Cancer Research Targets  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Takenoshita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Takenoshita, S.
[Cancer Research 60, 4507-4512, August 15, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

Analysis of Specific Gene Mutations in the Transforming Growth Factor-ß Signal Transduction Pathway in Human Ovarian Cancer1

Dan Wang, Tatsuya Kanuma, Hideki Mizunuma2, Fumiko Takama, Yoshito Ibuki, Norio Wake, Akira Mogi, Yoshinori Shitara and Seiichi Takenoshita

Department of Obstetrics and Gynecology [D. W., T. K., H. M., F. T., Y. I.] and First Department of Surgery [A. M., Y. S.], Gunma University School of Medicine, Gunma 3715-811, Japan; Second Department of Surgery, Fukushima Medical University, Fukushima 960-1295, Japan [S. T.]; and Department of Reproductive Physiology and Endocrinology, Medical Institute of Bioregulation, Kyushu University, Ohita 874-0838, Japan [N. W.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Several proteins, including transforming growth factor ß (TGF-ß) receptor type I (RI), TGF-ß receptor type II (RII), Smad2, Smad3, and Smad4/DPC4, have been identified in the transduction pathway of the tumor suppressor TGF-ß. Mutations in TGF-ß RI, TGF-ß RII, Smad2, and Smad4/DPC4 genes are associated with several human cancers. The present study examines these gene mutations in 32 human ovarian cancers and 14 patient-matched normal tissues. For the first time, mutations in the Smad2 and Smad4 genes were analyzed in relation to human ovarian cancer. Gene mutations of TGF-ß RI, TGF-ß RII, Smad2, and Smad4 were analyzed using specific primers by PCR-single-strand conformational polymorphism (SSCP), and the results revealed a frameshift mutation at codons 276–277 (CTCTGG->CTGCGTGG) in exon 5 of TGF-ß RI in 10 of 32 tumor samples (31.3%). This mutation was associated with reduced or absent expression of TGF-ß RI protein and p53 protein in tumor tissues. We detected SSCP variants of TGF-ß RII in exon 2 in 20 of 32 tumors. Sequence analysis of these variants revealed an A to G transition at the seventh band of intron 2. In this A to G polymorphism in intron 2, 12 samples (37.5%) had A/A alleles, 12 (37.5%) had A/G alleles, and 8 (25%) had G/G alleles. We detected Smad2 SSCP variants in exon 4 in 12 of 32 tumors (37.5%). Sequence analysis revealed a 2-bp deletion in the polypyrimidine tract of intron 3, which is located at position -39 to -56 in the splice acceptor site of the intron 3-exon 4 junction. No SSCP variants were detected in the Smad4 gene. These findings suggest that mutations in the TGF-ß RI and in its signal transduction pathway are likely responsible for human ovarian carcinogenesis.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The TGF-ß3 superfamily regulates cell proliferation, differentiation, adhesion, and apoptosis and thus controls embryonal development, tissue recycling, and wound repair (1) . TGF-ß binds directly to the TGF-ß RII, which is a constitutively active transmembrane serine/threonine kinase that recruits TGF-ß RI and phosphorylates one or more substrates to initiate a signal cascade such as that of Smad proteins (2) .

Seven human Smad proteins have been identified (2, 3, 4, 5) . Smad1 is thought to be a mediator of bone morphogenic protein signaling, whereas Smad2 and Smad3 are responsible for TGF-ß and activin signaling (6, 7, 8) . By forming a heteromeric complex with Smad2 and Smad3, Smad4 transduces TGF-ß or activin signals, whereas a complex composed of Smad1 and Smad4 transduces bone morphogenic protein signals (7 , 9) . Smad7 acts as an intracellular antagonist of the TGF-ß RI kinase domain (10) .

Mutations in TGF-ß-related genes seem to be closely linked to the progression of human tumors. Mutations in TGF-ß RI have been identified in chronic lymphocytic leukemia, prostate cancer, gastric cancer, and glioblastoma (11, 12, 13, 14) , and levels of TGF-ß RI expression are low in an ovarian cancer cell line (15) . Mutations of TGF-ß RII have also been found in gastric, colon, endometrial, colorectal, lung, and ovarian cancers (16, 17, 18, 19, 20, 21, 22) . Smad2 is a tumor suppressor gene located at 18q21, where DCC and Smad4 are also located (23) . Functionally disruptive mutations in Smad2 are features of colorectal cancers (2 , 4) and lung cancer (24) , suggesting that Smad2 plays a role in these types of carcinogenesis. Smad4 was originally cloned as a gene termed DPC4, which is frequently deleted in pancreatic adenocarcinoma (25) and relatively rare in other types of tumors (26, 27, 28) .

Although much is known about the role of the TGF-ß system as a tumor suppressor, little is understood about the TGF-ß system in conjunction with human ovarian cancers (15 , 24) . We therefore investigated the role of the TGF-ß system in ovarian carcinogenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Samples and DNA Extraction.
Thirty-two primary ovarian cancers were surgically resected (Table 2)Citation . All tissue fragments examined by molecular analysis were bordered by another fragment that was processed for histological diagnosis and confirmed as being malignant. All tissues were quickly frozen in liquid nitrogen and stored at -80°C until analysis. In addition, normal specimens were obtained from 14 corresponding normal tissues at the time of surgery. Genomic DNA was isolated by standard proteinase K digestion and phenol-chloroform extraction (27) .


View this table:
[in this window]
[in a new window]

 
Table 2 Clinical characteristics of patients with each gene alteration in primary ovarian cancer

 
PCR-SSCP Analysis.
Mutations in exons of the TGF-ß RI, TGF-ß RII, Smad2, and Smad4 genes were analyzed by PCR-SSCP. Each exon was amplified using the PCR primers shown in Table 1Citation . One hundred and fifty pmol of each primer set (forward and reverse primers) were labeled at the 5'-end with 10 µCi of [{gamma}-32P]ATP (6000 Ci/mmol; Amersham Life Science, Buckinghamshire, United Kingdom) using 5 units of T4 polynucleotide kinase (10 units/µl) and 0.5 µl of 10x T4 polynucleotide kinase buffer (Takara Shuzo, Shiga, Japan) in a total volume of 5 µl. The mixture was incubated at 37°C for 30 min, and the reaction was terminated at 65°C for 10 min. The PCR reaction mixture contained 1 µl of genomic DNA (50 ng/µl), 0.125 µCi of [{gamma}-32P]ATP/sample of labeled primer sets, and 0.05 µl (5 units/µl) of Taq DNA polymerase (Wako Pure Chemical Industries, Osaka, Japan) in a total volume of 5 µl. After the initial denaturation step (94°C for 3 min), the amplification conditions were 35 cycles of 94°C for 40 s, 55°C–58°C for 40 s, and 72°C for 90 s. The PCR products were diluted 1:2.5 with stop solution (95% formamide, 20 mM EDTA, 0.02% xylene cyanol, and 0.05% bromphenol blue), and then 4 µl of each sample were loaded onto 0.5x Super Detection Gel Solution (Toyobo Co., Ltd., Tokyo, Japan) in 0.6x Tris-borate EDTA buffer. Samples were resolved by electrophoresis for 10–24 h at 6–12 W before being dried and exposed to Kodak XAR film for approximately 24 h at room temperature.


View this table:
[in this window]
[in a new window]

 
Table 1 List of primer sequences for amplification of each exon of each gene

 
Sequence Analysis.
DNA fragments with mobility shifts were excised from the dried gels and reamplified by PCR using the corresponding set of primers for 40 cycles. Amplified DNA fragments were resolved by electrophoresis by 1.5% agarose gels, and then excised bands were purified by Suprec-01 column chromatography (Takara Shuzo) and ethanol precipitation. Purified DNA fragments were sequenced in triplicate by dideoxy chain termination using the Takara Taq Cycle Sequencing Kits (Takara Shuzo), ABI Prism Dye Terminator Cycle Sequencing Ready Reaction Kits (Perkin-Elmer, Foster City, CA), and an ABI 373 automated sequencer (Applied Biosystems, Inc.).

RNA Extraction and RT-PCR.
The cDNA of TGF-ß RI was analyzed by PCR-SSCP as follows. Total RNA was extracted from the tissues and cells using ISOGEN-LS (Wako Nippon Gene, Osaka, Japan) according to the manufacturer’s instructions, and RT-PCR proceeded according to the protocol provided with the SuperScript one-step RT-PCR system (Life Technologies, Inc.). The primer sequence was as follows: (a) T1E5F (sense primer), CCTGGGATTTATAGCAGCAGAC; and (b) T1E5R (antisense primer), AATGGCTGGCTTTCCTTGGGTA. After the initial step (50°C for 30 min and 94°C for 2 min), the PCR reaction proceeded at 94°C for 15 s, 60°C for 30 s, and 72°C for 60 s (35 cycles) . The products were resolved on a 1% agarose gel and visualized by ethidium bromide staining. The purified reverse transcription product was analyzed by PCR-SSCP.

LOH Analysis.
A LOH at 9q33–9q34 was examined using a PCR-based approach. Primers for the marker were WI-7314, SHGC-12551, and L11695. Primers for each pair were end-labeled with [{gamma}-32P]ATP (6000 Ci/mmol; Amersham Life Science) and T4 polynucleotide kinase, and then amplification proceeded using a PCR Thermal Cycler Personal (Takara Biomedicals) at an annealing temperature of 60°C. The PCR products were separated on a 0.5x Super Detection Gel (Toyobo Co., Ltd.) in 0.6x Tris-borate EDTA buffer and exposed to film.

Western Blotting.
The TGF-ß RI, p53, and Smad2 proteins were Western-blotted. About 20 µg of each tumor were lysed in 200 µl of sample buffer [60 mM Tris-HCl (pH 6.8), 100 mM DTT, and 2% SDS] and vortex-mixed for 1 min, boiled for 5 min, and then passed through a 26-gauge needle with a 1-ml syringe. After monitoring at A280/260 nm, lysates were diluted with 1 unit of sample buffer (62.5 mM Trizma, 2% SDS, 5% glycerol, and 2% 2-mercaptoethanol in distilled water) to 20 units/ml (A280 nm = 1 is 1 unit), and then 20 µl (0.4 unit) were resolved by electrophoresis in a 10% ready gel (Bio-Rad, Tokyo, Japan). Gels were soaked in transfer buffer [48 mM Tris-HCl, 39 mM glycine, 1.3 mM SDS, and 20% methanol (pH 9.2)], and proteins were transferred to a Hybond enhanced chemiluminescence nitrocellulose membrane (Amersham Life Science). Proteins were immunoblotted using anti-TGF-ß RI (Santa Cruz Biotechnology), anti-p53 (Santa Cruz Biotechnology) and anti-Smad2 as first antibodies (Transduction Laboratories) and antirabbit immunoglobulin and antimouse immunoglobulin as second antibodies (Amersham Life Science). Signals were developed using the enhanced chemiluminescence Western blotting detection system (Amersham Life Science). Anti-ß-actin antibody (Sigma Chemical Co., St. Louis, MO) served as the control.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Fig. 1Citation shows representative results of the mutation analysis of TGF-ß RI performed by PCR-SSCP, LOH, RT-PCR-SSCP, and Western blotting. Fig. 1Citation shows an extra band in patients 4T, 6T, 7T, 25T, and 28T. This is a frameshift mutation caused by the insertion of 1 bp (G) at codons 276 and 277 (CTCTGG->CTGCGTGG), respectively, in exon 5 (Fig. 2Citation ) and the presence of a stop codon at codon 293. The LOH analysis revealed that patients 4T, 6T, 9T, 23N, 23T, 25T, and 28T had an allelic loss. In addition, samples with a frameshift mutation or allelic loss neither stained for TGF-ß RI protein nor expressed p53 protein. No abnormal findings in any samples were detected by RT-PCR-SSCP analysis. Overall findings regarding the TGFß RI gene are shown in Table 1Citation . A band shifted in PCR-SSCP in 10 tumors (31.3%), and alleles were lost in 12 tumors (37.5%). Eleven of 32 tumor samples (34.4%) did not express TGF-ß RI protein, indicating that this insertion mutation is involved in human ovarian carcinogenesis.



View larger version (46K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. LOH, Western blots, PCR-SSCP, and RT-PCR-SSCP of TGF-ß RI. The top two panels show PCR-SSCP and RT-PCR-SSCP. PCR-SSCP variants were detected in patients 4, 6, 7, 9, 25T, and 28T; no variants were detected by RT-PCR-SSCP. The third panel shows representative examples of LOH for the L11695marker. Alleles were lost in patients 4, 6, 7, 9, 23, 25T, and 28T. The bottom panel shows expression of TGF-ß RI protein, p53 protein, and ß-actin (control). TGF-ß RI protein was undetectable in patients 4, 6, 7, 9, 23T, 25T, and 28T.

 


View larger version (120K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Frameshift mutations of the polyadenine tract in exon 5 caused by the insertion of 1 bp (G) at codons 276 and 277 were detected. 28N, normal tissue; 28T, tumor tissue.

 
Mutations in the TGFß RII, Smad2, and Smad4 genes were analyzed using PCR-SSCP. Fig. 3ACitation shows a TGFß RII SSCP polymorphism in amplified exon 2. Sequence analysis revealed an A->G transition at the seventh band of intron 2. In the A->G polymorphism in intron 2, 12 samples (37.5%) had A/A alleles, 12 (37.5%) had A/G alleles, and 8 (25%) had G/G alleles (Table 2)Citation . Fig. 4Citation shows PCR-SSCP analysis of Smad2 SSCP variants in exon 4. A band shifted in patients 4T, 5T, 10T, 20T, and 21T. The bandshift was similar in 12 of 32 samples (Table 2)Citation , and all bandshifts were in cancer tissues, suggesting that these bandshifts were attributable to somatic alterations. DNA fragments with unusual mobility were reamplified by PCR and sequenced. Fig. 4BCitation shows a 2-bp deletion in the polypyrimidine tract of intron 3 (T18), which is located at position -39 to -56 in the splice acceptor site of the intron 3-exon 4 junction. Western blotting did not show abnormal expression of the Smad2 protein (data not shown).



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Polymorphism of the TGF-ß RII gene detected by PCR-SSCP analysis and DNA sequencing using intron-based primers surrounding exon 2 in ovarian cancer tumors and corresponding normal samples. A, SSCP variants in patients 29 and 30 (case 31 was a wild type). B, patient 29 has an A->G transition at the seventh base of intron 2, patient 30 has an A/G allele, and patient 31 has a normal sequence.

 


View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. Mutation of the Smad2 gene in ovarian cancer samples detected by PCR-SSCP analysis and by DNA sequencing using intron-based primers. A, SSCP variants were detected in exon 4 from patients 4, 5, 20T, and 21T. N, normal tissue. T, tumor. B, mutation of T18 in intron 3. Two bases are deleted at the polypyrimidine tract (T16) of patient 4. Normal sequence (T18) is displayed on the left.

 
We did not detect SSCP variants in any exon of Smad4 (data not shown).

The overall findings regarding the TGF-ß RI, TGFß RII, and Smad2 genes are summarized in Table 2Citation .


    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Epithelial ovarian cancer is one of the most lethal gynecological malignancies. Despite advances in surgical techniques and chemotherapeutic agents, the overall survival rates for women with this disease have not improved significantly. Although the precise cause of epithelial ovarian cancer is unknown, several environmental and reproductive factors have been proposed as etiological factors (29, 30, 31) . Familial ovarian cancer accounts for less than 5% of all cancers and occurs as a site-specific phenomenon combined with breast cancer or with endometrial cancer and a hereditary form of colon cancer (25 , 26) . Oncogene abnormalities (32, 33, 34, 35) and mutations of the p53 gene (36 , 37) have been described as being associated with ovarian cancer. The TGF-ß superfamily, a type of tumor suppressor, and its specific receptors are expressed in the human ovary (15 , 22) . TGF-ß suppresses the proliferation of human ovarian epithelial cells and inhibits [3 H]thymidine incorporation into primary ovarian cancers (38) , suggesting that human ovarian cancer is also under the influence of TGF-ß. The present study therefore examined the roles of TGF-ß receptor mutations and the intracellular signal pathways of the TGF-ß system in ovarian cancer. TGF-ßs must bind specific receptors to exert biological action. Among these, TGF-ß RI and TGF-ß RII are responsible for transducing signals into cytoplasmic elements. Therefore, a lack or mutation in TGF-ß RI and/or TGF-ß RII causes the TGF-ß system to lose its function. Levels of TGF-ß RI expression are low in an ovarian cancer cell line (15) . The present study demonstrated a frameshift mutation in exon 5 in 10 of 32 tumor samples (31.3%). This frameshift was detected in tumor tissues but not in normal counterparts. In addition, samples with a frameshift mutation in exon 5 also had a LOH, confirming the mutation. However, the mutation was not demonstrated by RT-PCR-SSCP. The discrepancy between the results of PCR-SSCP and those of RT-PCR-SSCP may be accounted for by contamination of the normal tissues and/or by impaired transcription of the mutant DNA. Fig. 1Citation shows that this mutation was not accompanied by either TGF-ß RI expression or p53 proteins. Mutation of the p53 gene is the most frequent genetic change in epithelial ovarian cancers described to date (36 , 37) . The loss of p53 function attributable to mutations and/or deletions of this gene during malignant transformation has been associated with the development of resistance to the growth-inhibitory effect of TGF-ß (39) . Teramoto et al. (40) showed that TGF-ß1 increases the level of p53 protein expression and induces rat liver-derived epithelial cells to undergo apoptosis. The results of the present study suggest that TGF-ß RI mutation is involved in human ovarian carcinogenesis.

Lynch et al. (22) demonstrated a code-altering mutation of TGF-ß RII in 6 of 24 ovarian cancers by RT-PCR and cold SSCP. We found an A->G transition at the seventh base of intron 2 in eight ovarian cancers (25%). However, this transition is a germ-line polymorphism, and it is not certain whether it is involved in carcinogenesis. Cold SSCP is generally considered to be much more sensitive than PCR-SSCP; therefore, one explanation is that we overlooked the mutation found by Lynch et al. (22) . Nevertheless, we detected a polymorphism in intron 2, thus tending to discount this notion. In addition, race differences are unlikely because all samples were of Japanese origin. The discrepancy between the two studies remains unexplained. Mutations in the TGF-ß RII gene have been identified in other malignancies such as gastric, colon, endometrial, colorectal, and lung cancers (16, 17, 18, 19, 20, 21) , but the incidence of the code-altering mutations is reportedly rare except in hereditary nonpolyposis colorectal cancer and replication error RER-positive gastric cancer. Additional studies using a larger population are necessary.

The present study is the first to examine the involvement of Smad2 and Smad4 mutations in ovarian carcinogenesis. The Smad2 gene is altered in a small fraction of colorectal and lung cancers (2 , 3 , 24) . Riggins et al. (3) found a point mutation in exon 4 of the Smad2 gene and a deletion of 42 bases in exon 9 in a patient with colorectal cancer, and Uchida et al. (24) found a point mutation in exon 11 in lung cancer. On the other hand, Takenoshita et al. (41) , using 11 sets of intron-based primers that covered the entire coding region of the Smad2 gene, failed to find mutations in any exon but uncovered a deletion in the polypyrimidine tract preceding exon 4 in 2 of 60 sporadic colorectal cancers (3.3%). Using the same primers, we found the same deletion in 12 of 32 samples (37.5%) of ovarian cancer. Because the polypyrimidine tract is a consensus sequence at the splicing acceptor site of introns and is required for efficient splicesome assembly and for modulating branch site selection to splice pre-mRNAs correctly (42, 43, 44) , deletions within this region affect splicing efficiency and alter branch site usage. We examined whether or not T18 mutations induce aberrant expression of the Smad2 gene, but we did not detect any splicing abnormalities in this gene. Therefore, we could not confirm that the deletion in the polypyrimidine tract is involved in ovarian carcinogenesis. However, the fact that the deletion was not found in the patient-matched normal tissues suggests that this deletion is involved in ovarian carcinogenesis.

Smad4 is a downstream mediator for Smad2 (7) , and Schutte et al. (26) have identified Smad4 mutations in one of eight ovarian cancer cell lines. However, the present study did not find abnormalities in the Smad4 gene.

Table 2Citation shows that 21 of 32 tumor samples (65.6%) carried either one or a combination of the following: (a) a frameshift mutation in exon 5 of the TGF-ß RI gene; (b) a single nucleotide polymorphism in the TGF-ß RII gene; or (c) a sequence change in the Smad2 gene. Although a causal link between mutations in the TGF-ß gene and ovarian carcinogenesis remains unclear, the present study suggests that the TGF-ß system is involved as a tumor suppressor in ovarian carcinogenesis and more specifically points to the likelihood of a mutation in TGF-ß RI contributing to human ovarian cancer.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by Grant-in-Aid for Scientific Research (C) 09671664 from the Ministry of Education, Science, Sports and Culture of Japan. Back

2 To whom requests for reprints should be addressed, at Department of Obstetrics and Gynecology, Gunma University School of Medicine, 3-39-22 Showamachi, Maebashi, Gunma 3715-811, Japan. Phone: 81-27-220-8423; Fax: 81-27-220-8443. Back

3 The abbreviations used are: TGF-ß, transforming growth factor ß; RI, receptor type I; RII, receptor type II; RT-PCR, reverse transcription-PCR; SSCP, single-strand conformational polymorphism; LOH, loss of heterozygosity. Back

Received 7/ 6/99. Accepted 6/12/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Kingsley D. M. The TGF-ß superfamily: new numbers, new receptors, and new genetic tests of function in different organisms. Genes Dev., 8: 133-146, 1994.[Free Full Text]
  2. Massagué J. TGFß signaling: receptors, transducers, and mad proteins. Cell, 85: 947-950, 1996.[Medline]
  3. Riggins G. J., Kinzler K. W., Vogelstein B., Thiagalingam S. Frequency of Smad gene mutations in human cancers. Cancer Res., 57: 2578-2580, 1997.[Abstract/Free Full Text]
  4. Eppert K., Scherer S. W., Ozcelik H., Pirone R., Hoodless P., Kim H., Tsui L. C., Bapat B., Gallinger S., Andrulis I. L., Thomsen G. H., Wrana J. L., Attisano L. MADR2 maps to 18q21 and encodes a TGFß MAD-related protein that is functionally mutated in colorectal carcinoma. Cell, 86: 543-552, 1996.[Medline]
  5. Topper J. N., Cai J., Qiu Y., Anderson K. R., Xu, Y-Y., Deeds J. M., Feeley R., Gimeno C. J., Woolf E. A., Mays G. G., Sampson B. A., Schoen F. J., Gimbrone, M. A., Jr., Falb D. Vascular MADs: two novel MAD-related genes selectively inducible by flow in human vascular endothelium. Proc. Natl. Acad. Sci. USA, 94: 9314-9319, 1997.[Abstract/Free Full Text]
  6. Hoodless P. A., Haerry T., Abdollah S., Stapleton M., O’Connor M. B., Attisano L., Wrana J. L. MADR1, a MAD-related protein that functions in BMP2 signaling pathway. Cell, 85: 489-500, 1996.[Medline]
  7. Zhang Y., Feng X. H., Wu R. Y., Derynck R. Receptor-associated Mad homologues synergize as effectors of the TGF-ß response. Nature (Lond.), 383: 168-172, 1996.[Medline]
  8. Macias-Silva M., Abdollah S., Hoodless P. A., Pirone R., Attisano L., Wraana J. L. MADR2 is a substrate of the TGFß receptor and its phosphorylation is required for nuclear accumulation and signaling. Cell, 87: 1215-1224, 1996.[Medline]
  9. Lagna G., Hata A., Massagué J. Partnership between DPC4 and SMAD protein in TGF-ß signaling pathway. Nature (Lond.), 383: 832-836, 1996.[Medline]
  10. Hayashi H., Abdollah S., Qiu Y., Cai J., Xu Y. Y., Grinnell B. W., Richardson M. A., Topper J. N., Gimbrone, M. A., Jr., Wrana J. L., Falb D. The MAD-related protein Smad7 associates with the TGFß receptor and functions as an antagonist of TGFß signaling. Cell, 89: 1165-1173, 1997.[Medline]
  11. DeCoteau J. F., Knaus P. I., Yankelev H., Reis M. D., Lowsky R., Lodish H. F., Kadin M. E. Loss of functional cell surface transforming growth factor ß (TGF-ß) type 1 receptor correlates with insensitivity to TGF-ß in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. USA, 94: 5877-5881, 1997.[Abstract/Free Full Text]
  12. Kim I. Y., Ahn H-J., Zelner D. J., Shaw J. W., Sensibar J. A., Kim J-H., Kato M., Lee C. Genetic change in transformating growth factor ß (TGF-ß) receptor type I gene correlates with insensitivity to TGF-ß1 in human prostate cancer cells. Cancer Res., 56: 44-48, 1996.[Abstract/Free Full Text]
  13. Yoshida K., Yokozaki H., Niimoto M., Ito H., Ito M., Tahara E. Expression of TGF-ß and procollagen type I and type III in human gastric carcinomas. Int. J. Cancer, 44: 394-398, 1989.[Medline]
  14. Yamada N., Kato M., Yamashita H., Nister M., Miyazono K., Heldin C. H., Funa K. Enhanced expression of transforming growth factor-ß and its type-I and type-II receptor in human glioblastoma. Int. J. Cancer, 62: 386-392, 1995.[Medline]
  15. Jakowlew S. B., Moody T. W., Mariano J. M. Transforming growth factor-ß receptors in human cancer cell lines: analysis of transcript, protein and proliferation. Anticancer Res., 17: 1849-1860, 1997.[Medline]
  16. Shitara Y., Yokozaki H., Yasui W., Takenoshita S., Nagamachi Y., Tahara E. Mutation of the transforming growth factor-ß type II receptor gene is a rare event in human sporadic gastric carcinomas. Int. J. Oncol., 12: 1061-1065, 1998.[Medline]
  17. Takenoshita S., Tani M., Nagashima M., Hagiwara K., Bennett W. P., Yokota J., Harris C. C. Mutation analysis of coding sequences of the entire transforming growth factor ß type II receptor gene in sporadic human colon cancer using genomic DNA and intron primers. Oncogene, 14: 1255-1258, 1997.[Medline]
  18. Markowitz S., Wang J., Myeroff L., Parsons R., Sun L. Z., Lutterbaugh J., Fan R. S., Zborowska E., Kinzler K. W., Vogelstein B., Brattain M., Willson J. K. V. Inactivation of the type II TGF-ß receptor in colon cancer cells with microsatellite instability. Science (Washington DC), 268: 1336-1338, 1995.[Abstract/Free Full Text]
  19. Myeroff L. L., Parsons R., Kim S-J., Hedrick L., Cho K. R., Orth K., Mathis M., Kinzler K. W., Lutterbaugh J., Park K., Bang Y-J., Lee H. Y., Park J-G., Lynch H. T., Roberts A. B., Vogelstein B., Markowitz S. D. A transforming growth factor ß receptor type II gene mutation common in colon and gastric but rare in endometrial cancers with microsatellite instability. Cancer Res., 55: 5545-5547, 1995.[Abstract/Free Full Text]
  20. Parsons R., Myeroff L., Liu B., Willson J. K. V., Markowitz S., Kinzler K. W., Vogelstein B. Microsatellite instability and mutations of the transforming growth factor ß type II receptor gene in colorectal cancer. Cancer Res., 55: 5548-5550, 1995.[Abstract/Free Full Text]
  21. Takenoshita S., Hagiwara K., Gemma A., Nagashima M., Ryberg D., Lindstedt B. A., Bennett W. P., Haugen A., Harris C. C. Absence of mutations in the transformation growth factor-ß type II receptor in sporadic lung cancers with microsatellite instability and rare H-ras1 alleles. Carcinogenesis (Lond.), 18: 1427-1429, 1997.[Abstract/Free Full Text]
  22. Lynch M. A., Nakashima R., Song H., DeGroff V. L., Wang D., Enomoto T., Weghorst C. M. Mutational analysis of the transforming growth factor receptor type II gene in human ovarian carcinoma. Cancer Res., 58: 4227-4232, 1998.[Abstract/Free Full Text]
  23. Thiagalingam S., Lengauer C., Leach F. S., Schutte M., Hahn S. A., Overhauser J., Willson J. K. V., Markowitz S., Hamilton S. R., Kern S. E., Kinzler K. W., Vogelstein B. Evaluation of candidate tumor suppressor genes on chromosome 18 in colorectal cancers. Nat. Genet., 13: 343-346, 1996.[Medline]
  24. Uchida K., Nagatake M., Osada H., Yatabe Y., Kondo M., Mitsudomi T., Masuda A., Takahashi T., Takahashi T. Somatic in vivo alterations of the JV18–1 gene at 18q21 in human lung cancers. Cancer Res., 56: 5583-5585, 1996.[Abstract/Free Full Text]
  25. Hahn S. A., Schutte M., Hoque A. T. M. S., Moskaluk C. A., da Costa L. T., Rozenblum E., Weinstein C. L., Fischer A., Yeo C. J., Hruban R. H., Kern S. E. DPC4, a candidate tumor suppressor gene at human chromosome 18q21. 1. Science (Washington DC), 271: 350-353, 1996.[Abstract]
  26. Schutte, M., Hruban, R. H., Hedrick, L., Cho, K. R., Nadasdy, G. M., Weinstein, C. L., Bova, G. S., Isaacs, W. B., Cairns, P., Nawroz, H., Sidransky, D., Casero, R. A., Jr., Meltzer, P. S., Hahn, S. A., and Kern, S. E. DPC4 gene in various tumor types. Cancer Res., 56: 2527–2530, 1996.
  27. Sambrook, J., Fritsch, E. F., and Maniatis, T. Isolation of high-molecular-weight DNA from mammalian cells. Molecular Cloning: A Laboratory Manual, pp. 9.14–9.30. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
  28. Sambrook, J., Fritsch, E. F., and Maniatis, T. Analysis of genomic DNA by Southern hybridization. Molecular Cloning: A Laboratory Manual, pp. 9.31–9.58. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.
  29. Menczer J., Modan M., Ranon L., Golan A. Possible role of mumps virus in the etiology of ovarian cancer. Cancer (Phila.), 43: 1375-1379, 1979.[Medline]
  30. Rose D. P., Boyar A. P., Wynder E. L. International comparisons of mortality rates for cancer of the breast, ovary, prostate, and colon, and per capita food consumption. Cancer (Phila.), 58: 2363-2371, 1986.[Medline]
  31. Longo D. L., Young R. C. Cosmetic talc and ovarian cancer. Lancet, 2: 349-351, 1979.[Medline]
  32. Slamon D. J., Godolphin W., Jones L. A., Holy J. A., Wong S. G., Keith D. E., Leith W. J., Stuart S. G., Udove J., Ullrich A. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science (Washington DC), 244: 702-712, 1989.[Abstract/Free Full Text]
  33. Berchuck A., Kamel A., Whitaker R., Kerns B., Olt G., Kinney R., Soper J. T., Dodge R., Clarke-Pearson D. L., Marks P., McKenzie S., Yin S., Bast R. C., Jr. Overexpression of HER-2/neu is associated with poor survival in advanced epithelial ovarian cancer. Cancer Res., 50: 4087-4091, 1990.[Abstract/Free Full Text]
  34. Borst M. P., Baker V. V., Dixon D., Hatch K. D., Shingleton H. M. , and Miller,D. M. Oncogene alterations in endometrial carcinoma. Gynecol. Oncol., 38: 364-366, 1990.[Medline]
  35. Sasano H., Garrett C. T., Wilkinson D. S., Silverberg S., Comerford J., Hyde J. Protooncogene amplification and tumor ploidy in human ovarian neoplasms. Hum. Pathol., 21: 382-391, 1990.[Medline]
  36. Harris A. L. Mutant p53: the commonest genetic abnormality in human cancer?. J. Pathol., 162: 5-6, 1990.[Medline]
  37. Marks J. R., Davidoff A. M., Kerns B. J., Humphrey P. A., Pence J. C., Dodge R. K., Clarke-Pearson, D. L., Iglehart J. D., Bast, R. C., Jr., Berchuck A. Overexpression and mutation of p53 in epithelial ovarian cancer. Cancer Res., 51: 2979-2984, 1991.[Abstract/Free Full Text]
  38. Havrilesky L. J., Hurteau J. A., Whitaker R. S., Elbendary A., Wu S., Rodriguez G. C., Bast, R. C., Jr., Berchuck A. Regulation of apoptosis in normal and malignant ovarian epithelial cells by transforming growth factor ß. Cancer Res., 55: 944-948, 1995.[Abstract/Free Full Text]
  39. Reiss M., Vellucci V. F., Zhou Z-L. Mutant p53 tumor suppressor gene causes resistance to transforming growth factor ß 1 in murine keratinocytes. Cancer Res., 53: 899-904, 1993.[Abstract/Free Full Text]
  40. Teramoto T., Kiss A., Thorgeirsson S. S. Induction of p53 and Bax during TGF-ß1 initiated apoptosis in rat liver epithelial cells. Biochem. Biophys. Res. Commun., 251: 56-60, 1998.[Medline]
  41. Takenoshita S., Tani M., Mogi A., Nagashima M., Nagamachi Y., Bennett W. P., Hagiwara K., Harris C. C., Yokata J. Mutation analysis of the Smad2 gene in human colon cancer using genomic DNA, and intron primers. Carcinogenesis (Lond.), 19: 803-807, 1998.[Abstract/Free Full Text]
  42. Fu X. Y., Ge H., Manley J. L. The role of the polypyrimidine stretch at the SV40 early pre-mRNA 3' splice site in alternative splicing. EMBO J., 7: 809-817, 1988.[Medline]
  43. Roscigno R. F., Weiner M., Garcia-Blanco M. A. A mutational analysis of the polypyrimidine tract of introns. J. Biol. Chem., 268: 11222-11229, 1993.[Abstract/Free Full Text]
  44. Norton P. A. Polypyrimidine tract sequence direct selection of alternative branch sites and influence protein binding. Nucleic Acids Res., 22: 3854-3860, 1994.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
B. Ragazzon, L. Cazabat, M. Rizk-Rabin, G. Assie, L. Groussin, H. Fierrard, K. Perlemoine, A. Martinez, and J. Bertherat
Inactivation of the Carney Complex Gene 1 (Protein Kinase A Regulatory Subunit 1A) Inhibits SMAD3 Expression and TGF{beta}-Stimulated Apoptosis in Adrenocortical Cells
Cancer Res., September 15, 2009; 69(18): 7278 - 7284.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Z. Lei, R.-Y. Liu, J. Zhao, Z. Liu, X. Jiang, W. You, X.-F. Chen, X. Liu, K. Zhang, B. Pasche, et al.
TGFBR1 Haplotypes and Risk of Non-Small-Cell Lung Cancer
Cancer Res., September 1, 2009; 69(17): 7046 - 7052.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. E. Wang, B. Xiang, M. Guix, M. G. Olivares, J. Parker, C. H. Chung, A. Pandiella, and C. L. Arteaga
Transforming Growth Factor {beta} Engages TACE and ErbB3 To Activate Phosphatidylinositol-3 Kinase/Akt in ErbB2-Overexpressing Breast Cancer and Desensitizes Cells to Trastuzumab
Mol. Cell. Biol., September 15, 2008; 28(18): 5605 - 5620.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Chen, P. Ghosh, H. Osawa, C. Y. Sasaki, L. Rezanka, J. Yang, T. J. O'Farrell, and D. L. Longo
Resistance to TGF-{beta}1 correlates with aberrant expression of TGF-{beta} receptor II in human B-cell lymphoma cell lines
Blood, June 15, 2007; 109(12): 5301 - 5307.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. S. Sunde, H. Donninger, K. Wu, M. E. Johnson, R. G. Pestell, G. S. Rose, S. C. Mok, J. Brady, T. Bonome, and M. J. Birrer
Expression Profiling Identifies Altered Expression of Genes That Contribute to the Inhibition of Transforming Growth Factor-{beta} Signaling in Ovarian Cancer.
Cancer Res., September 1, 2006; 66(17): 8404 - 8412.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
B. Pasche, T. J. Knobloch, Y. Bian, J. Liu, S. Phukan, D. Rosman, V. Kaklamani, L. Baddi, F. S. Siddiqui, W. Frankel, et al.
Somatic Acquisition and Signaling of TGFBR1*6A in Cancer
JAMA, October 5, 2005; 294(13): 1634 - 1646.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
W. Ding, Q. Tang, V. Espina, L. A. Liotta, D. T. Mauger, and K. M. Mulder
A Transforming Growth Factor-{beta} Receptor-Interacting Protein Frequently Mutated in Human Ovarian Cancer
Cancer Res., August 1, 2005; 65(15): 6526 - 6533.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. E. Wang, F. Y. Wu, I. Shin, S. Qu, and C. L. Arteaga
Transforming Growth Factor {beta} (TGF-{beta})-Smad Target Gene Protein Tyrosine Phosphatase Receptor Type Kappa Is Required for TGF-{beta} Function
Mol. Cell. Biol., June 1, 2005; 25(11): 4703 - 4715.
[Abstract] [Full Text] [PDF]


Home page
Clin Med ResHome page
K. C. Flanders and J. K. Burmester
Medical Applications of Transforming Growth Factor-{beta}
Clin. Med. Res., January 1, 2003; 1(1): 13 - 20.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Hamamoto, H. Beppu, H. Okada, M. Kawabata, T. Kitamura, K. Miyazono, and M. Kato
Compound Disruption of Smad2 Accelerates Malignant Progression of Intestinal Tumors in Apc Knockout Mice
Cancer Res., October 15, 2002; 62(20): 5955 - 5961.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. D. Dunfield, E. J. C. Dwyer, and M. W. Nachtigal
TGF{beta}-Induced Smad Signaling Remains Intact in Primary Human Ovarian Cancer Cells
Endocrinology, April 1, 2002; 143(4): 1174 - 1181.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
P. J. Fuller, E. T. Zumpe, S. Chu, P. Mamers, and H. G. Burger
Inhibin-Activin Receptor Subunit Gene Expression in Ovarian Tumors
J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1395 - 1401.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
S. W. Baxter, D. Y. H. Choong, D. M. Eccles, and I. G. Campbell
Transforming Growth Factor {beta} Receptor 1 Polyalanine Polymorphism and Exon 5 Mutation Analysis in Breast and Ovarian Cancer
Cancer Epidemiol. Biomarkers Prev., February 1, 2002; 11(2): 211 - 214.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Docagne, N. Colloc'h, V. Bougueret, M. Page, J. Paput, M. Tripier, P. Dutartre, E. T. MacKenzie, A. Buisson, S. Komesli, et al.
A Soluble Transforming Growth Factor-beta (TGF-beta ) Type I Receptor Mimics TGF-beta Responses
J. Biol. Chem., November 30, 2001; 276(49): 46243 - 46250.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Lassus, R. Salovaara, L. A. Aaltonen, and R. Butzow
Allelic Analysis of Serous Ovarian Carcinoma Reveals Two Putative Tumor Suppressor Loci at 18q22-q23 Distal to SMAD4, SMAD2, and DCC
Am. J. Pathol., July 1, 2001; 159(1): 35 - 42.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Chen, J. Triplett, B. Dehner, B. Hurst, B. Colligan, J. Pemberton, J. R. Graff, and J. H. Carter
Transforming Growth Factor-{beta} Receptor Type I Gene Is Frequently Mutated in Ovarian Carcinomas
Cancer Res., June 1, 2001; 61(12): 4679 - 4682.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C.-R. Chen, Y. Kang, and J. Massague
Inaugural Article: Defective repression of c-myc in breast cancer cells: A loss at the core of the transforming growth factor beta growth arrest program
PNAS, January 30, 2001; 98(3): 992 - 999.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, D.
Right arrow Articles by Takenoshita, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, D.
Right arrow Articles by Takenoshita, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online