M. Debatin
Loss of Caspase-8 Expression Does Not Correlate with MYCN Amplification, Aggressive Disease, or Prognosis in Neuroblastoma.
Cancer Res., October 15, 2006; 66(20): 10016 - 10023.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
Y.-C. Li, C.-C. Tzeng, J. H. Song, F.-J. Tsia, L.-J. Hsieh, S.-J. Liao, C.-H. Tsai, E. G. Van Meir, C. Hao, and C.-C. Lin
Genomic alterations in human malignant glioma cells associate with the cell resistance to the combination treatment with tumor necrosis factor-related apoptosis-inducing ligand and chemotherapy.
Clin. Cancer Res., May 1, 2006; 12(9): 2716 - 2729.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Eramo, R. Pallini, F. Lotti, G. Sette, M. Patti, M. Bartucci, L. Ricci-Vitiani, M. Signore, G. Stassi, L. M. Larocca, et al.
Inhibition of DNA Methylation Sensitizes Glioblastoma for Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Mediated Destruction
Cancer Res., December 15, 2005; 65(24): 11469 - 11477.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Cui, T. Li, and H.-F. Ding
Linking of N-Myc to Death Receptor Machinery in Neuroblastoma Cells
J. Biol. Chem., March 11, 2005; 280(10): 9474 - 9481.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
V. Poulaki, C. S. Mitsiades, C. McMullan, G. Fanourakis, J. Negri, A. Goudopoulou, I. X. Halikias, G. Voutsinas, S. Tseleni-Balafouta, J. W. Miller, et al.
Human Retinoblastoma Cells Are Resistant to Apoptosis Induced by Death Receptors: Role of Caspase-8 Gene Silencing
Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 358 - 366.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
P. A. Svingen, D. Loegering, J. Rodriquez, X. W. Meng, P. W. Mesner Jr., S. Holbeck, A. Monks, S. Krajewski, D. A. Scudiero, E. A. Sausville, et al.
Components of the Cell Death Machine and Drug Sensitivity of the National Cancer Institute Cell Line Panel
Clin. Cancer Res., October 15, 2004; 10(20): 6807 - 6820.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Mirandola, C. Ponti, G. Gobbi, I. Sponzilli, M. Vaccarezza, L. Cocco, G. Zauli, P. Secchiero, F. A. Manzoli, and M. Vitale
Activated human NK and CD8+ T cells express both TNF-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors but are resistant to TRAIL-mediated cytotoxicity
Blood, October 15, 2004; 104(8): 2418 - 2424.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
F. B. Baumann Kubetzko, C. di Paolo, C. Maag, R. Meier, B. W. Schafer, D. R. Betts, R. A. Stahel, and A. Himmelmann
The PAX5 oncogene is expressed in N-type neuroblastoma cells and increases tumorigenicity of a S-type cell line
Carcinogenesis, October 1, 2004; 25(10): 1839 - 1846.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Ruiz-Ruiz, C. Ruiz de Almodovar, A. Rodriguez, G. Ortiz-Ferron, J. M. Redondo, and A. Lopez-Rivas
The Up-regulation of Human Caspase-8 by Interferon-{gamma} in Breast Tumor Cells Requires the Induction and Action of the Transcription Factor Interferon Regulatory Factor-1
J. Biol. Chem., May 7, 2004; 279(19): 19712 - 19720.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Karlsson, I. Ora, I. Porn-Ares, and S. Pahlman
Arsenic Trioxide-Induced Death of Neuroblastoma Cells Involves Activation of Bax and Does Not Require p53
Clin. Cancer Res., May 1, 2004; 10(9): 3179 - 3188.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Bian, T. D. Giordano, H.-J. Lin, G. Solomon, V. P. Castle, and A. W. Opipari Jr.
Chemotherapy-induced Apoptosis of S-type Neuroblastoma Cells Requires Caspase-9 and Is Augmented by CD95/Fas Stimulation
J. Biol. Chem., February 6, 2004; 279(6): 4663 - 4669.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
I. Wittke, R. Wiedemeyer, A. Pillmann, L. Savelyeva, F. Westermann, and M. Schwab
Neuroblastoma-Derived Sulfhydryl Oxidase, a New Member of the Sulfhydryl Oxidase/Quiescin6 Family, Regulates Sensitization to Interferon {gamma}-Induced Cell Death in Human Neuroblastoma Cells
Cancer Res., November 15, 2003; 63(22): 7742 - 7752.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X. Yang, M. S. Merchant, M. E. Romero, M. Tsokos, L. H. Wexler, U. Kontny, C. L. Mackall, and C. J. Thiele
Induction of Caspase 8 by Interferon {gamma} Renders Some Neuroblastoma (NB) Cells Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) but Reveals That a Lack of Membrane TR1/TR2 Also Contributes to TRAIL Resistance in NB
Cancer Res., March 1, 2003; 63(5): 1122 - 1129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Higuchi, J.-H. Yoon, A. Grambihler, N. Werneburg, S. F. Bronk, and G. J. Gores
Bile Acids Stimulate cFLIP Phosphorylation Enhancing TRAIL-mediated Apoptosis
J. Biol. Chem., January 3, 2003; 278(1): 454 - 461.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. M. van Noesel, S. van Bezouw, G. S. Salomons, P. A. Voute, R. Pieters, S. B. Baylin, J. G. Herman, and R. Versteeg
Tumor-specific Down-Regulation of the Tumor Necrosis Factor-related Apoptosis-inducing Ligand Decoy Receptors DcR1 and DcR2 Is Associated with Dense Promoter Hypermethylation
Cancer Res., April 1, 2002; 62(7): 2157 - 2161.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Nishimura, M. Adachi, T. Ishida, T. Matsunaga, H. Uchida, H. Hamada, and K. Imai
Adenovirus-mediated Transfection of Caspase-8 Augments Anoikis and Inhibits Peritoneal Dissemination of Human Gastric Carcinoma Cells
Cancer Res., October 1, 2001; 61(19): 7009 - 7014.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. F. Burns and W. S. El-Deiry
Identification of Inhibitors of TRAIL-induced Death (ITIDs) in the TRAIL-sensitive Colon Carcinoma Cell Line SW480 Using a Genetic Approach
J. Biol. Chem., October 5, 2001; 276(41): 37879 - 37886.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hopkins-Donaldson, S.
Right arrow Articles by Gross, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hopkins-Donaldson, S.
Right arrow Articles by Gross, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online