| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Department of Oncology [S. E. H. R., M. M., J. F. B., P. G. D., S. C., S. W. C., S. M., D. P. H., G. W. K., A. N. C., P. G. J.], School of Biology and Biochemistry [I. H.], The Queen’s University of Belfast, Belfast BT9 7AB, United Kingdom; Department of Internal Medicine, University of Michigan, Michigan 48109-0638 [E. M. P., L. M. K.]; and Genethon 1, 91002 Evry Cedex, France [J. W.]
 |
ABSTRACT |
|---|
 Top ABSTRACT IntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
200 kb)
was constructed and used to determine the precise position and order of
the microsatellites. The contig was shown to hybridize to 17q25 by
fluorescence in situ hybridization analysis. The DNA
sequence of the entire contig was determined and analyzed by BLAST
searches. A 4-kb cDNA was subsequently identified with homology to the
yeast, Drosophila and mammalian septin family of genes. We have
designated this gene Ovarian/Breast (Ov/Br) septin. Two
splice variants were demonstrated within the 200-kb contig, which
differ only at exon 1. Within the contig, 45% of the septin
transcript was identified and 38% of the septin
ß transcript. The septins are a family of
genes involved in cytokinesis and cell cycle control. Their known
functions are consistent with the hypothesis that the human 17q25
septin gene is a candidate for the ovarian tumor
suppressor gene. |
Introduction |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
|
Materials and Methods |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
-32P]dCTP by random hexamer priming and
hybridized overnight at 65°C. Filters were washed to 2x SSC at
42°C and autoradiographed at -70°C for 2–7 days. For PCR analysis
of microsatellite markers, the forward primer was end-labeled with
[
-32P]ATP and T4 polynucleotide
kinase.4
Primer sequences for the microsatellite marker afm203wc5 were provided
by Genethon. PCR was carried out in a final volume of 15 µl
containing 100 ng of target DNA, 250 nM primers,
2.5 mM MgCl2, 200
µM deoxynucleotide triphosphates, 1x Taq
buffer, and 0.35 unit of Taq polymerase. The reaction conditions were
95°C for 5 min and then 30 cycles of 95°C for 30 s, 55°C for
1 min, and 72°C for 1 min with a final extension step of 72°C for 5
min. Two µl of the PCR product were electrophoresed on a denaturing
polyacrylamide gel that was autoradiographed at -70°C for 8–24 h.
LOH was assessed by direct visual comparison of the relative allelic
ratios present in matched normal and tumor DNAs. To ensure that allelic
intensities were within the linear range, multiple exposures of each
autoradiograph were carried out. Autoradiographs were scored
independently by at least two authors. A representative autoradiograph
is shown in Fig. 1A
. LOH was scored if one allele was absent or exhibited
altered signal intensity in tumor DNA relative to the allelic ratio of
normal DNA. We have conventionally referred to this alteration of
allelic signal within a tumor sample as LOH. However, with this
analysis it is not possible to distinguish between allele losses and
gains, and such allelic imbalance could also represent amplification of
a mutant allele.
|
Restriction Mapping.
P1 and BAC DNAs were restricted with NotI, SalI,
and NotI/SalI. The digest was fractionated on a
1% agarose gel by pulsed field gel electrophoresis using the CHEF
Mapper System (Bio-Rad). The gel was blotted onto Hybond N+ (Amersham
Pharmacia) and probed with P1 and BAC insert end probes. Briefly,
riboprobes were generated from the SP6 and T7 promoters of the P1 and
BAC vectors using the riboprobe in vitro Transcription
System (Promega).
FISH Analysis.
FISH was carried out on normal human lymphocytes metaphase spreads.
Biotinylated probes were prepared by nick translation of BAC DNA with
biotin-16-dUTP (Boehringer) and DNA polymerase I and DNase I (Life
Technologies, Inc.). Slides were hybridized for 72 h and washed to
0.2x SSC (pH 7.0) at 42°C. Detection of bound probe was carried out
with avidin/Texas Red, and one round of amplification of signal was
performed.
Northern Blot Analysis.
A 387-bp PCR product was amplified from HeLa cDNA by primers ABO 01
(5'-CGG AGA TCA CCA TCG TCA AAC C-3') and ABO 02 (5'-ACG TAG CCG AAG
TCC ACC GG-3') corresponding to nucleotides 1207–1594 of Ov/Br
septin . This probe is common to both and ß
transcripts because it is derived from exon 2 and the start of exon 3.
The DNA was labeled with [-32P]dCTP
(Amersham Pharmacia) by the Megaprime DNA Labeling System (Amersham
Pharmacia). Human multiple tissue Northern blots were obtained from
Clontech, and hybridization was carried out according to the
manufacturer’s instructions.
Mutation Analysis.
Total RNA was purified from snap-frozen tumor samples using RNA Stat60
(Biogenesis) according to the manufacturer’s instructions. RNA (5
µg) was reverse transcribed using Moloney Murine Leukemia Virus
reverse transcriptase (Life Technologies, Inc.) and random hexamer
primer. cDNA (1 µl) was amplified by PCR in a volume of 50 µl. The
final concentration of reagents in the reaction was 20 mM
Tris-HCl (pH 8.4), 1.5 mM MgCl2, 50
mM KCl, 200 nM each primer, 200
µM each deoxynucleotide triphosphate, 2 units of Taq DNA
polymerase (Life Technologies, Inc.). Cycling conditions of 94°C for
2 min and then 35 cycles of 94°C, 30 s; 58°C, 30 s; and
72°C, 60 s were used. The following primer sets were used to
amplify overlapping fragments of the Ov/Br and
ß septin open reading frames: primers ABO13F,
TGAGAAAGGGGAGGCCGCCTCTG (708–730) and ABO10R, ACCTTGGAGGCAGGGGGCTC
(1236–1217); primers ABO01F, CGGAGATCACCATCGTCAAACC (1170–1191) and
ABO04R, GGTTGATGTTGACCTCCTCCTG (1916–1895); primers ABO05F,
CGAGAACTGCTGGCAGCCCATC (1874–1895) and ABO08R,
GAAATGACTTGGGGGCAGGAT (2526–2500). The numbers in parentheses
refer to the positions of each primer with reference to the septin
sequence, accession number AF123052. PCR products were purified with
the Wizard PCR Preps DNA Purification System (Promega) and sequenced
with ABI Prism BigDye Terminator Cycle Sequencing chemistry. Sequence
data were compared with the above septin sequence (AF123052).
|
Results |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
. The highest rates of LOH were
detected between the markers D17S785 and D17S75
at distal 17q. The extent of LOH from chromosome 17 was determined for
tumors that were informative at a minimum of eight loci (50 of the 70
tumors examined). Tumors were classified as having extensive loss
(i.e., loss of the whole chromosome or at least the q arm)
or partial deletion. These results are summarized in Table 1
. Within the tumor bank, 31 malignant tumors were informative for at
least eight loci. No LOH was observed in 3 whereas 20 showed extensive
LOH consistent with whole chromosome loss. One malignant tumor had
partial LOH from the short arm, whereas 7 tumors demonstrated partial
LOH from the long arm. In 2 cases, this LOH was across a large area of
proximal 17q and included the region of the BRCA1 gene. In
the remaining 5, the LOH was from distal 17q. Within the group of 16
benign tumors examined, 12 had no detectable LOH, 1 had whole
chromosome loss, 1 had LOH from the short arm only, and 2 had LOH from
distal 17q. Of the three borderline tumors, 1 had no detectable LOH, 1
had LOH from the short arm, and 1 had LOH from distal 17q. Screening
the original 70 tumors and a further additional 30 tumors with a series
of markers that map to 17q25, identified a group of 10 tumors with
confined deletions at 17q25 (Fig. 1C)
. Analysis of these
tumors with partial deletions has refined the region of interest to a
position within 4 polymorphic microsatellites with zero recombination
at map position 106.9 cM. This is also the region to which the VNTR
probe, THH59, used in the original LOH study has been mapped
(12)
.
|
. The BAC was used as a probe in FISH experiments and
hybridized to distal 17q (Fig. 2C)
.
|
27 kb between exons 1 and 2 and the predicted coding sequence begins
at position 733 bp within exon 2. The coding sequence is 1266 bp in
length and codes for a protein of 422 amino acids and predicted
molecular weight of Mr 47,500.
We have also identified a splice variant of this transcript (which we
have named the transcript) that differs at the 5' end because of an
alternative exon 1. The alternative first exon is located 57 kb
upstream from exon 1ß and is 833 bases in length. The coding sequence
is 1704 bp in length and begins at position 813 bp of exon 1. It codes
for a protein of 568 amino acids and predicted molecular weight of
Mr 63,600. The available genomic
structure is summarized in Fig. 2B
. A PCR product generated
from exon 2 and the beginning of exon 3 and thus common to both the
and ß transcripts was used as a probe in Northern blot experiments
against a variety of normal tissue RNAs (Fig. 2D)
. A 4-kb
and 4.3-kb transcript were evident in 10 tissues (spleen, thymus,
prostate, testis, ovary, small intestine, colon, peripheral blood
lymphocyte, heart, and pancreas), and there was variation in
their relative amounts. In the remaining tissues, only the 4.3-kb
transcript was detected.
Mutation Analysis.
A preliminary mutation analysis was carried out by direct sequencing of
cDNA from tumor samples with partial deletions in distal chromosome
17q. cDNA was available for 7 of the 10 tumors shown in Fig. 1C
(samples 1–3, 5, 6, 8, and 10). Primer sets were used to
amplify six overlapping fragments of the Ov/Br and
ß septin open reading frames for direct
sequencing. Base changes were observed in three of seven samples: in
sample 1, a GTG to ATG (Val/Met) at position 2484 bp; in sample 6, a
CCC to CCG (Pro/Pro) at position 890 bp, a CGC to TGC (Arg/Cys) at
position 984 bp, a CCG to CTG (Pro/Leu) at position 1192 bp; and in
sample 10, a CCG to CCA (Pro/Pro) at position 2510 bp. All base changes
were also identified in matched control samples. With the exception of
the base change at position 984 bp in sample 6, the other changes
result in conservative or semiconservative amino acid changes. However,
the C
T change at position 984 bp in sample 6 only alters the coding
sequence of the transcript and represents a dramatic change from a
charged amino acid (Arg) to a polar amino acid with a sulfydryl side
chain (Cys).
|
Discussion |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
Since our initial report in 1990 of high rates of LOH from 17q, there have been other reports of LOH from this chromosome in these tumors. Whole chromosome loss was demonstrated in the majority of malignant tumors (4) . In our analysis of 70 tumors with 19 markers and considering only tumors that were informative at more than eight loci, a similar pattern of LOH has emerged. In frankly malignant disease, the pattern of loss in 65% of tumors was consistent with loss of one copy of chromosome 17. In 5 of the remaining malignant tumors, a partial loss involving distal 17q was detected. These results would therefore indicate a crucial role in ovarian malignancy for a gene on distal 17q that is often accompanied by allelic imbalance at all chromosome 17 loci.
There has been the suggestion that benign, borderline, and malignant ovarian tumors and also the various histological subtypes may each follow a different molecular pathway (14) . Our findings of partial deletions in benign, borderline, and malignant disease and in serous, endometrioid, and mucinous tumors would indicate that this putative tumor suppressor gene is common to all of these pathways and may be an early event.
Previous reports in the literature describing partial deletions from 17q in sporadic ovarian tumors have delineated regions that are proximal to that described in our study. One study described a 16-cM common region of deletion delineated by nm23 and GH (5) , whereas another identified a 25-cM region delineated by GH and D17S4 (6) . In both studies only a limited number of markers in the 17q23–25 region were used, the most distal being D17S4 and D17S75, respectively. Also, a close examination of the individual cases in both studies reveals that the majority of deletions are in fact quite large, and in only 4 of 14 cases was the distal boundary of the deletion identified. The small region of deletion that we describe falls within the larger deleted regions of 11 of 14 tumors documented in the previous studies.
In addition, this study extends more recent data from an analysis of 39
breast tumors (7)
and 32 ovarian tumors (8)
in which an overlapping region of interstitial loss of 3 cM around
D17S937 was identified. The common region of deletion that
we describe is defined by four microsatellite markers D17S1790,
D17S937, D17S939, and afm203wc5, which lie within an
area of zero recombination at map position 106.9 cM.
We also demonstrate that this region covers 200 kb of genomic DNA
and contains part of the coding sequence of two splice variants of a
human septin gene. It is also now apparent that at least
three of the four microsatellite markers used originally to define the
minimal region of deletion (D17S937, D17S939, and afm
203wc5) fall within the genomic sequence of the
septin gene, thus confirming that LOH is actually observed
at this locus. In keeping with observations from other septins, this
protein has a P-loop nucleotide binding domain. A CLUSTAL alignment of
seven human septins is shown in Fig. 3
. It demonstrates the conserved central core of the septin proteins and
highlights the variability at the NH2 and COOH
termini. In addition, the Ov/Br septin protein has an
NH2 terminal extension of 136 amino acids
relative to the other human septins. When the clustal alignment is
extended with an additional 13 sequences from yeast, Drosophila, rat,
and mouse (not shown), it is clear that there is no other septin
currently in the databank with such a large NH2
terminus. Databank searches with only this region of Ov/Br septin
has yet to reveal notable or significant similarities with other
proteins.
|
The availability of a coiled-coil domain at the COOH terminus would suggest that individual septins can participate in protein-protein interactions and as such can organize into filamentous structures within cells. In Drosophila, a purified septin complex was shown to be composed of three previously identified septin polypeptides Pnut, Sep2, and Sep1. This complex was shown to be a heterotrimer of homodimers and copurified with 1 molecule of bound guanine nucleotide per septin polypeptide. The complex also bound and hydrolyzed exogenously added GTP. It therefore appears that GTP binding and hydrolysis regulate the interaction of septins with each other and/or with other proteins (18) .
Recently, a novel mammalian septin, eseptin, has been described that is alternatively spliced and expressed in a variety of tissues (19) . Eseptin is the rat orthologue of the septin that we describe in this report. The long and short splice variants of eseptin both had GTP binding sites and were distributed to the plasma membrane; however, the short form also had a more tubular and vesicular, perinuclear distribution. Mutants in the GTP binding site of the short form of the protein were confined principally to the perinuclear region, whereas similar mutants in the long form did not show an altered localization pattern. This may indicate that the two variants have different functions within the cell. A further difference between the two splice variants is the NH2 terminal extension of the long form. As with the septin that we describe, the longer protein includes the entire coding region of the short form, and it may be that the additional sequence at the NH2 terminus specifies different binding properties for this molecule.
The sequences of seven human septins have now been determined and a wide variety of functions attributed to these molecules. It could be hypothesized that the relative amounts of individual septins available to assemble into filaments would dramatically effect the overall substrate specificity of the complex and its cellular function. Studies with eseptin have shown that the relative amounts of splice variants varies between different tissues, and this may therefore represent a level of control of septin function (18) . Further studies with antibodies generated to this new human septin on chromosome 17q25 are required to investigate the relative amounts and localization of the protein in normal and malignant ovarian epithelium.
During the preparation of this manuscript, a t(11;17) (q23;q25) was
described in a patient with acute lymphocytic leukemia that involved
the MLL gene on chromosome 11 (9)
. The fusion
partner gene was cloned, and a cDNA of 2.8 kb was isolated that was
found to be a new member of the septin family. The gene, named
MSF, had a major transcript of 4 kb that was expressed
ubiquitously and a 1.7-kb transcript that was also present in most
tissues. A 3-kb transcript was detected in hematopoietic tissues. The
2.8-kb cDNA sequence of MSF is similar to the splice variant that
we have described but is 37 bp shorter at the 5' end, i.e.,
at the start of exon 1 and has a 1639-bp deletion in the 3'
untranslated region. In addition, there has now been an additional
report of one patient with de novo AML and one patient with
therapy-related AML, both with a t(11;17)(q23;q25), in which the fusion
partner of the MLL gene is the chromosome 17q25 septin
(10)
. The 17q25 septin gene therefore becomes one of a
number of partner genes for MLL to be cloned from leukemic cells that
have reciprocal translocations involving 11q23. However, it is not yet
known if it is the MLL gene, the partner gene, or the fusion
product that is important in leukemogenesis.
In conclusion, we have identified a gene that is a member of a family with a major role in cytokinesis and control of the cell cycle. We have mapped this gene to a region that is commonly deleted in benign, borderline, and malignant sporadic ovarian tumors of all histological subtypes. In three of seven tumors with confined deletions on distal chromosome 17q25, we have identified a number of germ-line base changes, one of which results in a significant amino acid change of arginine to cysteine. Whether this or any of the other base changes have a major functional effect on the Ov/Br septin still has to be determined.
|
Note Added in Proof |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
transcript" and MSF-C
in that manuscript is called "OV/Br septin ß transcript" in our
manuscript. Kalikin, L. M., Sims, H. L., and Petty, E. M. Genomic and expression analysis of alternatively spliced transcripts
of the MLL, septin-fusion gene (MSF) that maps to a 17q25 region
of loss in breast and ovarian tumors. Genomics, 63:
165–172, 2000.
|
FOOTNOTES |
|---|
1 This work is supported by grants from the Cancer
Research Campaign, WellBeing, The Medical Research Council, The Ulster
Cancer Foundation, NIH-NCI KO8 CA66613, RO1 CA72877, and F32
CA71166-03. 
2 To whom requests for reprints should be
addressed, at Department of Oncology, The Queen’s University of
Belfast, Belfast City Hospital, Belfast BT9 7AB, United Kingdom. Phone:
44-28-9032-9241, extension 2221; Fax: 44-28-9026-3744: E-mail: seh.russell{at}qub.ac.uk
3 The abbreviations used are; LOH, loss of
heterozygosity; FISH, fluorescence in situ
hybridization; Ov/Br, ovarian/breast; BAC, bacterial artificial
chromosome; AML, acute myeloid leukemia.
4 Details of primers for PCR are available
from http://bioinformatics.weizmann.ac.il/udb.
Received 1/20/00. Accepted 8/ 1/00.
|
REFERENCES |
|---|
|
TopABSTRACTIntroductionMaterials and MethodsResultsDiscussionNote Added in ProofREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. E. Gonzalez, E. A. Peterson, L. M. Privette, J. L. Loffreda-Wren, L. M. Kalikin, and E. M. Petty High SEPT9_v1 Expression in Human Breast Cancer Cells Is Associated with Oncogenic Phenotypes Cancer Res., September 15, 2007; 67(18): 8554 - 8564. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. S. McDade, P. A. Hall, and S.E. H. Russell Translational control of SEPT9 isoforms is perturbed in disease Hum. Mol. Genet., April 1, 2007; 16(7): 742 - 752. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Xinarianos, F. E. McRonald, J. M. Risk, N. L. Bowers, G. Nikolaidis, J. K. Field, and T. Liloglou Frequent genetic and epigenetic abnormalities contribute to the deregulation of cytoglobin in non-small cell lung cancer Hum. Mol. Genet., July 1, 2006; 15(13): 2038 - 2044. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ono, M. Ihara, H. Nakajima, K. Ozaki, Y. Kataoka-Fujiwara, T. Taki, K.-i. Nagata, M. Inagaki, N. Yoshida, T. Kitamura, et al. Disruption of Sept6, a Fusion Partner Gene of MLL, Does Not Affect Ontogeny, Leukemogenesis Induced by MLL-SEPT6, or Phenotype Induced by the Loss of Sept4 Mol. Cell. Biol., December 15, 2005; 25(24): 10965 - 10978. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W W J de Leng, J J Keller, S Luiten, A R Musler, M Jansen, A F Baas, F W M de Rooij, J J P Gille, F H Menko, G J A Offerhaus, et al. STRAD in Peutz-Jeghers syndrome and sporadic cancers J. Clin. Pathol., October 1, 2005; 58(10): 1091 - 1095. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-i. Nagata, T. Asano, Y. Nozawa, and M. Inagaki Biochemical and Cell Biological Analyses of a Mammalian Septin Complex, Sept7/9b/11 J. Biol. Chem., December 31, 2004; 279(53): 55895 - 55904. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Zucchi, E. Mento, V. A. Kuznetsov, M. Scotti, V. Valsecchi, B. Simionati, E. Vicinanza, G. Valle, S. Pilotti, R. Reinbold, et al. Gene expression profiles of epithelial cells microscopically isolated from a breast-invasive ductal carcinoma and a nodal metastasis PNAS, December 28, 2004; 101(52): 18147 - 18152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Martinez and J. Ware Mammalian Septin Function in Hemostasis and Beyond Experimental Biology and Medicine, December 1, 2004; 229(11): 1111 - 1119. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-i. Nagata, A. Kawajiri, S. Matsui, M. Takagishi, T. Shiromizu, N. Saitoh, I. Izawa, T. Kiyono, T. J. Itoh, H. Hotani, et al. Filament Formation of MSF-A, a Mammalian Septin, in Human Mammary Epithelial Cells Depends on Interactions with Microtubules J. Biol. Chem., May 9, 2003; 278(20): 18538 - 18543. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Montagna, M.-S. Lyu, K. Hunter, L. Lukes, W. Lowther, T. Reppert, B. Hissong, Z. Weaver, and T. Ried The Septin 9 (MSF) Gene Is Amplified and Overexpressed in Mouse Mammary Gland Adenocarcinomas and Human Breast Cancer Cell Lines Cancer Res., May 1, 2003; 63(9): 2179 - 2187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Surka, C. W. Tsang, and W. S. Trimble The Mammalian Septin MSF Localizes with Microtubules and Is Required for Completion of Cytokinesis Mol. Biol. Cell, October 1, 2002; 13(10): 3532 - 3545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X.-R. Peng, Z. Jia, Y. Zhang, J. Ware, and W. S. Trimble The Septin CDCrel-1 Is Dispensable for Normal Development and Neurotransmitter Release Mol. Cell. Biol., January 1, 2002; 22(1): 378 - 387. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
