| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Pediatric Onco-Hematology, Centre Hospitalier Universitaire Vaudois, CH1011 Lausanne [S. H-D., K. B. B., C. B. B., N. G.], and Institute of Biochemistry, University of Lausanne, CH1066 Epalinges [J-L. B., J. T.], Switzerland
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
TRAIL receptors TRAIL-R1/DR4 and TRAIL-R2/DR5/TRICK are members of the TNF death receptor family that trigger a cascade of events on binding to cell surface TRAIL involving caspase activation and resulting in DNA fragmentation and cell death (3) . In contrast to FasL/CD95L and TNF, which are both toxic after systemic administration, TRAIL has no adverse effects on normal tissues and can selectively kill implanted tumor cells (4) . However, some tumor cells are resistant to TRAIL-induced apoptosis, with the expression of inhibitory molecules such as cFLIP (5) or decoy receptors TRAIL-R3/TRID/DcR1 and TRAIL-R4/DcR2 (6) being proposed as underlying mechanisms of TRAIL resistance. cFLIP overexpression blocks both Fas and TRAIL pathways by preventing the recruitment and activation of the initiator caspase-8 (7) , whereas TRAIL decoy receptors are thought to block TRAIL signaling by competing with TRAIL-R1 and TRAIL-R2. These may not be the only existing mechanisms of resistance to TRAIL because no correlation was found between TRAIL resistance and cFLIP or TRAIL decoy receptor mRNA expression in human melanoma (3 , 8) .
In this study, we investigated the sensitivity of NB cell lines of invasive (N-type) and noninvasive (S-type) phenotypes (9 , 10) to TRAIL and the underlying mechanisms used by invasive NB cells to evade apoptosis.
| Materials and Methods |
|---|
|
|
|---|
Primary Antibodies.
Mouse antihuman Fas antibodies were from PharMingen (Becton
Dickinson), agonistic mouse antihuman Fas antibodies (clone CH11) were
from Upstate Biotechnology, mouse antihuman caspase-8 antibodies were
from Medical and Biological Laboratories, and rabbit antihuman
caspase-8 antibodies were from Santa Cruz Biotechnology. Mouse
anti-FADD and caspase-3 antibodies were obtained from Transduction
Laboratories, and mouse anti-caspase-10 antibodies were obtained from
Millennium Biotechnology. Anti-TRAIL-R2 (clone AL142) was
generated in rabbits by injecting TRAILR2:Fc (Alexis Biochemicals).
Mouse anti-N-CAM (UJ13A) was kindly provided by Dr. John
Kemshead (Bristol University, Bristol, United Kingdom), and
HLA-ABC (B9-12-1) has been described previously (11)
.
Cell Viability Assays.
Cells (100 µl; 105 cells/well in 96-well
plates) were incubated in the presence of anti-Fas CH11 or soluble
recombinant TRAIL and cross-linking mouse anti-FLAG antibody M2 (Alexis
Biochemicals). After 16 h, tetrazolium dye solution from the Cell
titer kit (Promega) was added, and the production of blue formazan
product produced by viable cells was measured at an absorbance of
570 nm. Assays were performed in quadruplicate, mean cell viability was
compared with untreated controls, and SDs were calculated. The
percentage of cell viability was also evaluated by staining cells with
0.5% crystal violet (Fluka). Absorbance was measured at 570 nm. Each
assay was performed at least three times, and the percentage of cell
viability compared with untreated controls was calculated. The
percentage of cell death was calculated as 100 - the
percentage of cell viability.
RT-PCR Analysis.
DNA-free RNA was prepared using the SV total RNA purification
kit (Promega). RNA (1 µg) was used in RT-PCR reactions using the
Promega Access RT-PCR kit. RNA samples were tested for DNA
contamination by 40 cycles of PCR with each pair of primers used.
Primers used to amplify Fas, TRAIL-R1, TRAIL-R2, TRAIL-R3, TRAIL-R4,
and caspase-10 have been described elsewhere (12, 13, 14)
.
Primers used to amplify human ß-actin, cFLIP, and caspase-8 cDNA are
as follows: (a) ß-actin, (5') TGACGGGGTCACCCACAC
TGTGCCCATCTA and (3') CTAGAAGCATTTGCGGTGGACGATGGAGGG; (b)
cFLIP, (5') GGAGGCTTATGTCTGCTGAAGTCATC and (3')
GGGGAATTCCTTCTGATTCCTGAATGG; and (c) caspase-8, (5')
TCTGGAGCATCTGCTGTCTG and (3') CCTGCCTGGTGTCTGAAGTT. RT-PCR reactions
were performed using a thermal program of 48°C for 45 min; 94°C for
5 min; 40 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for
1 min; and then 72°C for 10 min. A total of 30% of the final PCR
products were loaded onto a 1% agarose gel.
Flow Cytometric Analysis.
Cells were washed in FACS buffer (RPMI 1640, 10% FCS, and 2
mM EDTA) and then stained with antihuman Fas MAb or rabbit
antihuman TRAIL-R2 antibodies, followed by goat secondary antibodies
conjugated to FITC (Caltag Laboratories). A total of 10,000 events were
collected on a FACScan II (Becton Dickinson).
Western and Southern Blotting.
Cellular 1% NP40 (30 µg) extracts were boiled in sample buffer and
analyzed by 10% SDS-PAGE under reducing conditions and by Western
blotting. Blots were saturated with 5% skim milk and 0.5% Tween 20 in
PBS and revealed using mouse anti-FADD, anti-caspase-3, anti-caspase-8,
or anti-caspase-10 MAbs followed by incubation with
peroxidase-conjugated secondary antibody (Jackson ImmunoResearch).
Bound antibodies were detected using the enhanced chemiluminescence kit
(Amersham International) according to the manufacturers instructions.
Genomic DNA was isolated by lysis in a solution of 10 mM
Tris-HCl (pH 10.5), 1 mM EDTA, 150 mM NaCl, and
0.5% SDS and digested twice for 90 min in 20 mg/ml proteinase K
(Boehringer Mannheim) at 56°C, and then two chloroform/phenol
extractions were performed. Southern blotting was then carried out as
described previously (15)
, and nylon filters were
hybridized with full-length caspase-8 cDNA or the pNB-1 NMYC
probe kindly provided by Dr. M. Schwab (DFKZ, Heidelberg,
Germany).
Caspase-3 Activity Assay.
Caspase-3 activity was assayed by mixing 10 µl of post nuclear lysate
(3040 µg protein) with 10 volumes of reaction buffer [10
mM Tris-HCl (pH 7.4), 0.1%
3-[(3-cholamidopropyl)dimethylammonio]-1 -propanesulfonic acid, 2
mM MgCl2, 1 mM DTT, 5
mM EGTA, and 150 mM NaCl] containing 50
µM of a fluorogenic caspase-3 substrate
(Ac-DEVD-AMC; Alexis Biochemicals). The mixture was incubated
for 60 min in a black ELISA titer plate, and fluorescence was measured
in a Fluoroskan ELISA reader (excitation, 355 nm; emission, 460 nm).
The caspase-3 activity was expressed as a fold increase compared with
nontreated cells, and background was deduced using the lysis buffer as
a control. All values are normalized with respect to the protein
content in the sample measured by the Bio-Rad protein assay.
Immunohistochemistry.
Frozen sections (7 µm) were fixed in acetone, permeabilized for
caspase-8 staining in 1% Triton X-100 in Tris-buffered saline, blocked
in 2 g/liter BSA, and then incubated overnight with rabbit
anti-caspase-8 antibodies, followed by biotinylated goat anti-rabbit
antibody (DAKO) and avidin-alkaline phosphatase conjugate (ABComplex,
DAKO). Color was developed using Fast Red TR/Napthol AS-MX (Sigma),
followed by counterstaining with hematoxylin. For N-CAM and HLA class 1
staining, frozen sections were fixed and blocked as described above and
incubated for 2 h in primary antibody followed by rabbit
anti-mouse alkaline phosphatase and swine anti-rabbit antibody coupled
to alkaline phosphatase (DAKO) before substrate development as
described above.
| Results and Discussion |
|---|
|
|
|---|
|
Expression of signaling molecules downstream of TRAIL death receptors
was then examined. Caspase-3, caspase-8, and caspase-10 are involved in
both Fas- and TRAIL-mediated apoptosis, with cFLIP being a negative
regulator of both pathways. Adaptor potein FADD is essential for
Fas-mediated cell death (17)
and TRAIL-R2-mediated cell
death (18)
. Both Jurkat T cells and S-type NB cells
expressed cFLIP mRNA, whereas no cFLIP mRNA could be detected in N-type
cells (Fig. 2A
). It is unlikely that cFLIP inhibits TRAIL-mediated
apoptosis in S-type cells because they undergo extensive cell death at
low doses of TRAIL. In contrast, cFLIP may contribute to the
resistance of S-type cells to Fas-mediated apoptosis because its
expression is known to be more crucial in reducing sensitivity to
Fas-induced cell death than reduced levels of Fas on the cell surface
(7
, 19) . Expression of FADD and of caspases-3 and -10 was
detected by Western blotting in both S-type and N-type cells at levels
comparable to those in Jurkat T cells (Fig. 2B
).
Surprisingly, neither caspase-8 mRNA nor protein was present in N-type
cells, although they were readily detectable in S-type cells (Fig. 2 and B
).
|
The in vivo expression of caspase-8 by malignant NB tumors
was investigated by immunocytochemistry comparing a malignant NB stage
IV tumor with a benign ganglioneuroma (Fig. 3C
). The expression of N-CAM, a neural adhesion molecule that
is strongly expressed by NB and related neuroectoderm-derived tumors
(21)
, and the MHC class I molecules (HLA-I), which are
lacking in late-stage NB tumor cells (11)
, is also shown
(Fig. 3 and B
). Sections of ganglioneuroma
gave homogeneously positive stainings for N-CAM, HLA-I, and caspase-8.
The malignant NB stage IV tumor was positive for N-CAM and negative for
HLA-I and expressed only low levels of caspase-8, whereas regions of
normal cells surrounding the tumor were observed to be N-CAM negative
and HLA-I and caspase-8 positive. Therefore, as observed for N-type NB
cells, caspase-8 expression appears to be reduced in late-stage NB
tumors. In contrast, more differentiated ganglioneuromas are similar to
S-type cells in that they express both caspase-8 and HLA-I. The fact
that a subset of malignant NB tumors down-regulates the expression of
caspase-8, which is a key initiator of death receptor-mediated
apoptosis, could explain their highly aggressive behavior and thei
resistance to most treatment regimens (1)
. Whereas our
study is the first to provide evidence that caspase-8 expression is
absent in aggressive neuroblastomas, lower levels of caspase-1 and -3
have been measured in high-stage NB tumors, compared with those of
lower stages (22)
. In addition to the absence of HLA-I,
the down-regulation of caspase expression could therefore be a general
mechanism used by NB cells to evade immune attack.
|
|
| FOOTNOTES |
|---|
1 Supported by grants from the Antoine Leenaards
Foundation, the Swiss National Scientific Foundation, and the
FORCE Foundation. ![]()
2 To whom requests for reprints should be
addressed, at Department of Pediatric Onco-Hematology, Centre
Hospitalier Universitaire Vaudois, CH-1011 Lausanne, Switzerland.
Phone: 021-314-3622; Fax: 021-314-3558; E-mail: ngross{at}chuv.hospvd.ch ![]()
3 The abbreviations used are: NB, human
neuroblastoma; TRAIL, tumor necrosis factor-related apoptosis-inducing
ligand; TNF, tumor necrosis factor; RT-PCR, reverse transcription-PCR;
MAb, monoclonal antibody; FACS, fluorescence-activated cell-sorting;
AzaC, 5-aza-2'-deoxycytidine; c-Flip, cellular Flice inhibitory
protein; FasL, Fas ligand; N-CAM, neural cell adhesion molecule; HLA-I,
class I molecules. ![]()
Received 3/17/00. Accepted 6/28/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. La, Y. Yang, S. K. Karnik, A. C. Silva, R. W. Schnepp, S. K. Kim, and X. Hua Menin-mediated Caspase 8 Expression in Suppressing Multiple Endocrine Neoplasia Type 1 J. Biol. Chem., October 26, 2007; 282(43): 31332 - 31340. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yang, J. J. Peairs, R. Tano, N. Zhang, J. Tyrell, and G. J. Jaffe Caspase-8-Mediated Apoptosis in Human RPE Cells Invest. Ophthalmol. Vis. Sci., July 1, 2007; 48(7): 3341 - 3349. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Lissat, T. Vraetz, M. Tsokos, R. Klein, M. Braun, N. Koutelia, P. Fisch, M. E. Romero, L. Long, P. Noellke, et al. Interferon-{gamma} Sensitizes Resistant Ewing's Sarcoma Cells to Tumor Necrosis Factor Apoptosis-Inducing Ligand-Induced Apoptosis by Up-Regulation of Caspase-8 Without Altering Chemosensitivity Am. J. Pathol., June 1, 2007; 170(6): 1917 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. De Geer, R. Kiessling, V. Levitsky, and J. Levitskaya Cytotoxic T Lymphocytes Induce Caspase-Dependent and -Independent Cell Death in Neuroblastomas in a MHC-Nonrestricted Fashion J. Immunol., December 1, 2006; 177(11): 7540 - 7550. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fulda, C. Poremba, B. Berwanger, S. Hacker, M. Eilers, H. Christiansen, B. Hero, and K.-M. Debatin Loss of Caspase-8 Expression Does Not Correlate with MYCN Amplification, Aggressive Disease, or Prognosis in Neuroblastoma. Cancer Res., October 15, 2006; 66(20): 10016 - 10023. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-C. Li, C.-C. Tzeng, J. H. Song, F.-J. Tsia, L.-J. Hsieh, S.-J. Liao, C.-H. Tsai, E. G. Van Meir, C. Hao, and C.-C. Lin Genomic alterations in human malignant glioma cells associate with the cell resistance to the combination treatment with tumor necrosis factor-related apoptosis-inducing ligand and chemotherapy. Clin. Cancer Res., May 1, 2006; 12(9): 2716 - 2729. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Eramo, R. Pallini, F. Lotti, G. Sette, M. Patti, M. Bartucci, L. Ricci-Vitiani, M. Signore, G. Stassi, L. M. Larocca, et al. Inhibition of DNA Methylation Sensitizes Glioblastoma for Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Mediated Destruction Cancer Res., December 15, 2005; 65(24): 11469 - 11477. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Cui, T. Li, and H.-F. Ding Linking of N-Myc to Death Receptor Machinery in Neuroblastoma Cells J. Biol. Chem., March 11, 2005; 280(10): 9474 - 9481. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Poulaki, C. S. Mitsiades, C. McMullan, G. Fanourakis, J. Negri, A. Goudopoulou, I. X. Halikias, G. Voutsinas, S. Tseleni-Balafouta, J. W. Miller, et al. Human Retinoblastoma Cells Are Resistant to Apoptosis Induced by Death Receptors: Role of Caspase-8 Gene Silencing Invest. Ophthalmol. Vis. Sci., January 1, 2005; 46(1): 358 - 366. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Svingen, D. Loegering, J. Rodriquez, X. W. Meng, P. W. Mesner Jr., S. Holbeck, A. Monks, S. Krajewski, D. A. Scudiero, E. A. Sausville, et al. Components of the Cell Death Machine and Drug Sensitivity of the National Cancer Institute Cell Line Panel Clin. Cancer Res., October 15, 2004; 10(20): 6807 - 6820. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mirandola, C. Ponti, G. Gobbi, I. Sponzilli, M. Vaccarezza, L. Cocco, G. Zauli, P. Secchiero, F. A. Manzoli, and M. Vitale Activated human NK and CD8+ T cells express both TNF-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors but are resistant to TRAIL-mediated cytotoxicity Blood, October 15, 2004; 104(8): 2418 - 2424. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Baumann Kubetzko, C. di Paolo, C. Maag, R. Meier, B. W. Schafer, D. R. Betts, R. A. Stahel, and A. Himmelmann The PAX5 oncogene is expressed in N-type neuroblastoma cells and increases tumorigenicity of a S-type cell line Carcinogenesis, October 1, 2004; 25(10): 1839 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ruiz-Ruiz, C. Ruiz de Almodovar, A. Rodriguez, G. Ortiz-Ferron, J. M. Redondo, and A. Lopez-Rivas The Up-regulation of Human Caspase-8 by Interferon-{gamma} in Breast Tumor Cells Requires the Induction and Action of the Transcription Factor Interferon Regulatory Factor-1 J. Biol. Chem., May 7, 2004; 279(19): 19712 - 19720. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Karlsson, I. Ora, I. Porn-Ares, and S. Pahlman Arsenic Trioxide-Induced Death of Neuroblastoma Cells Involves Activation of Bax and Does Not Require p53 Clin. Cancer Res., May 1, 2004; 10(9): 3179 - 3188. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Bian, T. D. Giordano, H.-J. Lin, G. Solomon, V. P. Castle, and A. W. Opipari Jr. Chemotherapy-induced Apoptosis of S-type Neuroblastoma Cells Requires Caspase-9 and Is Augmented by CD95/Fas Stimulation J. Biol. Chem., February 6, 2004; 279(6): 4663 - 4669. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. MUHLETHALER-MOTTET, K. BALMAS, K. AUDERSET, J.-M. JOSEPH, and N. GROSS Restoration of TRAIL-Induced Apoptosis in a Caspase-8-Deficient Neuroblastoma Cell Line by Stable Re-expression of Caspase-8 Ann. N.Y. Acad. Sci., December 1, 2003; 1010(1): 195 - 199. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Wittke, R. Wiedemeyer, A. Pillmann, L. Savelyeva, F. Westermann, and M. Schwab Neuroblastoma-Derived Sulfhydryl Oxidase, a New Member of the Sulfhydryl Oxidase/Quiescin6 Family, Regulates Sensitization to Interferon {gamma}-Induced Cell Death in Human Neuroblastoma Cells Cancer Res., November 15, 2003; 63(22): 7742 - 7752. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Yang, M. S. Merchant, M. E. Romero, M. Tsokos, L. H. Wexler, U. Kontny, C. L. Mackall, and C. J. Thiele Induction of Caspase 8 by Interferon {gamma} Renders Some Neuroblastoma (NB) Cells Sensitive to Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) but Reveals That a Lack of Membrane TR1/TR2 Also Contributes to TRAIL Resistance in NB Cancer Res., March 1, 2003; 63(5): 1122 - 1129. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Higuchi, J.-H. Yoon, A. Grambihler, N. Werneburg, S. F. Bronk, and G. J. Gores Bile Acids Stimulate cFLIP Phosphorylation Enhancing TRAIL-mediated Apoptosis J. Biol. Chem., January 3, 2003; 278(1): 454 - 461. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. van Noesel, S. van Bezouw, G. S. Salomons, P. A. Voute, R. Pieters, S. B. Baylin, J. G. Herman, and R. Versteeg Tumor-specific Down-Regulation of the Tumor Necrosis Factor-related Apoptosis-inducing Ligand Decoy Receptors DcR1 and DcR2 Is Associated with Dense Promoter Hypermethylation Cancer Res., April 1, 2002; 62(7): 2157 - 2161. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nishimura, M. Adachi, T. Ishida, T. Matsunaga, H. Uchida, H. Hamada, and K. Imai Adenovirus-mediated Transfection of Caspase-8 Augments Anoikis and Inhibits Peritoneal Dissemination of Human Gastric Carcinoma Cells Cancer Res., October 1, 2001; 61(19): 7009 - 7014. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. Burns and W. S. El-Deiry Identification of Inhibitors of TRAIL-induced Death (ITIDs) in the TRAIL-sensitive Colon Carcinoma Cell Line SW480 Using a Genetic Approach J. Biol. Chem., October 5, 2001; 276(41): 37879 - 37886. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Cell Growth & Differentiation |