| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Division of Immunology, Beckman Research Institute of the City of Hope [P. C., G. S., J. E. S.], and Division of Radiology, City of Hope National Medical Center, [L. W.] Duarte, California 91010; and Departments of Pathology [X. X., F. J. P.], Preventive Medicine [Y. S.], and Biochemistry [E. S.], Vanderbilt University Medical Center, Nashville, Tennessee 37232
| ABSTRACT |
|---|
|
|
|---|
| INTRODUCTION |
|---|
|
|
|---|
The expression of CEA in a majority of colon cancers (14)
and in
50% of breast (15)
and lung (16)
cancers has made it an attractive target for antibody-directed
diagnosis and therapy. However, CEA is present in some normal tissues
and is well expressed by the large bowel (17)
. In this
study, we describe the generation of a genetically engineered bivalent
single-gene-encoded antibody and its IL-2 fusion protein derivative.
The tumor targeting properties of these antibodies were studied in an
immunocompetent CEA transgenic mouse model (18)
. The
antigen binding domains for the parent scFvFc antibody were derived
from the high affinity anti-CEA murine antibody, T84.66
(19)
. Like humans, the transgenic line expresses CEA in
the colon and thus provides a preclinical model more analogous to
humans than the more commonly used animal hosts that lack normal tissue
expression of the relevant antigen (20)
. It was found that
the antigen-binding and blood clearance properties of the parent scFvFc
antibody were relatively unaltered, and it retained its ability to
target tumors specifically albeit at lower levels than the intact Mab.
The colons from transgenic mice showed a marginal increase in
accumulation of the scFvFc antibody compared with that appearing in
nontransgenic colons. The antigen-binding and IL-2 activity properties
of the fusion protein were preserved, whereas there was a marked
decrease in tumor localization coincident with enhanced intravascular
clearance. Despite the diminished tumor-targeting properties of the
fusion protein, the growth of CEA-expressing but not antigen-irrelevant
syngeneic tumor cells was inhibited after treatment with the
anti-CEA-IL-2 antibody.
| MATERIALS AND METHODS |
|---|
|
|
|---|
scFvFc Construction.
The light and heavy chain variable domains of T84.66 were joined by an
18-amino acid linker to form a scFv. This scFv sequence was then joined
to a murine IgG2a constant region composed of
hinge-CH2CH3 to form a
scFvFc. An IL-2 fusion gene was created by joining the cDNA for murine
IL-2 directly to the 3'-end of the scFvFc gene to form the
scFvFc.IL-2 fusion gene.
For construction of the scFvFc, the T84.66 VL was PCR amplified using the sense primer TTCCCGGGGCAGAGATGGAGACAGACA and antisense primer CGCCAGATCCGGGCTTGCCGGATCCAGAGGTGGAGCCTTTTATTTCCAGCTTGGTCC. The T84.66 VH was amplified using the sense primer CGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGGTTCAGCTGCAGCAGTC and antisense primer CTCTGGGCTCTGAGGAGACGGTGACTGAGG. These primers amplify the variable domains and also add sequences encoding the 18-amino acid 218 linker GSTSGSGKPGSGEGSTKG (23) . The primer sequences contain overlapping complementary regions which are underlined. The variable region PCR products were then joined by splice overlap extension (24) forming an scFv domain. The T84.12 hinge Fc domain was amplified with the sense primer CGTCTCCTCAGAGCCCAGAGGGCCCACAAT and antisense primer TTCCCGGGTTGTGGGTGCTGAGCTCATT. This PCR product was then joined to the scFv sequences by splice overlap extension to complete the scFvFc coding sequence. The product was cut with SmaI and ligated into SmaI cut pEE12 to form pEEscFvFc. We used the plasmid pEEscFvFc to express the scFvFc in mammalian tissue culture.
scFvFc.IL-2 Construction.
A unique SmaI restriction site was engineered into the
3'-end of the scFvFc gene to facilitate the creation of genetic
fusions. The scFvFc gene was amplified using pEEscFvFc as
template and the sense primer TTGGATATCGCAGAGATGGAGACAGACAC and
antisense primer
GAGATTTAAATCGGTGCTGAGCTCATTTCCCGGGAGTCCGGGAGAAGCTC. These primers
amplified the entire T84.66/12 scFvFc gene and added an
EcoRV site to the 5'-end and a BsaBI site to the
3'-end of the gene. The antisense primer also introduced two silent
mutations in the Pro-Gly codons at amino acid positions 501 and 502,
converting the sequence (CCG GGT) to an SmaI site (CCC GGG).
The PCR product was cut with EcoRV and BsaB1 and
ligated to SmaI cut pEE12. The resulting plasmid,
pEEscFvFcSma, contained a unique SmaI site at the
3'-end of the Fc portion of the ScFvFc gene.
The mouse IL-2 cDNA was amplified using the sense primer TTCCCGGGAAAGCACCCACTTCAAGCTCCACT and antisense primer TTCCCGGGATCGCGATCTTATTGAGGGCTTGTTGAGAT. This amplification added SmaI sites to both the 5'- and 3'-ends of the IL-2 gene. In addition, the 5'-end of the product contained the codons for the COOH-terminal Pro-Gly-Lys residues of the T84.12 Fc domain in frame with the NH2-terminal Ala-Pro residues of the mature IL-2 sequence. The IL-2 sequence was then isolated as a SmaI fragment and ligated into the SmaI site of pEEscFvFcSma. This fused the mature NH2 terminus of the IL-2 sequence directly to the natural COOH terminus of the scFvFc forming the scFvFc.IL-2 coding region within pEE12.
Preparation of Transfectomas.
Linearized DNA (40 µg) was transfected into 1 x 107 NSO plasmacytoma cells by electroporation.
NSO cells were obtained from Dr. Sebastian Joyce (Vanderbilt
University, Nashville, TN). Electroporated cells were plated into
microtiter plates at 2 x 103
to
7 x 103
cells/well in 50 µl of
complete medium consisting of DMEM high glucose, 2 mM
glutamine, 1 mM sodium pyruvate, nonessential amino acids,
100 units/ml penicillin, 100 µg/ml streptomycin (all obtained from
Irvine Scientific, Santa Ana, CA), and 10% fetal bovine serum (Gemini,
Carlsbad, CA). After 24 h, 100 µl of glutamine-deficient medium
were added that consisted of glutamine-free DMEM high glucose, 1
mM sodium pyruvate, antibiotics, nonessential amino acids,
7 µg/ml each of adenosine, guanosine, cytidine, and uridine (Sigma,
St. Louis, MO), 2.4 µg/ml thymidine, 60 µg/ml each of glutamic acid
and asparagine (Sigma), 10 mM HEPES (Irvine Scientific),
5 x 10-5 2mercaptoethanol
(Irvine Scientific), and 10% dialyzed fetal bovine serum (Life
Technologies, Inc., Grand Island, NY). After 1014 days, colonies
appeared and were screened for the production of immunoglobulin by EIA.
Selected clones from NSO cells transfected with the
scFvFc.IL-2 fusion construct and positive for immunoglobulin
production were exposed to the inhibitor of glutamine synthetase,
L-MSX (Sigma), at concentrations ranging from 5
to 50 µM. One clone (1H2) from the
scFvFc transfection and one clone (8H8) from the
scFvFc.IL-2 transfection were selected for production of
engineered antibodies.
Antibody Purification.
Production of engineered antibodies was carried out in static culture
containing glutamine-free DMEM high glucose supplemented with 10%
fetal bovine serum. Medium from cultures grown to extinction was
centrifuged at 5000 rpm in Sorval GSA bottles for 20 min. The scFvFc
and scFvFc.IL-2 were purified by affinity chromatography using a T84.66
anti-idiotype immunoadsorbent (25)
. The column was washed
with PBS (0.01 M phosphate, pH 7.2, plus 0.15 M NaCl) and eluted with
1.0 M MgCl in PBS. The eluted antibodies were dialyzed
twice against 100 volumes of PBS and then were concentrated by
untrafiltration (Amicon, Beverly, MA). Both engineered antibodies were
further purified by size exclusion chromatography using two 1- x 30-cm Superdex 200 columns in tandem (Pharmacia, Piscataway,
NJ). Hybridoma-derived T84.66 was purified from ascites by affinity
chromatography over a protein G immunoadsorbent (Pharmacia). The
ascites was applied with 0.01 M phosphate buffer, pH 6.5;
eluted with 0.01 M
H3PO4, pH 2.2; and
immediately neutralized with 1.0 M Tris, pH 8.0. The eluted
intact Mab was dialyzed against PBS and concentrated. Purified antibody
preparations were analyzed by SDS-PAGE. Protein content of
purified antibody preparations was determined by amino acid analysis in
the City of Hope Protein Chemistry facility.
Enzyme Immunoassays.
The immunoglobulin content of culture supernatants was determined in a
sandwich EIA. Goat antimouse IgG Fc antibody (250 ng/well; Jackson
ImmunoResearch, West Grove, PA) was coated overnight at 4°C in 0.1
M sodium bicarbonate, pH 9.6, onto polystyrene microtiter
plates. Plates were then blocked for 1 h at room temperature with
0.5% BSA in coating buffer. After incubation at 37°C for 1 h
with 100 µl of test sample or standard, plates were washed with PBS
containing 0.05% Tween 20 and then exposed to 100 µl of alkaline
phosphatase-labeled goat antimouse IgG Fc antibody (Jackson
ImmunoResearch). After an additional 1-h incubation at 37°C, the
plates were washed and then exposed to disodium
p-nitrophenyl phosphate (Sigma) in 10% (v/v)
diethanolamine. The plates were read at 405 nm with a Bio-Rad
Microplate reader. Standard curves were generated with purified
hybridoma-derived Mab.
Antigen reactivity of culture supernatants and purified engineered antibodies was determined in competition EIA. Microtiter wells were coated with 250 ng/well purified CEA contained in 0.1 M sodium bicarbonate, pH 9.6. After blocking with 0.5% BSA, 50 µl of test sample were added to the wells, and the plates were incubated for 1 h at 37°C. Biotinylated hybridoma-derived T84.66 Mab (50 µl containing 50 ng) was then added, and incubation at 37°C for 1 h was continued. The T84.66 Mab was biotinylated with NHS-LC-biotin (Pierce, Rockford, IL) at a 200:1 mol input ratio of biotin to antibody. The plates were washed, reacted with streptavidin-alkaline phosphatase conjugate (Jackson ImmunoResearch) for 1 h at 37°C and then exposed to disodium p-nitrophenyl phosphate. The plates were read as described above.
Measurement of Affinity Constants.
Antibody affinity (KA = ka/kDa), and rate
constants were determined with a BIAcore 2000 (Pharmacia) biosensor.
Data were analyzed with BIAevaluation software (version 3.1) using the
bianalyte model under global conditions.
NHS/1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride was
used to attach the N-A3 two-domain CEA subunit (26)
to F1
biosensor chips (Pharmacia). Fetuin was coupled to the sensor chip
using NHS/1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride
and was used for background subtraction. Antibody was applied to the
chip at increasing concentrations (31500 nM)
with each concentration level followed by regeneration. A 20-min
dissociation time was used to determine
kDa.
Flow Cytometry.
Flow cytometry analysis was conducted with a FACScalibur (Becton
Dickinson, Mountain View, CA) as previously described
(27)
.
IL-2 Assay.
The ability of the scFvFc.IL-2 fusion protein to support the
proliferative activity of the IL-2-dependent cell line, CTLL-2
(American Type Culture Collection) was measured using either
colorimetric (Promega, Madison, WI) or radioactive methods. Briefly,
5 x 103
CTLL-2 cells in 50 µl
were exposed in microtiter plates to samples or IL-2 standard contained
in 50 µl for 24 h at 37°C. Human IL-2 (Intergen, Purchase, NY)
was used as a standard. Chromogen solution (MTS/PMS) or [
3
H]thymidine was added to the wells, and the
plates were incubated overnight before determining absorbance at 490 nm
in a plate reader or measurement of
[3
H]thymidine incorporation.
Radioiodination of Antibodies.
Proteins were radioiodinated to 510 µCi/µg using the IODO-GEN
method (28)
. Briefly, 40 µg of protein were added to
4080 µl of 0.1 M phosphate, pH 7.5, in a polypropylene
tube coated with 20 µg of IODO-GEN (Pierce). Carrier-free
131I (500 µCi; ICN, Costa Mesa, CA) in the
above buffer was allowed to react for 3 min at room temperature.
Antibody-bound radioactivity was separated from free
131I by molecular sieve chromatography over a
PD-10 column (Pharmacia) equilibrated in PBS containing 1% BSA. The
purity of the each radioantibody was examined by molecular sieve
chromatography using two Superdex 200 (1 x 30 cm;
Pharmacia) columns connected in tandem. The immunoreactivity of the
radioantibodies was evaluated with an immunoadsorbent containing CEA,
whereas a BSA immunoadsorbent was used to determine nonspecific
binding.
Pharmacokinetics and Biodistribution.
Biodistribution and blood clearance studies were conducted in female
and male CEA-transgenic mice with a C57BL/6 background
(18)
. After i.v. injection, small volume (20 µl) blood
samples from the tail vein were removed at various times (0.5, 1, 3, 6,
24, 48, 96 h). The %ID per ml of blood for each time point was
normalized to an initial sample removed immediately after injection of
the radioantibody. Blood clearance curves were represented by
biexponential functions using the ADAPT II software package
(29)
. Two half-lives
(t1/2
and
t1/2ß) and their associated
amplitudes were estimated for each curve. For tumor localization, mice
were implanted s.c. with MC-38 tumor cells in one flank, whereas
MC-38.CEA cells were injected into the contralateral flank. Animals
were injected with 1.0 x 106
MC-38.CEA tumors cells, followed in 23 days by injection with
0.5 x 106 parental MC-38 tumor
cells. Differences in the in vivo growth rates of the
parental MC-38 cells and the CEA-transfected clone necessitated
injecting a different number of cells and delaying the time of
injection of the former cells. Ten days after injection of MC-38.CEA
cells,
2 µg (510 µCi of 131I) of
radioantibody were administered by tail vein injection. Animals were
anesthetized and exsanguinated by cardiac puncture at various times
after injection (4, 8, 24, 48, 96 h). Tumor and reference normal
tissues (liver, spleen, kidney, lung, stomach, colon, muscle) were
removed and counted along with blood samples. Contents of the
gastrointestinal tract were removed before counting. The radioactive
content of tumor, tissues, and blood samples was expressed as %ID/g by
dividing the measured count rate by the rate obtained with an injection
standard counted the same time as the samples. Tumor localization
ratios were determined by dividing the %ID/g of MC-38.CEA tumor by the
%ID/g of parental MC-38 tumor cells. Likewise, tumor:nontumor ratios
were determined by dividing the %ID/g of MC-38.CEA tumor by the
corresponding values for blood or normal reference tissues.
Tumor Therapy.
CEA transgenic mice, male or female, were implanted s.c. with
1 x 106 MC-38.CEA or MC-38.BGP
cells (30)
. MC-38 cells transfected with BGP served as a
negative control for therapy studies because the T84.66 Mab does not
cross-react with the BGP CEA-related antigen. Treatment with the fusion
protein was initiated 24 h after tumor implantation. As identified
in the results, mice were treated i.p. or i.v. with different doses of
the fusion protein or control preparations for 1428 days in most
experiments. Tumor growth was monitored by caliber measurements in two
perpendicular dimensions, and tumor volume was determined according to
the formula:
![]() |
Statistics.
Results were subjected to Students t test. In addition, a
restricted/residual maximum likelihood-based repeated measure model
(mixed model analysis) with various covariance structure was used. The
latter procedure is a repeated measures analysis for correlated
continuous outcome variables and is designed for longitudinal data
analysis with multiple observable vectors for the same subject. SAS
version 7.0 was used for all analyses.
| RESULTS |
|---|
|
|
|---|
For production, the selected clones were grown in medium lacking
glutamine and supplemented with nondialyzed fetal bovine serum. Static
cultures were grown to extinction, at which time the concentration of
scFvFc and scFvFc.Il-2 was
80 and 10 µg/ml, respectively. After an
initial purification on an antiidiotype affinity column, the scFvFc
antibody contained <10% material that was of a larger molecular size
than that of dimeric scFvFc as determined by size exclusion
chromatography. By contrast,
50% of the scFvFc.IL-2 chromatographed
as high molecular weight material (data not shown). Dimeric scFvFc.IL-2
was obtained after purification by size exclusion chomatography.
However, after storage of the dimeric fusion protein (1.4 mg/ml) in PBS
at 10°C or -20°C for 46 weeks, the high molecular weight
material reappeared. The latter occurred at a faster rate with storage
at 10°C. Additional aggregation of the scFvFc over that observed
after its initial purification did not appear. Despite the aggregation
properties of the scFvFc.IL-2, SDS-PAGE analysis showed that both the
scFvFc and scFvFc.IL-2 were assembled as dimeric molecules (Fig. 1A
). The molecular weights of the scFvFc
(Mr 106,774) and scFvFc.IL-2
(Mr 145,501) were similar to that
predicted by sequence information. In addition, a second band was
variably observed at Mr
129,000
for the scFvFc.IL-2 (Fig. 1A
). The nature of this smaller
band is not known but its size is similar to a molecule that is missing
1 mol of IL-2. Analysis of reduced samples of the purified scFvFc and
scFvFc.IL-2 produced single bands that migrated at
Mr
53,000 and 71,000, respectively,
which closely agrees with that predicted by sequence information (Fig. 1B
).
|
|
|
Purified scFvFc.IL-2 was also analyzed for IL-2 biological activity in
a cell proliferation assay. The concentration of IL-2 in the purified
fusion protein was determined as 2 mol eq of IL-2 per mol of fusion
protein. As depicted in Fig. 3
, the IL-2 activity of the scFvFc.IL-2 was equal to that of comparable
amounts of human IL-2. Thus, the fusion protein contained
3978 IU
IL-2 activity/µg. The parent scFvFc molecule did not have an effect
on cell proliferation (not shown).
|
150,000) and the scFvFc.IL-2
(Mr
145,000) eluted slightly
earlier than the scFvFc antibody (Mr
106,000). Immunoreactivity of the labeled antibody preparations was
tested using a CEA-containing immunoadsorbent. Between 85 and 95% of
the activity associated with each of the three labeled antibody types
bound to the latter immunoadsorbent (data not shown). Binding to a
control immunoadsorbent containing BSA varied between 5 and 10% of the
activity for each antibody.
|
The blood clearance properties of the three antibodies were examined in
nontransgenic mice after i.v. injection. The blood clearance of the
scFvFc.IL-2 was markedly faster than that of the T84.66 Mab with a
t1/2
and
t1/2ß of 2.3 and 31.4 h,
respectively, for the fusion protein compared with 5.0 and 101 h
for the Mab for the same respective time points (Fig. 5A
; Table 2
). The faster clearance of the scFvFc.IL-2 is also reflected in the area
under the curve, whereas the clearance of the scFvFc was intermediate
between that of the latter and the intact Mab. Even with its more rapid
clearance,
40% of the initial amount of radiolabeled scFvFc.IL-2
injected remained in the circulation at 3 h postinjection. Similar
blood clearance patterns were observed when antibodies were injected
into CEA-transgenic mice (data not shown).
|
|
6%ID/g of
this fusion protein was present in the MC-38.CEA tumor at 8 h
post-antibody injection, the earliest time point examined with the
latter antibody (Fig. 5B
All three antibody types showed specific accumulation of
radioantibody in the CEA-positive tumor as shown by the generation
of tumor localization ratios >1 (Fig. 5C
). The tumor
localization ratio for the intact antibody was slightly greater than 5
by 24 h postinjection and remained relatively constant thereafter.
The scFvFc gave tumor localization ratios similar to that of the intact
antibody until 96 h after injection, but by 144 h, this ratio
had declined to <3 (Fig. 5C
). Although the scFvFc.IL-2 had
the lowest accumulation in MC-38.CEA tumors of the three antibody
types, specific uptake of scFvFc.IL-2 was evident (Fig. 5C
).
Tumor localization ratios for the latter antibody were similar to the
other two antibody types until 48 h, after which there was a
decline. At the time of peak uptake of antibody in the CEA-positive
tumor, the level of intact (P = 0.01), scFvFc
(P = 0.003), and scFvFc.IL-2
(P = 0.002) in the latter tumor was
significantly higher than that in the contralateral CEA-negative tumor.
Thus, although the accumulation of scFvFc.IL-2 in MC-38.CEA tumors was
lower than that of the scFvFc or intact Mab, the scFvFc.IL-2 was still
capable of antigen-specific targeting.
The MC-38.CEA tumor:nontumor ratios were compared for selected normal
reference tissues (Fig. 6
). Similar to the pattern observed when antibody uptake in the
CEA-negative parental tumors was compared with that of MC-38.CEA
tumors, the scFvFc and intact Mab produced similar tumor:nontumor
ratios at earlier time points. After 48 h, ratios for the scFvFc
declined whereas those for the intact Mab remained constant. For the
scFvFc.IL-2, tumor:nontumor ratios for blood, colon, and muscle were
similar to those observed for the scFvFc and intact Mab at early time
points. However, the ratios for the remaining reference tissues (lung,
liver, kidney, spleen, and stomach) were notably less than those
obtained with the other two antibody types. The stomach of
CEA-transgenic mice expresses CEA (18)
, but this does not
appear to be the reason for the low tumor:stomach ratios because
increased levels of fusion protein were also observed in the stomachs
of nontransgenic mice (data not shown).
|
|
119,000 and 80,000 IU of IL-2 for the i.p. and i.v. injections,
respectively. The total doses of IL-2 administered by the i.p. and i.v.
routes were 1.67 x 106 and
0.56 x 106 IU, respectively.
Preliminary toxicity experiments showed that these doses were also well
tolerated. For the first experiment, mice were treated i.p. 1 day after
s.c. implantation with either MC-38.CEA or MC-38.BGP tumor cells.
Inhibition of MC-38.CEA tumor growth was observed in mice treated with
the fusion protein as compared with mice receiving PBS (Fig. 8A
|
|
| DISCUSSION |
|---|
|
|
|---|
The scFvFc showed excellent targeting to tumors and was similar to the intact Mab at the earliest time point in experiments with transgenic mice. In the latter model, animals had both an antigen-positive and -negative tumor that made it possible to demonstrate directly specificity of targeting. The ratio of antibody uptake between tumors growing in the same animal host that differ only in the expression of the targetable antigen (tumor localization ratio) is reminiscent of the paired-label technique introduced by Pressman et al. (32) for demonstrating specificity of antibody targeting. The ability to show specificity of tumor targeting in the transgenic model is a feature amendable for studies with engineered antibodies in which an identical irrelevant construct may not be easily fabricated or acquired. Thus, the scFvFc localized specifically to the MC-38.CEA tumors producing tumor localization ratios that were similar to those obtained with the intact Mab. As observed with the tumor localization ratio, the tumor:nontumor ratios were also very similar between the scFvFc and intact Mab for most of the reference tissues. Nonetheless, tumor uptake of the scFvFc was less than that of the intact Mab, and the latter was particularly evident after the peak of scFvFc uptake. The faster blood clearance of the scFvFc most likely accounted for the earlier peak accumulation of the scFvFc in tumors and its lower overall tumor targeting activity. The lower blood levels of the scFvFc at later time points coupled with its egress from the tumor contributed to the lower tumor localization and tumor:nontumor ratios observed at later time points as compared with the intact Mab. Others have also produced a single-gene-encoded antibody identical in structure with the scFvFc but its tumor-targeting properties were not reported (33) . The demonstration that the scFvFc does have good tumor-targeting properties suggested that it may function well as a template for the creation of fusion proteins such as the anti-CEA scFvFc.IL-2.
Using the same expression system for both scFvFc and scFvFc.IL-2, the
secretion of the fusion protein was
10% of that obtained with the
scFvFc. Because all clones expressed the fusion protein in relatively
low concentrations, it seems unlikely that the latter was due to
insertion of the gene into unfavorable locations for transcription.
Other factors such as message stability, assembly, or enhanced
intracellular degradation may explain the lower secretion levels of the
scFvFc.IL-2. Nonetheless, the scFvFc.IL-2 was expressed as fully
assembled fusion protein containing 2 mol of IL-2 per antibody-IL-2
molecule. Like the scFvFc, the fusion protein was similar to intact Mab
in its ability to bind CEA; in addition, IL-2 activity was fully
preserved as has been reported by others (9
, 34)
. Antibody
activity was also found to be maintained after fusion of IL-2 at the
COOH-terminal end of a chimeric Fd (4)
or chimeric heavy
chain (9
, 35)
, whereas Gillies et al.
(34)
observed either loss or enhancement of antigen
binding with fusion proteins similar in structure to those reported in
the latter studies. In addition, the scFvFc.IL-2 antibody retained its
binding specificity for CEA-expressing cells.
The blood clearance of the scFvFc.IL-2 was considerably faster than
that of both the intact Mab and the scFvFc. This phenomenon had been
observed in studies of chimeric IgG fusion proteins with human IL-2
joined to the COOH-terminal end of the heavy chain (9
, 12
, 36)
. However, the clearance of the fusion protein reported here
was up to 8 times slower than that reported for the latter fusion
molecules. This difference may be due to our use of murine IL-2, to the
nature of the engineered fusion protein, or to measurement methods.
Because we used whole blood to evaluate blood clearance, it does not
appear that binding of the fusion protein to circulating IL-2
receptor-bearing cells, and their coincident clearance explains the
accelerated clearance of the fusion protein. Based on observations that
changes in antigen-binding properties can occur in IL-2 fusion
proteins, it was suggested that fusion of IL-2 alters antibody domain
structure and thereby can alter both antigen reactivity and metabolism
(36)
. This conformational change could mask, expose,
and/or alter recognition sites on the CH2 and/or
CH3 domains that are involved in immunoglobulin
clearance (37)
. However, recent studies have shown that
the apparent rapid clearance of the chimeric IgG fusion protein
resulted from a cleavage within the cytokine portion of the fusion
molecule (38)
. The heterologous immunoassay that was
used to measure serum levels of fusion protein reflected disappearance
of fusion protein as a result of both its clearance as well as a loss
of IL-2 from the molecule. We also observed the formation of large
molecular weight complexes on incubation of the fusion protein in mouse
serum. Molecules smaller than the native fusion protein were not
observed. As early as 4 h, >20% of the fusion protein appeared
as complexes. This property was unique to the fusion protein because
large molecular weight complexes did not appear when the parent scFvFc
molecule was incubated in serum. Thus, the possible alteration in
domain structure induced by fusion of IL-2 to the COOH terminus of the
CH3 domain may promote aggregation of the fusion
protein in serum or binding to a factor in serum. The self-association
properties of IL-2 may have contributed to fusion protein aggregation
in serum (39)
. Possible candidates for a serum factor
promoting aggregation are soluble IL-2 receptor that is present in low
levels in the sera from normal mice (40)
,
2-macroglobulin (41)
, and/or
anti-IL-2 antibody (42)
. Other binding factors may also be
involved because we have observed similar aggregation on incubation in
serum of an engineered antibody molecule with a scFv fused to the
COOH-terminal end of the CH3 domain
(4)
. Nonetheless, although the clearance of the
scFvFc.IL-2 was accelerated, its circulating half-life was considerably
prolonged compared with that for recombinant IL-2 (43)
.
Despite the rapid clearance of the scFvFc.IL-2 from the circulation, it specifically targeted antigen-positive tumors. Tumor localization ratios were similar to those obtained with either the scFvFc or the intact Mab until 48 h although the %ID/g of antigen-positive tumor of the fusion protein was significantly lower. Tumor:nontumor ratios for the fusion protein approximated those observed for the scFvFc and intact Mab in some reference tissues, whereas these values were lower with organs that have clearance functions such as liver and spleen. Becker et al. (6 , 44) found that a chimeric anti-GD2-IL-2 fusion protein localized specifically to pulmonary or hepatic metastases of a human melanoma xenograft or murine melanoma. Targeting of the latter fusion protein to melanoma xenografts growing s.c. was also observed, although much higher tumor accretion (6- to 10-fold) and tumor:nontumor ratios were obtained than ours (44) . Because the blood clearance of the fusion proteins appears similar between the present and former study, differences in tumor uptake may be due to higher expression of antigen on melanoma cells, different murine systems, or different forms of the fusion proteins. Furthermore, the localization of a control fusion protein was not examined by Becker et al. (44) such that a high level of nonspecific tumor uptake may have contributed to the localization observed with the fusion protein. Other studies have shown that with antibody protein doses up to 2 mg in rodents the percentage of antibody reaching the tumor remains the same (45 , 46) . Thus, as protein doses are increased in therapy studies, more fusion protein is expected to reach the tumor, but a concomitant increase in the level of fusion protein in normal tissues may be a limiting factor.
The level of tumor localization obtained with the scFvFc.IL-2 construct was sufficient to elicit growth inhibition of tumors expressing CEA. The growth of antigen-negative parental tumors was only marginally affected by fusion protein treatment, whereas injection of antibody alone or a mixture of antibody plus IL-2 did not alter the growth of MC-38.CEA tumors. The ineffectiveness of antibody alone was not surprising because CEA-specific Mabs are poor mediators of antibody-dependent cellular cytotoxicity (47) . The daily dose of IL-2 delivered as a fusion protein was also less than that of recombinant IL-2 reported by others to have an anti-MC-38 effect (48) . The therapeutic effects of the anti-CEA scFvFc.IL-2 were improved by injecting i.v. and extending the duration of treatment. However, tumor cures were not observed, whereas toxic effects precluded the use of higher doses of fusion protein. Whether targeting to antigen-positive normal tissues contributed to toxicity at these higher doses of fusion protein is currently being examined. Using reconstituted immunodeficient mouse models, it was found that anti-GD2-IL-2 fusion protein doses as low as 1 µg and containing 3000 IU of IL-2 cured mice of hepatic metastases of neuroblastoma xenografts (3 , 49) . Similar antitumor effects were also observed when slightly higher doses of fusion protein were used to treat melanoma or prostatic xenografts (44 , 50) or syngeneic colon carcinomas or B-cell lymphomas (51, 52, 53) . The blood clearance of the fusion protein used to treat murine B-cell lymphomas (51) was similar to that of the anti-CEA scFvFc.IL-2, suggesting that a shortened intravacular residence time does not explain the lower efficacy of the latter fusion protein. Factors that may account for the differences in antitumor effects between the present study and those of others are tumor type, antigen type, antigen expression, and/or tumor location. Furthermore, the antitumor properties of the anti-CEA fusion protein may have been limited by its faster egress from the tumor possibly caused in part by its higher koff. Also, IL-2 fusion proteins demonstrating profound antitumor properties were constructed with antibodies that can mediate antibody-dependent cellular cytotoxicity and complement-dependent cytotoxicity (CDC) activities that could potentiate the therapeutic effects of fusion proteins (3 , 51 , 52 , 54) . The present study examined the treatment of tumors growing s.c. It is possible that the anti-CEA fusion protein may show greater efficacy when studied in a more relevant metastatic tumor model.
Although immunotherapy with IL-2 has been most effective in patients with renal cell carcinoma and melanomas, responses have also been observed in patients with colorectal tumors treated with IL-2 in combination with lymphokine-activated killer cells (55) . Cytotoxic T cell activity against CEA peptides has also been elicited in peripheral blood lymphocytes derived from normal individuals and cancer patients (56 , 57) , suggesting that it may be possible to induce CEA-directed T cell responses in vivo. Our studies have shown that an immunocompetent mouse model for CEA provides opportunities to define the therapeutic properties of anti-CEA fusion proteins such as the IL-2 fusion protein characterized in the present study. Furthermore, because anti-CEA antibodies target tumors in patients (58) , another potential use for the anti-CEA scFcFv.IL-2 is the modulation of tumor vascular permeability to enhance the delivery of antibodies and other therapeutic reagents (5 , 9) . Finally, because CEA expression in normal tissues of transgenic mice parallels the distribution pattern in humans, the effect of fusion proteins on antigen-positive normal tissues can simultaneously be evaluated (18) .
| FOOTNOTES |
|---|
1 This work was supported by NIH Grant CA58327.
Additional support was from a NIH Cancer Core Grant to the City of Hope
(CA33572) and Vanderbilt-Ingram Cancer Center (CA68485). ![]()
2 To whom requests for reprints should be
addressed, at Vanderbilt University Medical Center, Department of
Pathology, C-3321 MCN, Nashville, TN 37232. ![]()
3 The abbreviations used are: Mab, monoclonal
antibody; IL-2, interleukin 2; BGP, biliary glycoprotein; EIA,
enzyme-linked immunoassay; %ID, percent injected dose;
L-MSX, L-methionine sulfoximine; scFv,
single-chain variable fragment; scFvFc, scFv joined to the
crystallizable fragment, Fc; VL, immunoglobulin light chain
variable domain; VH, immunoglobulin heavy chain variable
domain; NHS, normal human serum. ![]()
4 F. J. Primus, P, Clarke, Q. Shi, K,
Tompkins, G. Szalai, L. E. Williams, X. Xu, and M. F.
Hawthorne. A single-chain tetravalent bispecific antibody for targeting
carboranes to tumors, manuscript in preparation. ![]()
Received 1/27/00. Accepted 6/16/00.
| REFERENCES |
|---|
|
|
|---|
2-macroglobulin. J. Biol. Chem., 270: 8381-8384, 1995.This article has been cited by other articles:
![]() |
I. Poola, B. Shokrani, R. Bhatnagar, R. L. DeWitty, Q. Yue, and G. Bonney Expression of Carcinoembryonic Antigen Cell Adhesion Molecule 6 Oncoprotein in Atypical Ductal Hyperplastic Tissues Is Associated with the Development of Invasive Breast Cancer Clin. Cancer Res., August 1, 2006; 12(15): 4773 - 4783. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Olafsen, V. E. Kenanova, G. Sundaresan, A.-L. Anderson, D. Crow, P. J. Yazaki, L. Li, M. F. Press, S. S. Gambhir, L. E. Williams, et al. Optimizing Radiolabeled Engineered Anti-p185HER2 Antibody Fragments for In vivo Imaging Cancer Res., July 1, 2005; 65(13): 5907 - 5916. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schwegler, A. Dorn-Beineke, S. Nittka, C. Stocking, and M. Neumaier Monoclonal Anti-idiotype Antibody 6G6.C4 Fused to GM-CSF Is Capable of Breaking Tolerance to Carcinoembryonic Antigen (CEA) in CEA-Transgenic Mice Cancer Res., March 1, 2005; 65(5): 1925 - 1933. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kenanova, T. Olafsen, D. M. Crow, G. Sundaresan, M. Subbarayan, N. H. Carter, D. N. Ikle, P. J. Yazaki, A. F. Chatziioannou, S. S. Gambhir, et al. Tailoring the Pharmacokinetics and Positron Emission Tomography Imaging Properties of Anti-Carcinoembryonic Antigen Single-Chain Fv-Fc Antibody Fragments Cancer Res., January 15, 2005; 65(2): 622 - 631. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Zhang, W. Li, L. Holle, N. Chen, and W. Y. Chen A Novel Design of Targeted Endocrine and Cytokine Therapy for Breast Cancer Clin. Cancer Res., April 1, 2002; 8(4): 1196 - 1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Lehtolainen, A. Taskinen, J. Laukkanen, K. J. Airenne, S. Heino, M. Lappalainen, K. Ojala, V. Marjomaki, J. F. Martin, M. S. Kulomaa, et al. Cloning and Characterization of Scavidin, a Fusion Protein for the Targeted Delivery of Biotinylated Molecules J. Biol. Chem., March 1, 2002; 277(10): 8545 - 8550. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Carnemolla, L. Borsi, E. Balza, P. Castellani, R. Meazza, A. Berndt, S. Ferrini, H. Kosmehl, D. Neri, and L. Zardi Enhancement of the antitumor properties of interleukin-2 by its targeted delivery to the tumor blood vessel extracellular matrix Blood, March 1, 2002; 99(5): 1659 - 1665. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Soares, V. Mehta, and O. J. Finn Three Different Vaccines Based on the 140-Amino Acid MUC1 Peptide with Seven Tandemly Repeated Tumor-Specific Epitopes Elicit Distinct Immune Effector Mechanisms in Wild-Type Versus MUC1-Transgenic Mice with Different Potential for Tumor Rejection J. Immunol., June 1, 2001; 166(11): 6555 - 6563. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |