| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Molecular Biology and Genetics |
Department of Obstetrics and Gynecology [D. W., T. K., H. M., F. T., Y. I.] and First Department of Surgery [A. M., Y. S.], Gunma University School of Medicine, Gunma 3715-811, Japan; Second Department of Surgery, Fukushima Medical University, Fukushima 960-1295, Japan [S. T.]; and Department of Reproductive Physiology and Endocrinology, Medical Institute of Bioregulation, Kyushu University, Ohita 874-0838, Japan [N. W.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
CTGCGTGG) in exon 5 of
TGF-ß RI in 10 of 32 tumor samples
(31.3%). This mutation was associated with reduced or absent
expression of TGF-ß RI protein and p53 protein in tumor tissues. We
detected SSCP variants of TGF-ß RII
in exon 2 in 20 of 32 tumors. Sequence analysis of these
variants revealed an A to G transition at the seventh band of
intron 2. In this A to G polymorphism in intron 2, 12 samples (37.5%)
had A/A alleles, 12 (37.5%) had A/G alleles, and 8 (25%) had G/G
alleles. We detected Smad2 SSCP variants in exon 4 in 12
of 32 tumors (37.5%). Sequence analysis revealed a 2-bp deletion in
the polypyrimidine tract of intron 3, which is located at position -39
to -56 in the splice acceptor site of the intron 3-exon 4 junction. No
SSCP variants were detected in the Smad4 gene. These
findings suggest that mutations in the TGF-ß RI and in its signal
transduction pathway are likely responsible for human ovarian
carcinogenesis. |
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Seven human Smad proteins have been identified (2, 3, 4, 5) . Smad1 is thought to be a mediator of bone morphogenic protein signaling, whereas Smad2 and Smad3 are responsible for TGF-ß and activin signaling (6, 7, 8) . By forming a heteromeric complex with Smad2 and Smad3, Smad4 transduces TGF-ß or activin signals, whereas a complex composed of Smad1 and Smad4 transduces bone morphogenic protein signals (7 , 9) . Smad7 acts as an intracellular antagonist of the TGF-ß RI kinase domain (10) .
Mutations in TGF-ß-related genes seem to be closely linked to the progression of human tumors. Mutations in TGF-ß RI have been identified in chronic lymphocytic leukemia, prostate cancer, gastric cancer, and glioblastoma (11, 12, 13, 14) , and levels of TGF-ß RI expression are low in an ovarian cancer cell line (15) . Mutations of TGF-ß RII have also been found in gastric, colon, endometrial, colorectal, lung, and ovarian cancers (16, 17, 18, 19, 20, 21, 22) . Smad2 is a tumor suppressor gene located at 18q21, where DCC and Smad4 are also located (23) . Functionally disruptive mutations in Smad2 are features of colorectal cancers (2 , 4) and lung cancer (24) , suggesting that Smad2 plays a role in these types of carcinogenesis. Smad4 was originally cloned as a gene termed DPC4, which is frequently deleted in pancreatic adenocarcinoma (25) and relatively rare in other types of tumors (26, 27, 28) .
Although much is known about the role of the TGF-ß system as a tumor suppressor, little is understood about the TGF-ß system in conjunction with human ovarian cancers (15 , 24) . We therefore investigated the role of the TGF-ß system in ovarian carcinogenesis.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
.
All tissue fragments examined by molecular analysis were bordered by
another fragment that was processed for histological diagnosis and
confirmed as being malignant. All tissues were quickly frozen in liquid
nitrogen and stored at -80°C until analysis. In addition, normal
specimens were obtained from 14 corresponding normal tissues at the
time of surgery. Genomic DNA was isolated by standard proteinase K
digestion and phenol-chloroform extraction (27)
.
|
. One hundred and fifty pmol of each primer set (forward and reverse
primers) were labeled at the 5'-end with 10 µCi of
[
-32P]ATP (6000 Ci/mmol; Amersham Life
Science, Buckinghamshire, United Kingdom) using 5 units of T4
polynucleotide kinase (10 units/µl) and 0.5 µl of 10x T4
polynucleotide kinase buffer (Takara Shuzo, Shiga, Japan) in a total
volume of 5 µl. The mixture was incubated at 37°C for 30 min, and
the reaction was terminated at 65°C for 10 min. The PCR reaction
mixture contained 1 µl of genomic DNA (50 ng/µl), 0.125 µCi of
[-32P]ATP/sample of labeled primer sets, and
0.05 µl (5 units/µl) of Taq DNA polymerase (Wako Pure Chemical
Industries, Osaka, Japan) in a total volume of 5 µl. After the
initial denaturation step (94°C for 3 min), the amplification
conditions were 35 cycles of 94°C for 40 s, 55°C–58°C for
40 s, and 72°C for 90 s. The PCR products were diluted
1:2.5 with stop solution (95% formamide, 20 mM
EDTA, 0.02% xylene cyanol, and 0.05% bromphenol blue), and then 4
µl of each sample were loaded onto 0.5x Super Detection Gel Solution
(Toyobo Co., Ltd., Tokyo, Japan) in 0.6x Tris-borate EDTA buffer.
Samples were resolved by electrophoresis for 10–24 h at 6–12 W before
being dried and exposed to Kodak XAR film for approximately 24 h
at room temperature.
|
RNA Extraction and RT-PCR.
The cDNA of TGF-ß RI was analyzed by PCR-SSCP as follows. Total RNA
was extracted from the tissues and cells using ISOGEN-LS (Wako Nippon
Gene, Osaka, Japan) according to the manufacturer’s
instructions, and RT-PCR proceeded according to the protocol provided
with the SuperScript one-step RT-PCR system (Life Technologies, Inc.).
The primer sequence was as follows: (a) T1E5F (sense
primer), CCTGGGATTTATAGCAGCAGAC; and (b) T1E5R (antisense
primer), AATGGCTGGCTTTCCTTGGGTA. After the initial step (50°C for 30
min and 94°C for 2 min), the PCR reaction proceeded at 94°C for
15 s, 60°C for 30 s, and 72°C for 60 s (35 cycles) .
The products were resolved on a 1% agarose gel and visualized by
ethidium bromide staining. The purified reverse transcription
product was analyzed by PCR-SSCP.
LOH Analysis.
A LOH at 9q33–9q34 was examined using a PCR-based approach. Primers
for the marker were WI-7314, SHGC-12551, and L11695. Primers for each
pair were end-labeled with [-32P]ATP (6000
Ci/mmol; Amersham Life Science) and T4 polynucleotide kinase, and then
amplification proceeded using a PCR Thermal Cycler Personal (Takara
Biomedicals) at an annealing temperature of 60°C. The PCR products
were separated on a 0.5x Super Detection Gel (Toyobo Co., Ltd.) in
0.6x Tris-borate EDTA buffer and exposed to film.
Western Blotting.
The TGF-ß RI, p53, and Smad2 proteins were Western-blotted. About 20
µg of each tumor were lysed in 200 µl of sample buffer [60
mM Tris-HCl (pH 6.8), 100 mM DTT, and 2% SDS]
and vortex-mixed for 1 min, boiled for 5 min, and then passed through a
26-gauge needle with a 1-ml syringe. After monitoring at
A280/260 nm, lysates were
diluted with 1 unit of sample buffer (62.5 mM
Trizma, 2% SDS, 5% glycerol, and 2% 2-mercaptoethanol in distilled
water) to 20 units/ml (A280 nm = 1 is 1 unit), and then 20 µl (0.4 unit) were resolved
by electrophoresis in a 10% ready gel (Bio-Rad, Tokyo, Japan).
Gels were soaked in transfer buffer [48 mM
Tris-HCl, 39 mM glycine, 1.3
mM SDS, and 20% methanol (pH 9.2)], and
proteins were transferred to a Hybond enhanced chemiluminescence
nitrocellulose membrane (Amersham Life Science). Proteins were
immunoblotted using anti-TGF-ß RI (Santa Cruz Biotechnology),
anti-p53 (Santa Cruz Biotechnology) and anti-Smad2 as first antibodies
(Transduction Laboratories) and antirabbit immunoglobulin and antimouse
immunoglobulin as second antibodies (Amersham Life Science). Signals
were developed using the enhanced chemiluminescence Western blotting
detection system (Amersham Life Science). Anti-ß-actin antibody
(Sigma Chemical Co., St. Louis, MO) served as the control.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
shows representative results of the mutation analysis of TGF-ß RI
performed by PCR-SSCP, LOH, RT-PCR-SSCP, and Western blotting. Fig. 1
shows an extra band in patients 4T, 6T, 7T, 25T, and 28T. This is a
frameshift mutation caused by the insertion of 1 bp (G) at codons 276
and 277 (CTCTGGCTGCGTGG), respectively, in exon 5 (Fig. 2
) and the presence of a stop codon at codon 293. The LOH analysis
revealed that patients 4T, 6T, 9T, 23N, 23T, 25T, and 28T had an
allelic loss. In addition, samples with a frameshift mutation or
allelic loss neither stained for TGF-ß RI protein nor expressed p53
protein. No abnormal findings in any samples were detected by
RT-PCR-SSCP analysis. Overall findings regarding the TGFß
RI gene are shown in Table 1
. A band shifted in PCR-SSCP in
10 tumors (31.3%), and alleles were lost in 12 tumors (37.5%). Eleven
of 32 tumor samples (34.4%) did not express TGF-ß RI protein,
indicating that this insertion mutation is involved in human ovarian
carcinogenesis.
|
|
shows a TGFß RII SSCP polymorphism
in amplified exon 2. Sequence analysis revealed an AG transition at
the seventh band of intron 2. In the AG polymorphism in intron 2, 12
samples (37.5%) had A/A alleles, 12 (37.5%) had A/G alleles, and 8
(25%) had G/G alleles (Table 2)
. Fig. 4
shows PCR-SSCP analysis of Smad2 SSCP variants in exon 4. A
band shifted in patients 4T, 5T, 10T, 20T, and 21T. The bandshift was
similar in 12 of 32 samples (Table 2)
, and all bandshifts were
in cancer tissues, suggesting that these bandshifts were attributable
to somatic alterations. DNA fragments with unusual mobility were
reamplified by PCR and sequenced. Fig. 4B
shows a 2-bp
deletion in the polypyrimidine tract of intron 3 (T18),
which is located at position -39 to -56 in the splice acceptor site
of the intron 3-exon 4 junction. Western blotting did not show abnormal
expression of the Smad2 protein (data not shown).
|
|
The overall findings regarding the TGF-ß RI,
TGFß RII, and Smad2 genes are summarized
in Table 2
.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
shows that this mutation was not accompanied by
either TGF-ß RI expression or p53 proteins. Mutation of the
p53 gene is the most frequent genetic change in epithelial
ovarian cancers described to date (36
, 37)
. The loss of
p53 function attributable to mutations and/or deletions of this gene
during malignant transformation has been associated with the
development of resistance to the growth-inhibitory effect of TGF-ß
(39)
. Teramoto et al. (40)
showed
that TGF-ß1 increases the level of p53 protein expression and induces
rat liver-derived epithelial cells to undergo apoptosis. The results of
the present study suggest that TGF-ß RI
mutation is involved in human ovarian carcinogenesis.
Lynch et al. (22)
demonstrated a code-altering
mutation of TGF-ß RII in 6 of 24 ovarian
cancers by RT-PCR and cold SSCP. We found an AG transition at the
seventh base of intron 2 in eight ovarian cancers (25%). However, this
transition is a germ-line polymorphism, and it is not certain whether
it is involved in carcinogenesis. Cold SSCP is generally considered to
be much more sensitive than PCR-SSCP; therefore, one explanation is
that we overlooked the mutation found by Lynch et al.
(22)
. Nevertheless, we detected a polymorphism in intron
2, thus tending to discount this notion. In addition, race differences
are unlikely because all samples were of Japanese origin. The
discrepancy between the two studies remains unexplained. Mutations in
the TGF-ß RII gene have been identified in
other malignancies such as gastric, colon, endometrial, colorectal, and
lung cancers (16, 17, 18, 19, 20, 21)
, but the incidence of the
code-altering mutations is reportedly rare except in hereditary
nonpolyposis colorectal cancer and replication error
RER-positive gastric cancer. Additional studies using a larger
population are necessary.
The present study is the first to examine the involvement of Smad2 and Smad4 mutations in ovarian carcinogenesis. The Smad2 gene is altered in a small fraction of colorectal and lung cancers (2 , 3 , 24) . Riggins et al. (3) found a point mutation in exon 4 of the Smad2 gene and a deletion of 42 bases in exon 9 in a patient with colorectal cancer, and Uchida et al. (24) found a point mutation in exon 11 in lung cancer. On the other hand, Takenoshita et al. (41) , using 11 sets of intron-based primers that covered the entire coding region of the Smad2 gene, failed to find mutations in any exon but uncovered a deletion in the polypyrimidine tract preceding exon 4 in 2 of 60 sporadic colorectal cancers (3.3%). Using the same primers, we found the same deletion in 12 of 32 samples (37.5%) of ovarian cancer. Because the polypyrimidine tract is a consensus sequence at the splicing acceptor site of introns and is required for efficient splicesome assembly and for modulating branch site selection to splice pre-mRNAs correctly (42, 43, 44) , deletions within this region affect splicing efficiency and alter branch site usage. We examined whether or not T18 mutations induce aberrant expression of the Smad2 gene, but we did not detect any splicing abnormalities in this gene. Therefore, we could not confirm that the deletion in the polypyrimidine tract is involved in ovarian carcinogenesis. However, the fact that the deletion was not found in the patient-matched normal tissues suggests that this deletion is involved in ovarian carcinogenesis.
Smad4 is a downstream mediator for Smad2 (7) , and Schutte et al. (26) have identified Smad4 mutations in one of eight ovarian cancer cell lines. However, the present study did not find abnormalities in the Smad4 gene.
Table 2
shows that 21 of 32 tumor samples (65.6%) carried either one
or a combination of the following: (a) a frameshift mutation
in exon 5 of the TGF-ß RI gene; (b)
a single nucleotide polymorphism in the TGF-ß
RII gene; or (c) a sequence change in the
Smad2 gene. Although a causal link between mutations in the
TGF-ß gene and ovarian carcinogenesis remains unclear, the
present study suggests that the TGF-ß system is involved as a tumor
suppressor in ovarian carcinogenesis and more specifically points to
the likelihood of a mutation in TGF-ß RI
contributing to human ovarian cancer.
|
FOOTNOTES |
|---|
1 Supported by Grant-in-Aid for Scientific
Research (C) 09671664 from the Ministry of Education, Science, Sports
and Culture of Japan. 
2 To whom requests for reprints should be
addressed, at Department of Obstetrics and Gynecology, Gunma University
School of Medicine, 3-39-22 Showamachi, Maebashi, Gunma 3715-811,
Japan. Phone: 81-27-220-8423; Fax: 81-27-220-8443.
3 The abbreviations used are: TGF-ß,
transforming growth factor ß; RI, receptor type I; RII, receptor type
II; RT-PCR, reverse transcription-PCR; SSCP, single-strand
conformational polymorphism; LOH, loss of heterozygosity.
Received 7/ 6/99. Accepted 6/12/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  B. Ragazzon, L. Cazabat, M. Rizk-Rabin, G. Assie, L. Groussin, H. Fierrard, K. Perlemoine, A. Martinez, and J. Bertherat Inactivation of the Carney Complex Gene 1 (Protein Kinase A Regulatory Subunit 1A) Inhibits SMAD3 Expression and TGF{beta}-Stimulated Apoptosis in Adrenocortical Cells Cancer Res., September 15, 2009; 69(18): 7278 - 7284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Lei, R.-Y. Liu, J. Zhao, Z. Liu, X. Jiang, W. You, X.-F. Chen, X. Liu, K. Zhang, B. Pasche, et al. TGFBR1 Haplotypes and Risk of Non-Small-Cell Lung Cancer Cancer Res., September 1, 2009; 69(17): 7046 - 7052. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. E. Wang, B. Xiang, M. Guix, M. G. Olivares, J. Parker, C. H. Chung, A. Pandiella, and C. L. Arteaga Transforming Growth Factor {beta} Engages TACE and ErbB3 To Activate Phosphatidylinositol-3 Kinase/Akt in ErbB2-Overexpressing Breast Cancer and Desensitizes Cells to Trastuzumab Mol. Cell. Biol., September 15, 2008; 28(18): 5605 - 5620. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Chen, P. Ghosh, H. Osawa, C. Y. Sasaki, L. Rezanka, J. Yang, T. J. O'Farrell, and D. L. Longo Resistance to TGF-{beta}1 correlates with aberrant expression of TGF-{beta} receptor II in human B-cell lymphoma cell lines Blood, June 15, 2007; 109(12): 5301 - 5307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Sunde, H. Donninger, K. Wu, M. E. Johnson, R. G. Pestell, G. S. Rose, S. C. Mok, J. Brady, T. Bonome, and M. J. Birrer Expression Profiling Identifies Altered Expression of Genes That Contribute to the Inhibition of Transforming Growth Factor-{beta} Signaling in Ovarian Cancer. Cancer Res., September 1, 2006; 66(17): 8404 - 8412. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Pasche, T. J. Knobloch, Y. Bian, J. Liu, S. Phukan, D. Rosman, V. Kaklamani, L. Baddi, F. S. Siddiqui, W. Frankel, et al. Somatic Acquisition and Signaling of TGFBR1*6A in Cancer JAMA, October 5, 2005; 294(13): 1634 - 1646. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Ding, Q. Tang, V. Espina, L. A. Liotta, D. T. Mauger, and K. M. Mulder A Transforming Growth Factor-{beta} Receptor-Interacting Protein Frequently Mutated in Human Ovarian Cancer Cancer Res., August 1, 2005; 65(15): 6526 - 6533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Wang, F. Y. Wu, I. Shin, S. Qu, and C. L. Arteaga Transforming Growth Factor {beta} (TGF-{beta})-Smad Target Gene Protein Tyrosine Phosphatase Receptor Type Kappa Is Required for TGF-{beta} Function Mol. Cell. Biol., June 1, 2005; 25(11): 4703 - 4715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. C. Flanders and J. K. Burmester Medical Applications of Transforming Growth Factor-{beta} Clin. Med. Res., January 1, 2003; 1(1): 13 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Hamamoto, H. Beppu, H. Okada, M. Kawabata, T. Kitamura, K. Miyazono, and M. Kato Compound Disruption of Smad2 Accelerates Malignant Progression of Intestinal Tumors in Apc Knockout Mice Cancer Res., October 15, 2002; 62(20): 5955 - 5961. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. D. Dunfield, E. J. C. Dwyer, and M. W. Nachtigal TGF{beta}-Induced Smad Signaling Remains Intact in Primary Human Ovarian Cancer Cells Endocrinology, April 1, 2002; 143(4): 1174 - 1181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Fuller, E. T. Zumpe, S. Chu, P. Mamers, and H. G. Burger Inhibin-Activin Receptor Subunit Gene Expression in Ovarian Tumors J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1395 - 1401. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. W. Baxter, D. Y. H. Choong, D. M. Eccles, and I. G. Campbell Transforming Growth Factor {beta} Receptor 1 Polyalanine Polymorphism and Exon 5 Mutation Analysis in Breast and Ovarian Cancer Cancer Epidemiol. Biomarkers Prev., February 1, 2002; 11(2): 211 - 214. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Docagne, N. Colloc'h, V. Bougueret, M. Page, J. Paput, M. Tripier, P. Dutartre, E. T. MacKenzie, A. Buisson, S. Komesli, et al. A Soluble Transforming Growth Factor-beta (TGF-beta ) Type I Receptor Mimics TGF-beta Responses J. Biol. Chem., November 30, 2001; 276(49): 46243 - 46250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lassus, R. Salovaara, L. A. Aaltonen, and R. Butzow Allelic Analysis of Serous Ovarian Carcinoma Reveals Two Putative Tumor Suppressor Loci at 18q22-q23 Distal to SMAD4, SMAD2, and DCC Am. J. Pathol., July 1, 2001; 159(1): 35 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chen, J. Triplett, B. Dehner, B. Hurst, B. Colligan, J. Pemberton, J. R. Graff, and J. H. Carter Transforming Growth Factor-{beta} Receptor Type I Gene Is Frequently Mutated in Ovarian Carcinomas Cancer Res., June 1, 2001; 61(12): 4679 - 4682. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-R. Chen, Y. Kang, and J. Massague Inaugural Article: Defective repression of c-myc in breast cancer cells: A loss at the core of the transforming growth factor beta growth arrest program PNAS, January 30, 2001; 98(3): 992 - 999. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
