Cancer Research Meeting Calendar  Sign up for Cancer Research eTOC's
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, S. E. H.
Right arrow Articles by Johnston, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, S. E. H.
Right arrow Articles by Johnston, P. G.
[Cancer Research 60, 4729-4734, September 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Isolation and Mapping of a Human Septin Gene to a Region on Chromosome 17q, Commonly Deleted in Sporadic Epithelial Ovarian Tumors1

S. E. Hilary Russell2, Michael A. McIlhatton, James F. Burrows, Paul G. Donaghy, Severine Chanduloy, Elizabeth M. Petty, Linda M. Kalikin, Stewart W. Church, Stephen McIlroy, D. Paul Harkin, Gillian W. Keilty, Aaron N. Cranston, Jean Weissenbach, Ivor Hickey and Patrick G. Johnston

Department of Oncology [S. E. H. R., M. M., J. F. B., P. G. D., S. C., S. W. C., S. M., D. P. H., G. W. K., A. N. C., P. G. J.], School of Biology and Biochemistry [I. H.], The Queen’s University of Belfast, Belfast BT9 7AB, United Kingdom; Department of Internal Medicine, University of Michigan, Michigan 48109-0638 [E. M. P., L. M. K.]; and Genethon 1, 91002 Evry Cedex, France [J. W.]


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
Allele losses from chromosome 17 are common in sporadic ovarian tumors. Previously, we reported high rates of LOH (up to 70%) from 17q25 at the marker THH59 in a bank of malignant ovarian tumors. We have extended this study to 70 tumors with 17 markers from the long arm of chromosome 17. In most cases, the data are consistent with whole chromosome loss, but we have identified a minimal region of deletion that is centered around 4 microsatellites with zero recombination at map position 106.9 cM. A P1/BAC contig across the region (~200 kb) was constructed and used to determine the precise position and order of the microsatellites. The contig was shown to hybridize to 17q25 by fluorescence in situ hybridization analysis. The DNA sequence of the entire contig was determined and analyzed by BLAST searches. A 4-kb cDNA was subsequently identified with homology to the yeast, Drosophila and mammalian septin family of genes. We have designated this gene Ovarian/Breast (Ov/Br) septin. Two splice variants were demonstrated within the 200-kb contig, which differ only at exon 1. Within the contig, ~45% of the septin {alpha} transcript was identified and 38% of the septin ß transcript. The septins are a family of genes involved in cytokinesis and cell cycle control. Their known functions are consistent with the hypothesis that the human 17q25 septin gene is a candidate for the ovarian tumor suppressor gene.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
Identification of tumor suppressor genes has characteristically been by linkage analysis in families with an inherited predisposition to a particular tumor type or by deletion mapping in a bank of sporadic tumors. In the latter case, polymorphic markers have been used to determine overlapping deleted regions by comparison of tumor DNA with matched control DNA. This LOH3 analysis has led to the identification of such minimum regions of deletion and the localization of several tumor suppressor genes. In 1990, we and others provided evidence for high rates of LOH from the long arm of chromosome 17 in sporadic epithelial ovarian tumors (1 , 2) . Whereas LOH could be demonstrated with polymorphic markers from both the long and short arms of this chromosome, the highest rates of loss were detected with the VNTR probe THH59 (D17S4, 17q23–25). Up to 70% of malignant tumors showed loss with this marker, and LOH was detected in a benign tumor, suggesting that such loss may reflect the inactivation of a gene early in malignancy. In a larger follow-up study (3) , we showed that this loss was present in all histological subtypes and correlated with tumor stage but could still be detected in early stage disease. The LOH from the short arm occurred in later stage disease, possibly reflecting inactivation of the p53 gene. Numerous other reports have confirmed this high rate of LOH from chromosome 17 and demonstrated that the pattern of LOH in the majority of tumors is consistent with loss of the whole chromosome (4) . Moreover, in those tumors in which a partial deletion from 17q can be detected, the partially deleted region is distal of BRCA1, the familial breast/ovarian gene (5 , 6) . This therefore suggested that BRCA1 was not the target of deletion on 17q in sporadic ovarian disease and that there may be another tumor suppressor on distal chromosome 17q. LOH analysis in a bank of 39 sporadic breast tumors identified a region of interstitial loss of approximately 3 cM around D17S937 on chromosome 17q (7) . Subsequently, it was shown that approximately half of a group of 32 ovarian tumors had losses coincident with this region (8) . In this study, we report the results of deletion analysis of a large bank of ovarian tumors from patients with no obvious family history of ovarian cancer and provide evidence of a discrete region of loss from distal 17q. We have carried out fine mapping and further localized the common region of deletion to between D17S1790 and afm203wc5, an interval of zero recombination at map position 106.9 cM. By positional cloning efforts, we have identified a gene from this region that is a member of the septin family of proteins that are conserved in organisms as divergent as yeast and humans. Recently, there have been two reports identifying this same septin gene as the fusion partner of the MLL gene in t(11;17)(q23;q25) in two patients with therapy-related AML and de novo AML (9 , 10) . The septins have been shown to localize to the cleavage site of mitotic cells and are essential for cytokinesis in both yeast and animal cells. However, they are also thought to have a variety of other roles in morphogenesis and the organization of the cell surface (reviewed in Ref. 11 ). The sequences of the known septins contain a P-loop nucleotide-binding domain consistent with GTPase activity. Many of the septins also contain predicted coiled-coil domains near their COOH termini. However, the sequence similarity is greatest within the central portion of the peptide with the NH2- and COOH-terminal regions being more divergent in both length and sequence.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
LOH Analysis.
Tumor samples were obtained from surgically resected material and snap frozen in liquid nitrogen. Tumors were staged according to the International Federation of Gynaecology and Obstetrics classification. Peripheral blood samples were obtained from each patient. High molecular weight DNA was isolated by standard methods of SDS-proteinase K and phenol chloroform. Standard Southern blot analysis was carried out with the markers YNZ22 (D17S5), EW206 (D17S57), CMM86 (D17S74), THH59 (D17S4), KKA35 (D17S75), and RMU3 (D17S24). Genomic DNAs were restricted with the appropriate enzyme, separated on a 1.2% agarose gel, and blotted onto Hybond N+ (Amersham Pharmacia). DNA was labeled with [{alpha}-32P]dCTP by random hexamer priming and hybridized overnight at 65°C. Filters were washed to 2x SSC at 42°C and autoradiographed at -70°C for 2–7 days. For PCR analysis of microsatellite markers, the forward primer was end-labeled with [{gamma}-32P]ATP and T4 polynucleotide kinase.4 Primer sequences for the microsatellite marker afm203wc5 were provided by Genethon. PCR was carried out in a final volume of 15 µl containing 100 ng of target DNA, 250 nM primers, 2.5 mM MgCl2, 200 µM deoxynucleotide triphosphates, 1x Taq buffer, and 0.35 unit of Taq polymerase. The reaction conditions were 95°C for 5 min and then 30 cycles of 95°C for 30 s, 55°C for 1 min, and 72°C for 1 min with a final extension step of 72°C for 5 min. Two µl of the PCR product were electrophoresed on a denaturing polyacrylamide gel that was autoradiographed at -70°C for 8–24 h.

LOH was assessed by direct visual comparison of the relative allelic ratios present in matched normal and tumor DNAs. To ensure that allelic intensities were within the linear range, multiple exposures of each autoradiograph were carried out. Autoradiographs were scored independently by at least two authors. A representative autoradiograph is shown in Fig. 1ACitation . LOH was scored if one allele was absent or exhibited altered signal intensity in tumor DNA relative to the allelic ratio of normal DNA. We have conventionally referred to this alteration of allelic signal within a tumor sample as LOH. However, with this analysis it is not possible to distinguish between allele losses and gains, and such allelic imbalance could also represent amplification of a mutant allele.



View larger version (32K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. a, autoradiograh of PCR products with the microsatellite marker afm107ye3 (D17S937). Lanes 1, 2, and 3 are control, primary, and secondary tumor DNA from patient 8 in Fig. 1Citation c; Lanes 4 and 5 are control and tumor DNA from patient 9 in Fig. 1Citation c; and Lanes 6 and 7 are control and tumor DNA from patient 10 in Fig. 1Citation c. LOH was observed in tumor DNA from patients 8 and 9. Patient 10 was uninformative at this marker. b, ideogram of chromosome 17 with approximate positions of the markers used in this study and the percentage of LOH observed at each locus (in parentheses). c, partial deletions from chromosome 17q25 in ovarian tumors. Map position obtained from the Whitehead Institute (H, heterozygous; L, loss of heterozygosity; U, uninformative; ND, not done; Muc, mucinous; Ser, serous; End, endometrioid; Un, undifferentiated; Bl, borderline; Bn, benign; Mal, malignant).

 
PCR reactions with tumors and markers showing partial deletions were repeated twice to confirm the scoring and again read independently by two authors.

Restriction Mapping.
P1 and BAC DNAs were restricted with NotI, SalI, and NotI/SalI. The digest was fractionated on a 1% agarose gel by pulsed field gel electrophoresis using the CHEF Mapper System (Bio-Rad). The gel was blotted onto Hybond N+ (Amersham Pharmacia) and probed with P1 and BAC insert end probes. Briefly, riboprobes were generated from the SP6 and T7 promoters of the P1 and BAC vectors using the riboprobe in vitro Transcription System (Promega).

FISH Analysis.
FISH was carried out on normal human lymphocytes metaphase spreads. Biotinylated probes were prepared by nick translation of BAC DNA with biotin-16-dUTP (Boehringer) and DNA polymerase I and DNase I (Life Technologies, Inc.). Slides were hybridized for 72 h and washed to 0.2x SSC (pH 7.0) at 42°C. Detection of bound probe was carried out with avidin/Texas Red, and one round of amplification of signal was performed.

Northern Blot Analysis.
A 387-bp PCR product was amplified from HeLa cDNA by primers ABO 01 (5'-CGG AGA TCA CCA TCG TCA AAC C-3') and ABO 02 (5'-ACG TAG CCG AAG TCC ACC GG-3') corresponding to nucleotides 1207–1594 of Ov/Br septin {alpha}. This probe is common to both {alpha} and ß transcripts because it is derived from exon 2 and the start of exon 3. The DNA was labeled with [{alpha}-32P]dCTP (Amersham Pharmacia) by the Megaprime DNA Labeling System (Amersham Pharmacia). Human multiple tissue Northern blots were obtained from Clontech, and hybridization was carried out according to the manufacturer’s instructions.

Mutation Analysis.
Total RNA was purified from snap-frozen tumor samples using RNA Stat60 (Biogenesis) according to the manufacturer’s instructions. RNA (5 µg) was reverse transcribed using Moloney Murine Leukemia Virus reverse transcriptase (Life Technologies, Inc.) and random hexamer primer. cDNA (1 µl) was amplified by PCR in a volume of 50 µl. The final concentration of reagents in the reaction was 20 mM Tris-HCl (pH 8.4), 1.5 mM MgCl2, 50 mM KCl, 200 nM each primer, 200 µM each deoxynucleotide triphosphate, 2 units of Taq DNA polymerase (Life Technologies, Inc.). Cycling conditions of 94°C for 2 min and then 35 cycles of 94°C, 30 s; 58°C, 30 s; and 72°C, 60 s were used. The following primer sets were used to amplify overlapping fragments of the Ov/Br {alpha} and ß septin open reading frames: primers ABO13F, TGAGAAAGGGGAGGCCGCCTCTG (708–730) and ABO10R, ACCTTGGAGGCAGGGGGCTC (1236–1217); primers ABO01F, CGGAGATCACCATCGTCAAACC (1170–1191) and ABO04R, GGTTGATGTTGACCTCCTCCTG (1916–1895); primers ABO05F, CGAGAACTGCTGGCAGCCCATC (1874–1895) and ABO08R, GAAATGACTTGGGGGCAGGAT (2526–2500). The numbers in parentheses refer to the positions of each primer with reference to the septin sequence, accession number AF123052. PCR products were purified with the Wizard PCR Preps DNA Purification System (Promega) and sequenced with ABI Prism BigDye Terminator Cycle Sequencing chemistry. Sequence data were compared with the above septin sequence (AF123052).


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
LOH Studies.
A bank of 70 sporadic ovarian tumors composed of 43 malignant, 5 borderline, and 22 benign lesions was investigated for LOH with 19 markers from chromosome 17. The relative position of these markers along the chromosome and the percentage of LOH observed at this position is shown in Fig. 1BCitation . The highest rates of LOH were detected between the markers D17S785 and D17S75 at distal 17q. The extent of LOH from chromosome 17 was determined for tumors that were informative at a minimum of eight loci (50 of the 70 tumors examined). Tumors were classified as having extensive loss (i.e., loss of the whole chromosome or at least the q arm) or partial deletion. These results are summarized in Table 1Citation . Within the tumor bank, 31 malignant tumors were informative for at least eight loci. No LOH was observed in 3 whereas 20 showed extensive LOH consistent with whole chromosome loss. One malignant tumor had partial LOH from the short arm, whereas 7 tumors demonstrated partial LOH from the long arm. In 2 cases, this LOH was across a large area of proximal 17q and included the region of the BRCA1 gene. In the remaining 5, the LOH was from distal 17q. Within the group of 16 benign tumors examined, 12 had no detectable LOH, 1 had whole chromosome loss, 1 had LOH from the short arm only, and 2 had LOH from distal 17q. Of the three borderline tumors, 1 had no detectable LOH, 1 had LOH from the short arm, and 1 had LOH from distal 17q. Screening the original 70 tumors and a further additional 30 tumors with a series of markers that map to 17q25, identified a group of 10 tumors with confined deletions at 17q25 (Fig. 1C)Citation . Analysis of these tumors with partial deletions has refined the region of interest to a position within 4 polymorphic microsatellites with zero recombination at map position 106.9 cM. This is also the region to which the VNTR probe, THH59, used in the original LOH study has been mapped (12) .


View this table:
[in this window]
[in a new window]

 
Table 1 Extent of allele loss from chromosome 17 in sporadic ovarian tumors

 
Physical Mapping.
A P1/BAC contig was constructed to cover this region (13) . Three P1s and one BAC were obtained that screened positive for either D17S939 or D17S937. To determine the relationship of these P1s and BAC to each other, a NotI/SalI restriction map was constructed by generating riboprobes from the ends of each P1 and BAC and hybridizing them sequentially to NotI/SalI restrictions on Southern blots. The order and location of the 4 microsatellites was determined in two ways. Primers for PCR with these microsatellites were end labeled and used as probes in Southern blot experiments of NotI/SalI digests. Additionally, individual NotI/SalI fragments were gel purified and used as templates for PCR with individual microsatellites. The complete restriction map and position of the markers is shown in Fig. 2ACitation . The BAC was used as a probe in FISH experiments and hybridized to distal 17q (Fig. 2C)Citation .



View larger version (29K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. a, restriction map of P1 655 g10 and BAC 334m6 showing NotI an SalI restriction sites and the position of the microsatellite markers D17S1790, D17S937, D17S939, and afm203wc5. S, SalI; N, NotI; SP6, SP6 promoter; T7, T7 promoter. b, genomic structure of the candidate gene, Ov/Br septin, predicted from the DNA sequence of the contig. 1{alpha}, 1ß, and 2–6 represent exons of the candidate gene. Exons 1{alpha} and 1ß are two alternate 5' exons. c, FISH analysis of normal human lymphocyte metaphase spreads with the BAC 334m6. d, Northern blot analysis of Ov/Br septin in normal tissues. Multiple tissue Northern blots (Clontech) were hybridized with a 387-bp PCR product amplified by ABO 01 and ABO 02 (see text). Two major transcripts of 4.3 and 4 kb are apparent in approximately half of the tissues, whereas in the remainder, only the 4.3 kb was detected.

 
Sequencing.
DNA sequencing of the largest P1 (655 g10) and the BAC was performed. Briefly, each was restricted and subcloned to provide approximately a six-deep coverage that was then sequenced automatically. The sequence of the individual contigs was ordered and assembled. The DNA sequence was then subjected to BLAST searches. Further analysis with individual ESTs revealed by the BLAST searches identified 1502 nucleotides of a 4-kb septin cDNA lying within the contig. This cDNA was isolated from brain tissue and lodged recently in GenBank (accession number AB023208). From the sequence of the 4-kb cDNA (which we have named the ß transcript), we have been able to identify the genomic structure of the first six exons of this gene. There is an intron of ~27 kb between exons 1 and 2 and the predicted coding sequence begins at position 733 bp within exon 2. The coding sequence is 1266 bp in length and codes for a protein of 422 amino acids and predicted molecular weight of Mr 47,500. We have also identified a splice variant of this transcript (which we have named the {alpha} transcript) that differs at the 5' end because of an alternative exon 1. The alternative first exon is located ~57 kb upstream from exon 1ß and is 833 bases in length. The coding sequence is 1704 bp in length and begins at position 813 bp of exon 1. It codes for a protein of 568 amino acids and predicted molecular weight of Mr 63,600. The available genomic structure is summarized in Fig. 2BCitation . A PCR product generated from exon 2 and the beginning of exon 3 and thus common to both the {alpha} and ß transcripts was used as a probe in Northern blot experiments against a variety of normal tissue RNAs (Fig. 2D)Citation . A 4-kb and 4.3-kb transcript were evident in 10 tissues (spleen, thymus, prostate, testis, ovary, small intestine, colon, peripheral blood lymphocyte, heart, and pancreas), and there was variation in their relative amounts. In the remaining tissues, only the 4.3-kb transcript was detected.

Mutation Analysis.
A preliminary mutation analysis was carried out by direct sequencing of cDNA from tumor samples with partial deletions in distal chromosome 17q. cDNA was available for 7 of the 10 tumors shown in Fig. 1CCitation (samples 1–3, 5, 6, 8, and 10). Primer sets were used to amplify six overlapping fragments of the Ov/Br {alpha} and ß septin open reading frames for direct sequencing. Base changes were observed in three of seven samples: in sample 1, a GTG to ATG (Val/Met) at position 2484 bp; in sample 6, a CCC to CCG (Pro/Pro) at position 890 bp, a CGC to TGC (Arg/Cys) at position 984 bp, a CCG to CTG (Pro/Leu) at position 1192 bp; and in sample 10, a CCG to CCA (Pro/Pro) at position 2510 bp. All base changes were also identified in matched control samples. With the exception of the base change at position 984 bp in sample 6, the other changes result in conservative or semiconservative amino acid changes. However, the C->T change at position 984 bp in sample 6 only alters the coding sequence of the {alpha} transcript and represents a dramatic change from a charged amino acid (Arg) to a polar amino acid with a sulfydryl side chain (Cys).


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
Despite recent advances in the understanding of the molecular abnormalities associated with sporadic ovarian cancer, the overall 5-year survival still remains very low mainly because of a lack of early diagnosis. There is now clear evidence that genes on chromosome 17 play a crucial role in the development of epithelial ovarian tumors. Indeed, the highest rates of LOH from any chromosomal region in ovarian tumors are from this chromosome.

Since our initial report in 1990 of high rates of LOH from 17q, there have been other reports of LOH from this chromosome in these tumors. Whole chromosome loss was demonstrated in the majority of malignant tumors (4) . In our analysis of 70 tumors with 19 markers and considering only tumors that were informative at more than eight loci, a similar pattern of LOH has emerged. In frankly malignant disease, the pattern of loss in 65% of tumors was consistent with loss of one copy of chromosome 17. In 5 of the remaining malignant tumors, a partial loss involving distal 17q was detected. These results would therefore indicate a crucial role in ovarian malignancy for a gene on distal 17q that is often accompanied by allelic imbalance at all chromosome 17 loci.

There has been the suggestion that benign, borderline, and malignant ovarian tumors and also the various histological subtypes may each follow a different molecular pathway (14) . Our findings of partial deletions in benign, borderline, and malignant disease and in serous, endometrioid, and mucinous tumors would indicate that this putative tumor suppressor gene is common to all of these pathways and may be an early event.

Previous reports in the literature describing partial deletions from 17q in sporadic ovarian tumors have delineated regions that are proximal to that described in our study. One study described a 16-cM common region of deletion delineated by nm23 and GH (5) , whereas another identified a 25-cM region delineated by GH and D17S4 (6) . In both studies only a limited number of markers in the 17q23–25 region were used, the most distal being D17S4 and D17S75, respectively. Also, a close examination of the individual cases in both studies reveals that the majority of deletions are in fact quite large, and in only 4 of 14 cases was the distal boundary of the deletion identified. The small region of deletion that we describe falls within the larger deleted regions of 11 of 14 tumors documented in the previous studies.

In addition, this study extends more recent data from an analysis of 39 breast tumors (7) and 32 ovarian tumors (8) in which an overlapping region of interstitial loss of ~3 cM around D17S937 was identified. The common region of deletion that we describe is defined by four microsatellite markers D17S1790, D17S937, D17S939, and afm203wc5, which lie within an area of zero recombination at map position 106.9 cM.

We also demonstrate that this region covers ~200 kb of genomic DNA and contains part of the coding sequence of two splice variants of a human septin gene. It is also now apparent that at least three of the four microsatellite markers used originally to define the minimal region of deletion (D17S937, D17S939, and afm 203wc5) fall within the genomic sequence of the septin gene, thus confirming that LOH is actually observed at this locus. In keeping with observations from other septins, this protein has a P-loop nucleotide binding domain. A CLUSTAL alignment of seven human septins is shown in Fig. 3Citation . It demonstrates the conserved central core of the septin proteins and highlights the variability at the NH2 and COOH termini. In addition, the Ov/Br septin {alpha} protein has an NH2 terminal extension of 136 amino acids relative to the other human septins. When the clustal alignment is extended with an additional 13 sequences from yeast, Drosophila, rat, and mouse (not shown), it is clear that there is no other septin currently in the databank with such a large NH2 terminus. Databank searches with only this region of Ov/Br septin {alpha} has yet to reveal notable or significant similarities with other proteins.



View larger version (87K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. CLUSTAL X alignment of Ov/Br septin with other human septins. Ov/Br septin demonstrates high homology with the other septins over their central portion; the NH2 and COOH termini are more variable. *, predicted Meti of Ov/Br septin ß; dashes, conserved residues of the GTP binding motifs. Dark shading, identical residues; light shading, conserved residues. Accession numbers: C10H_HUMAN, Q16181; NED5_HUMAN, Q15019; BH5_HUMAN, O43236; SEP2_HUMAN, Q14141; hCDCrel-1, O15251; KIAA0202, Q92599.

 
In dividing yeast cells, the septins localize to a ring of 10-nm filaments at the bud neck, where their role appears to be to localize membrane proteins such as Bud3p and Bud4p to the site at which budding will occur (15) . Other evidence suggests that a major role of the septins is to act as a scaffold or template for recruitment of other proteins that must assemble at specific sites within the cell. In budding yeast, the septins are required for the mitosis-specific regulation of the Nim 1-related kinase, Gin4, which functions in a pathway initiated by the Clb2 cyclin (16) . A link between the organization of the peripheral cytoskeleton and cell cycle progression has been demonstrated recently, when it was shown that the function of the Nim 1-related kinase, Hsl-1, was dependent on proper septin function and that Hsl-1 colocalized and coprecipitated with the septins in yeast (17) . Hsl1 induces entry into mitosis by negatively regulating the Wee1-related kinase, Swe 1.

The availability of a coiled-coil domain at the COOH terminus would suggest that individual septins can participate in protein-protein interactions and as such can organize into filamentous structures within cells. In Drosophila, a purified septin complex was shown to be composed of three previously identified septin polypeptides Pnut, Sep2, and Sep1. This complex was shown to be a heterotrimer of homodimers and copurified with 1 molecule of bound guanine nucleotide per septin polypeptide. The complex also bound and hydrolyzed exogenously added GTP. It therefore appears that GTP binding and hydrolysis regulate the interaction of septins with each other and/or with other proteins (18) .

Recently, a novel mammalian septin, eseptin, has been described that is alternatively spliced and expressed in a variety of tissues (19) . Eseptin is the rat orthologue of the septin that we describe in this report. The long and short splice variants of eseptin both had GTP binding sites and were distributed to the plasma membrane; however, the short form also had a more tubular and vesicular, perinuclear distribution. Mutants in the GTP binding site of the short form of the protein were confined principally to the perinuclear region, whereas similar mutants in the long form did not show an altered localization pattern. This may indicate that the two variants have different functions within the cell. A further difference between the two splice variants is the NH2 terminal extension of the long form. As with the septin that we describe, the longer protein includes the entire coding region of the short form, and it may be that the additional sequence at the NH2 terminus specifies different binding properties for this molecule.

The sequences of seven human septins have now been determined and a wide variety of functions attributed to these molecules. It could be hypothesized that the relative amounts of individual septins available to assemble into filaments would dramatically effect the overall substrate specificity of the complex and its cellular function. Studies with eseptin have shown that the relative amounts of splice variants varies between different tissues, and this may therefore represent a level of control of septin function (18) . Further studies with antibodies generated to this new human septin on chromosome 17q25 are required to investigate the relative amounts and localization of the protein in normal and malignant ovarian epithelium.

During the preparation of this manuscript, a t(11;17) (q23;q25) was described in a patient with acute lymphocytic leukemia that involved the MLL gene on chromosome 11 (9) . The fusion partner gene was cloned, and a cDNA of 2.8 kb was isolated that was found to be a new member of the septin family. The gene, named MSF, had a major transcript of 4 kb that was expressed ubiquitously and a 1.7-kb transcript that was also present in most tissues. A 3-kb transcript was detected in hematopoietic tissues. The 2.8-kb cDNA sequence of MSF is similar to the splice variant {alpha} that we have described but is 37 bp shorter at the 5' end, i.e., at the start of exon 1 and has a 1639-bp deletion in the 3' untranslated region. In addition, there has now been an additional report of one patient with de novo AML and one patient with therapy-related AML, both with a t(11;17)(q23;q25), in which the fusion partner of the MLL gene is the chromosome 17q25 septin (10) . The 17q25 septin gene therefore becomes one of a number of partner genes for MLL to be cloned from leukemic cells that have reciprocal translocations involving 11q23. However, it is not yet known if it is the MLL gene, the partner gene, or the fusion product that is important in leukemogenesis.

In conclusion, we have identified a gene that is a member of a family with a major role in cytokinesis and control of the cell cycle. We have mapped this gene to a region that is commonly deleted in benign, borderline, and malignant sporadic ovarian tumors of all histological subtypes. In three of seven tumors with confined deletions on distal chromosome 17q25, we have identified a number of germ-line base changes, one of which results in a significant amino acid change of arginine to cysteine. Whether this or any of the other base changes have a major functional effect on the Ov/Br septin still has to be determined.


    Note Added in Proof
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 
Genomic and expression analyses of this 17q25 septin gene, MSF, and three alternatively spliced transcripts were recently published (Kalikin et al., 2000). The MSF transcripts, including two novel transcripts (MSF-A and MSF-B), were found to share nine coding exons. The intron/exon boundaries of these transcripts were described and six polymorphic variants were identified. Note: MSF-A in that manuscript is called "Ov/Br septin {alpha} transcript" and MSF-C in that manuscript is called "OV/Br septin ß transcript" in our manuscript. Kalikin, L. M., Sims, H. L., and Petty, E. M. Genomic and expression analysis of alternatively spliced transcripts of the MLL, septin-fusion gene (MSF) that maps to a 17q25 region of loss in breast and ovarian tumors. Genomics, 63: 165–172, 2000.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work is supported by grants from the Cancer Research Campaign, WellBeing, The Medical Research Council, The Ulster Cancer Foundation, NIH-NCI KO8 CA66613, RO1 CA72877, and F32 CA71166-03. Back

2 To whom requests for reprints should be addressed, at Department of Oncology, The Queen’s University of Belfast, Belfast City Hospital, Belfast BT9 7AB, United Kingdom. Phone: 44-28-9032-9241, extension 2221; Fax: 44-28-9026-3744: E-mail: seh.russell{at}qub.ac.uk Back

3 The abbreviations used are; LOH, loss of heterozygosity; FISH, fluorescence in situ hybridization; Ov/Br, ovarian/breast; BAC, bacterial artificial chromosome; AML, acute myeloid leukemia. Back

4 Details of primers for PCR are available from http://bioinformatics.weizmann.ac.il/udb. Back

Received 1/20/00. Accepted 8/ 1/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 Note Added in Proof
 REFERENCES
 

  1. Russell S. E. H., Hickey L., Lowry W. S., Atkinson R. J. Allele loss from chromosome 17 in ovarian cancer. Oncogene, 5: 1581-1583, 1990.[Medline]
  2. Eccles D. M., Cranston G., Steel C. M., Nakamura Y., Leonard R. C. F. Allele losses on chromosome 17 in human epithelial ovarian carcinoma. Oncogene, 5: 1599-1601, 1990.[Medline]
  3. Eccles, D. M., Russell, S. E. H., Haites, N., Atkinson, R, Bell, D. W., Gruber, L., Hickey, I, Kelly, K., Kitchener, H., Leonard, R., et al. Early loss of heterozygosity on 17q in ovarian cancer. The Abe Ovarian Cancer Genetics Group. Oncogene, 7: 2069–2072, 1992.
  4. Foulkes W. D., Black D. M., Stamp G. W. H., Solomon E., Trowsdale J. Very frequent loss of heterozygosity throughout chromosome 17 in sporadic ovarian carcinoma. Int. J. Cancer, 54: 220-225, 1993.[Medline]
  5. Jacobs L. J., Smith S. A., Wiseman R. W., Futreal P. A., Harrington T., Osborne R. J., Leech V., Molyneux A., Berchuk A., Ponder B. A. J., Bast R. C., Jr. A deletion unit on chromosome 17q in epithelial ovarian tumors distal to the familial breast ovarian cancer locus. Cancer Res., 53: 1218-1221, 1993.[Abstract/Free Full Text]
  6. Godwin A. K., Vanderveer L., Schultz D. C., Lynch H. T., Altomare D. A., Buetow K. H., Daly M., Getts L. A., Masny A., Rosenblum N., Hogan M., Ozols R. F., Hamilton T. C. A common region of deletion on chromosome 17q in both sporadic and familial epithelial ovarian tumors distal to BRCA1. Am. J. Hum. Genet., 55: 666-677, 1994.[Medline]
  7. Kalikin L. M., Qu X., Frank T. S., Caduff R. F., Svoboda S. M., Law D. J., Petty E. M. Detailed deletion analysis of sporadic breast tumors defines an interstitial region of allelic loss on 17q25. Genes Chromosomes Cancer, 17: 64-68, 1996.[Medline]
  8. Kalikin L. M., Frank T. S., Svoboda-Newman S. M., Wetzel J. C., Cooney K. A., Petty E. M. A region of interstitial 17q25 allelic loss in ovarian tumors coincides with a defined region of loss in breast tumors. Oncogene, 14: 1991-1994, 1997.[Medline]
  9. Osaka M., Rowley J. D., Zeleznik-Le N. J. MSF (MLL septin-like fusion), a fusion partner gene of MLL, in a therapy related acute myeloid leukemia with a t(11;17)(q23;q25). Proc. Natl. Acad. Sci. USA, 96: 6428-6433, 1999.[Abstract/Free Full Text]
  10. Taki T., Ohnishi H., Shinohara K., Sako M., Bessho F., Yanagisawa M., Hayashi Y. AF17q25, a putative septin family gene, fuses the MLL gene in acute myeloid leukemia with t(11;17)(q23;q25). Cancer Res., 59: 4261-4265, 1999.[Abstract/Free Full Text]
  11. Longtine M. S., DeMarini D. J., Valencik M. L., Al-Awar O. S., Fares H., De Virgilio C., Pringle J. R. The septins: roles in cytokinesis and other processes. Curr. Opin. Cell Biol., 8: 106-119, 1996.[Medline]
  12. Dib C., Faure S., Fizames C., Samson D., Drouot N., Vignal A., Millasseau P., Marc S., Hazan J., Seboun E., Lathrop M., Gyapay G., Morrissette J., Weissenbach J. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature (Lond.), 380: 152-154, 1996.[Medline]
  13. Kalikin L. M., George R. A. V., Keller M. P., Bort S., Bowler N. S., Law D. J., Chance P. F., Petty E. M. An integrated physical and gene map of human distal chromosome 17q24-proximal 17q25 encompassing multiple disease loci. Genomics, 57: 36-42, 1999.[Medline]
  14. Pieretti M., Cavalieri C., Conway P. S., Gallion H., Powell D. E., Turker M. Genetic alterations distinguish different types of ovarian tumors. Int. J. Cancer, 64: 434-440, 1995.[Medline]
  15. Chant J. Septin scaffolds and cleavage planes in Saccharomyces. Cell, 84: 187-190, 1996.[Medline]
  16. Carroll C. W., Altman R., Schieltz D., Yeates J. R. , III, and Kellogg, D. The septins are required for the mitosis specific activation of the Gin4 kinase. J. Cell Biol., 143: 709-717, 1998.[Abstract/Free Full Text]
  17. Barral Y., Parra M., Bidlingmaier S., Snyder M. Nim1-related kinases coordinate cell cycle progression with the organization of the peripheral cytoskeleton in yeast. Genes Dev., 13: 176-187, 1999.[Abstract/Free Full Text]
  18. Field, C. M., al-Owar, O., Rosenblatt, J., Wong, M. L., Alberts, B., and Mitchison, T. J. A purified Drosophila septin complex forms filaments and exhibits GTPase activity. J. Cell Biol., 133: 605–616, 1996.
  19. Fung E. T., Scheller R. H. Identification of a novel alternatively spliced septin. FEBS Lett., 451: 203-208, 1999.[Medline]



This article has been cited by other articles:


Home page
Am. J. Pathol.Home page
Y.-H. Lin, Y.-M. Lin, Y.-Y. Wang, I-S. Yu, Y.-W. Lin, Y.-H. Wang, C.-M. Wu, H.-A. Pan, S.-C. Chao, P. H. Yen, et al.
The Expression Level of Septin12 Is Critical for Spermiogenesis
Am. J. Pathol., May 1, 2009; 174(5): 1857 - 1868.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. E. Gonzalez, E. A. Peterson, L. M. Privette, J. L. Loffreda-Wren, L. M. Kalikin, and E. M. Petty
High SEPT9_v1 Expression in Human Breast Cancer Cells Is Associated with Oncogenic Phenotypes
Cancer Res., September 15, 2007; 67(18): 8554 - 8564.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. S. McDade, P. A. Hall, and S.E. H. Russell
Translational control of SEPT9 isoforms is perturbed in disease
Hum. Mol. Genet., April 1, 2007; 16(7): 742 - 752.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
G. Xinarianos, F. E. McRonald, J. M. Risk, N. L. Bowers, G. Nikolaidis, J. K. Field, and T. Liloglou
Frequent genetic and epigenetic abnormalities contribute to the deregulation of cytoglobin in non-small cell lung cancer
Hum. Mol. Genet., July 1, 2006; 15(13): 2038 - 2044.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
R. Ono, M. Ihara, H. Nakajima, K. Ozaki, Y. Kataoka-Fujiwara, T. Taki, K.-i. Nagata, M. Inagaki, N. Yoshida, T. Kitamura, et al.
Disruption of Sept6, a Fusion Partner Gene of MLL, Does Not Affect Ontogeny, Leukemogenesis Induced by MLL-SEPT6, or Phenotype Induced by the Loss of Sept4
Mol. Cell. Biol., December 15, 2005; 25(24): 10965 - 10978.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Pathol.Home page
W W J de Leng, J J Keller, S Luiten, A R Musler, M Jansen, A F Baas, F W M de Rooij, J J P Gille, F H Menko, G J A Offerhaus, et al.
STRAD in Peutz-Jeghers syndrome and sporadic cancers
J. Clin. Pathol., October 1, 2005; 58(10): 1091 - 1095.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Nagata, T. Asano, Y. Nozawa, and M. Inagaki
Biochemical and Cell Biological Analyses of a Mammalian Septin Complex, Sept7/9b/11
J. Biol. Chem., December 31, 2004; 279(53): 55895 - 55904.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Zucchi, E. Mento, V. A. Kuznetsov, M. Scotti, V. Valsecchi, B. Simionati, E. Vicinanza, G. Valle, S. Pilotti, R. Reinbold, et al.
Gene expression profiles of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a nodal metastasis
PNAS, December 28, 2004; 101(52): 18147 - 18152.
[Abstract] [Full Text] [PDF]


Home page
Exp. Biol. Med.Home page
C. Martinez and J. Ware
Mammalian Septin Function in Hemostasis and Beyond
Experimental Biology and Medicine, December 1, 2004; 229(11): 1111 - 1119.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-i. Nagata, A. Kawajiri, S. Matsui, M. Takagishi, T. Shiromizu, N. Saitoh, I. Izawa, T. Kiyono, T. J. Itoh, H. Hotani, et al.
Filament Formation of MSF-A, a Mammalian Septin, in Human Mammary Epithelial Cells Depends on Interactions with Microtubules
J. Biol. Chem., May 9, 2003; 278(20): 18538 - 18543.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Montagna, M.-S. Lyu, K. Hunter, L. Lukes, W. Lowther, T. Reppert, B. Hissong, Z. Weaver, and T. Ried
The Septin 9 (MSF) Gene Is Amplified and Overexpressed in Mouse Mammary Gland Adenocarcinomas and Human Breast Cancer Cell Lines
Cancer Res., May 1, 2003; 63(9): 2179 - 2187.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. C. Surka, C. W. Tsang, and W. S. Trimble
The Mammalian Septin MSF Localizes with Microtubules and Is Required for Completion of Cytokinesis
Mol. Biol. Cell, October 1, 2002; 13(10): 3532 - 3545.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X.-R. Peng, Z. Jia, Y. Zhang, J. Ware, and W. S. Trimble
The Septin CDCrel-1 Is Dispensable for Normal Development and Neurotransmitter Release
Mol. Cell. Biol., January 1, 2002; 22(1): 378 - 387.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Russell, S. E. H.
Right arrow Articles by Johnston, P. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Russell, S. E. H.
Right arrow Articles by Johnston, P. G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online