| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Cellular Genetics Unit, Université catholique de Louvain, B-1200 Brussels, Belgium [R. C., G. H., P. G. C.]; Ludwig Institute for Cancer Research, Brussels Branch, B-1200 Brussels, Belgium [V. S., T. B.]; and Département d’Ingénierie et d’Etudes des Protéines, CEA-Saclay, 91191 Gif-sur-Yvette, France [C. T., B. M.]
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
We have pursued our analysis of the antitumor T-cell response of melanoma patient LB33, because this patient enjoys a favorable evolution of her disease that is associated with a very strong and sustained antitumor CTL response (8) . Two tumor cell lines, MEL.A and MEL.B, were derived from metastases resected in 1988 and 1993, respectively. The patient developed a very strong CTL response against the MEL.A cells (9) . From blood lymphocytes collected in 1990, we derived a panel of anti-MEL.A CTL clones that recognize at least seven distinct antigens presented by various HLA class I molecules. Four of these antigens were shown to result from point mutations in genes with ubiquitous expression (10, 11, 12) . One of them, presented on HLA-A28 molecules, is recognized by >1% of the autologous blood CD8 T lymphocytes, as measured with complexes of soluble HLA-A28 molecules loaded with the antigenic peptide (12) . This is the highest frequency of truly tumor-specific CTLs that has been found in a cancer patient. These CTLs could be restimulated in vitro and lysed the autologous tumor cells. The MEL.B cells resist lysis by the anti-MEL.A CTLs because they have lost expression of HLA class I molecules, except HLA-A24, which did not present antigens to anti-MEL.A CTLs. This strongly suggests that MEL.B cells were selected in vivo by the strong anti-MEL.A CTL response.
Thus far, all of the antitumor CTLs that we have obtained by stimulating blood lymphocytes of patient LB33 with the MEL.A cells recognized antigens that are absolutely tumor specific. In addition, one of these CTLs is present in the blood in great number. This strong tumor-specific CTL response may very well have participated in the remarkably favorable clinical course of the patient since 1990, characterized by the appearance of single metastases that were treatable by surgery in 1993, 1994, and 1999. In view of this, it was interesting to analyze the involvement, if any, of HLA class II-restricted T lymphocytes in the anti-MEL.A immune response. We report here the identification on MEL.A cells of a tumor-specific shared antigen presented to autologous lytic T cells on HLA-DR11 molecules.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
HLA Class II Expression and Cloning of cDNA Encoding HLA-DR.
For the analysis of cell surface expression of HLA class II molecules,
tumor cells were incubated with monoclonal antibodies Leu-10
(anti-HLA-DQ), L243 (anti-HLA-DR), and B7/21 (anti-HLA-DP) from Becton
Dickinson for 30 min at 4°C in 134 mM NaCl, 5
mM KCl, 0.4 mM MgSO4, 0.3
mM MgCl2, 5 mM glucose, 4
mM NaHCO3, 1 mM EDTA, 500
units/ml penicillin, 1 µg/ml streptomycin, and 1% FCS and buffered
with phosphate (1 mM; pH 7.4). The cells were washed,
incubated further with FITC-conjugated antimouse immunoglobulin for 20
min at 4°C, fixed with 0.5% paraformaldehyde, and analyzed by flow
cytometry.
cDNA clones encoding the HLA-DRB1*1101 and DRB3*0202 chains of patient
LB33 were obtained as follows. RNA prepared from LB33-EBV-B cells was
converted to cDNA with Moloney murine leukemia virus reverse
transcriptase (Boehringer Mannheim) using an oligo-dT primer. The cDNA
was used as a template for a PCR amplification with primers PCX3DR
(5'-CGCGGATCCAGCATGGTGTGTCTG) and PCX4DR
(5'-GGAATTCCTCAGCTAGGAATCCTGTTG). The PCR product was
purified using the QIAquick PCR purification kit (Qiagen, Hilden,
Germany), digested with BamHI and EcoRI, and
ligated into expression vector pcDNA3 (Invitrogen). The constructs were
transfected by electroporation into Escherichia coli DH5
,
and plasmid DNA extracted from several independent colonies was
sequenced. The DRA*0101 cDNA clone was obtained from an MZ2-MEL cDNA
library cloned into pcDNA1/Amp. An Ii (invariant chain) RT-PCR product
obtained from RNA of LB23-EBV-B cells with oligonucleotides BG3
(5'-AGCGGATCCTGTCGGGAAGATCAGAAG) and BG4
(5'-CAAGAATTCAGGCTGGAGGGGAGAGGA) was blunted using the Klenow fragment
of DNA polymerase I (New England Biolabs, Beverly, MA), inserted into
the EcoRV site of pcDNAI/Amp, and completely sequenced.
T-Cell Clone.
Blood mononuclear cells collected from patient LB33 in 1990 were
isolated by Lymphoprep (Nycomed, Oslo, Norway) density-gradient
centrifugation and cryopreserved. They were stimulated three times at
weekly intervals by the addition of irradiated (100 Gy from a
137Cesium source) autologous melanoma cells
MEL.AQ, a clone isolated from a population of MEL.A-1.1 cells
transfected with HLA-DQ and DQß constructs, in the presence of
recombinant human IL-2 (20 units/ml) and recombinant human IL-4 (5
units/ml) in Iscove’s Dulbecco medium supplemented with AAG,
5 x 10-5 M
2-mercaptoethanol (AAGM) and 10% human serum (a pool of ABO serum from
healthy blood donors). On day 10, the lymphocytes were collected, and
CD4 T cells were sorted as follows. The lymphocytes were labeled with
antibodies recognizing B lymphocytes, natural killer cells, monocytes,
and CD8 T cells and coupled to magnetic microbeads (MACS
CD4+ T cell isolation kit; Miltenyi
Biotech, Bergisch Gladbach, Germany). The labeled cells were
retained by passage through a magnetic column. The unlabeled CD4 cells
were recovered and incubated in medium with IL-2 and IL-4. Derivation
and long-term culture of T-cell clones were carried out as
described previously (9)
.
Sensitivity of target cells to lysis was evaluated by a standard
51Cr-release assay over 4 h, with target
tumor cells incubated for 48 h with IFN-
(50 units/ml;
Boehringer Mannheim). GM-CSF production by clone 19 was measured
with a standard ELISA assay (Biosource, Fleurus, Belgium) and by
testing the capacity of the culture supernatant to stimulate the
proliferation of M-07e cells, which grow in the presence of any of
several growth factors, including GM-CSF, IL-3, IL-6, and IL-15
(14
, 15)
. Briefly, clone 19 (5000 cells/well) was
incubated in microwells (100 µl) with stimulator cells (3 x 104
cells/well) in medium containing IL-2
(25 units/ml). After 24 h, 50 µl of medium were collected and
added to M-07e cells (104
cells/microwell). After
24 h, [3H]thymidine was added, and
thymidine incorporation was measured after another 16 h. IFN-
and IL-4 production by clone 19 were measured in standard ELISA assays
(Biosource). The TNF secretion assay was performed as described
previously (9)
.
Peptides and Peptide Binding Assay.
Peptides were synthesized by conventional solid phase peptide
synthesis, using Fmoc for transient NH2-terminal
protection (16)
, and characterized by mass spectrometry.
They were solubilized at 10 mg/ml in DMSO, kept frozen at -20°C, and
diluted in Iscove’s medium immediately before use. Peptide recognition
assays were performed on LB33-EBV-B cells preincubated 2 h at
37°C in the presence of the different peptides in a M-07e
proliferation assay, as described above. HLA-DR molecules were
immunopurified from the EBV-transformed B cell line SWEIG as described
by Gorga et al. (17)
. A competitive binding
assay to DRB1*1101 molecules was performed in 10
mM phosphate, 150 mM NaCl,
1 mM DM, 10 mM citrate,
0.003% thimerosal, and 2 mM DTT (pH 5) buffer,
as described previously (18)
. Briefly, an appropriate
amount of HLA class II molecules was incubated for 24 h with 20
nM biotinylated HA 306–318 peptide
(PKYVKQNTLKLAT) and various concentrations of competitor peptides. The
DR-peptide complexes were transferred into microwells coated with the
anti-HLA-DR monoclonal antibody L243 and incubated for 2 h.
Unbound peptides were washed off the plates, and peptide-DR complexes
were revealed with streptavidine phosphatase (Amersham,
Buckinghamshire, United Kingdom) and 4-methylumbelliferyl phosphate as
substrate (Sigma Chemical Co., St. Louis, MO). Fluorescence was
measured at 450 nm upon excitation at 365 nm on a Fluorolite 1000
fluorimeter (Dynex, Issy les Moulineaux, France). The relative affinity
of each competitor peptide was evaluated by the concentration that
prevented 50% of binding of the biotinylated peptide
(IC50). Each experiment was validated with the
IC50 of nonbiotinylated HA 306–318 peptide,
which did not vary by more than a factor of three from one experiment
to another.
Construction and Screening of the cDNA Library.
Total RNA was extracted from MEL.A-1 cells by the
guanidine-isothiocyanate procedure. Poly(A)+ RNA enriched with an
oligo(dT)-cellulose column (Pharmacia Biotech, Uppsala, Sweden) was
converted to cDNA with the Superscript Choice System (Life
Technologies, Inc., Gaithersburg, MD) using an oligo(dT) primer
[5'-ATAAGAATGCGGCCGCTAAACTA(T)18VZ (V = G, A, or C;
Z = G, A, T, or C)] containing a NotI site
at its 5' end. The cDNA was ligated to
HindIII-EcoRI adaptors (Stratagene, Heidelberg,
Germany), phosphorylated, digested with NotI, and inserted
at the HindIII and NotI sites of expression
vector pCEP4 (Invitrogen). E. coli DH5 were transformed
by electroporation with the recombinant plasmid and selected with
ampicillin (50 µg/ml). The library was divided into 528 pools of
100 cDNA clones. Each pool was amplified for 4 h, and plasmid
DNA was extracted using the QIAprep 8 plasmid kit (Qiagen). Duplicate
microcultures of 293-EBNA cells, plated in flat-bottomed 96 microwells
(3.5 x 104
/well) 24 h before
transfection, were cotransfected with 1.5 µl of LipofectAMINE reagent
(Life Technologies), 100 ng of plasmid DNA of each pool of the cDNA
library, 12 ng of plasmid pcDNA3 containing the HLA-DRB1*1101 cDNA, 12
ng of plasmid pcDNA1/Amp containing an Ii cDNA, and 24 ng of plasmid
EBO-76pl containing a CIITA cDNA (19)
. After 24 h,
clone 19 (5000 cells/well) was added to each microculture in 100 µl
of Iscove’s medium supplemented with AAGM, 1% human plasma,
and IL-2 (25 units/ml). After another 24 h, 75 µl of supernatant
were collected, and cytokine production was measured with the M-07e
cells.
Sequences and Construction of Minigenes.
cDNA clone 279 contained the published EphA3 sequence (M83941). Four
nucleotide changes were found: two conservative substitutions (G
instead of A at position 2184 of clone 279; T instead of C at position
3027 of clone 279); a T
A modification at position 2956 of clone 279,
changing S into T in the translated protein; and a CT modification
at position 2995, changing R into W. In cDNA clone 60, the open reading
frame ended at nucleotide 1705. Nucleotide 1681 presumably corresponded
to the end of exon 7, as deduced from a comparison with the genomic
sequence of the chicken EphB2 receptor [GenBank M62325
(20)
], and the reading frame extended for another 23
nucleotides into a putative intronic sequence.
Minigenes were constructed as follows. We first cloned the signal sequence of EphA3; cDNA clone 279 was used as a template for a PCR amplification with primers OPC 894 (5'- CGCGGATCCCTTCTCCAGCAATCAGAGCGC) and OPC 895 (5'-CCGGAATTCTGAATCCAGTAGATTGACTTCATTGGA) in the following conditions: 5 min at 94°C, followed by 30 cycles consisting of 1 min at 94°C, 2 min at 64°C, and 3 min at 72°C. The PCR product was purified using QIAquick PCR purification kit (Qiagen), digested with BamHI and EcoRI, and ligated into pcDNA3 to obtain pcDNA3-EphA3-signal. Subsequently, fragments of cDNA clone 279, corresponding to truncated portions of the extracellular part of the receptor, were amplified by PCR using three different sense primers, OPC 899 (5'-CCGGAATTCAAAACAATTCAAGGGGAGCTGGG), OPC 941 (5'-CCGGAATTCTGTACCCGACCTCCATCTTCA), or OPC 896 (5'-CCGGAATTCTGTGAGCCATGCAGCCCAAATG) with the same antisense primer OPC 897 (5'-ATAGTTTAGCGGCCGCTCACTTATAGCCACAGAACCTCCCA), where TAG is a stop codon in frame with the main open reading frame. The three PCR products were cloned into the EcoRI and NotI sites of pcDNA3-EphA3-signal. The resulting constructs coded for putative membrane-bound EphA3 receptors truncated at their NH2 termini and differing from wild-type EphA3 by the insertion of two amino acids (E-F) after the first 10 residues of the mature protein.
PCR Assay for EphA3 Expression.
Total RNA extraction and reverse transcription of RNA were performed as
described previously (21)
. For the analysis of EphA3
expression in tumor and normal tissues samples, PCR primers were OPC
818 (5'-AGCAACATGGATTGTCAGCTCTC) and OPC 806
(5'-TGTTGGTGAGTCCAAACTGTCG), the position of which is shown in
Fig. 4.
PCR conditions were 5 min at 94°C, followed by 32 cycles consisting
of 1 min at 94°C, 2 min at 65°C, and 3 min at 72°C. We verified
that with these conditions, we were in the linear range of DNA
amplification. The quality of RNA preparations was tested by PCR
amplification of a human ß-actin sequence. The quantities of the
amplified DNA were visually assessed on agarose gels stained with
ethidium bromide. Band intensities were compared with that of PCR
products of serial dilutions (1:1, 1:3, 1:9, and 1:27) of reverse
transcribed RNA from MEL.A-1 cells. The level of expression of each
sample was normalized for RNA integrity by taking into account the
level of expression of the ß-actin gene.
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and labeled with monoclonal antibodies
specific for HLA-DP, DQ, or DR molecules (Fig. 1)
. In the absence of IFN-, 15% of the cells expressed HLA-DR but
not DP or DQ molecules. After incubation with IFN-, all of the cells
carried HLA-DP and DR molecules at levels comparable with that found on
autologous EBV-transformed B cells. HLA-DQ molecules were not detected
on the tumor cells.
|
-treated MEL.A-1 cells in the
presence of IL-2 and IL-4. On day 7, the lymphocytes were restimulated
with the tumor cells. CD4 cells were purified on day 10, restimulated
with tumor cells on day 14, and cloned by limiting dilution on day 21.
We obtained CD4 T-cell clone 19 that lysed MEL.A-1 cells but not the
autologous EBV-B cells (Fig. 2A)
. After stimulation by the tumor cells, clone 19 secreted
TNF, IL-4, IFN-, or GM-CSF (Fig. 2, B and C)
.
The antigen recognized by clone 19 was named LB33-Z.
|
. Patient LB33 was
typed HLA-DR11 by serology. The melanoma cells of another DR11 patient,
LB4, were also recognized by clone 19, indicating that antigen Z was
shared between at least some melanomas (Fig. 2B)
. The
HLA-DR11 serological typing corresponds to the presence of two HLA-DR
molecules, sharing a common chain and differing by their ß
chains, encoded by the DRB1 and DRB3 genes. Molecular typing indicated
that patient LB33 carried the DRB1*1101 and
DRB3*0202 alleles. To identify the HLA-DR molecule
presenting antigen Z, melanoma cells of a DR11-negative patient were
transfected with DRB1*1101 or DRB3*0202 cDNA clones. The cells were
recognized by clone 19 after transfection with the DRB1 construct but
not the DRB3 construct (Fig. 2C)
. We concluded that antigen
Z was presented by DR/DRB1*1101 molecules.
Presentation of Antigens on HLA Class II Molecules by 293 Cells
after Transfection with CIITA.
In previous efforts to identify genes coding for antigens presented by
class I molecules, we have cotransfected 293-EBNA cells with a cDNA
library from the tumor and a cDNA encoding the presenting HLA.
Considering that the protein containing the LB33-Z antigenic peptide
was naturally processed through the class II pathway in MEL.A-1, we
expected a recombinant protein to do the same in cells transfected with
the corresponding full-length cDNA. However, 293-EBNA cells express
neither of the genes coding for HLA-DR, DRß, the Ii invariant
chain, HLA-DMA, or -DMB, which are required for the processing of
antigens presented by class II molecules. The expression of these genes
is controlled by the class II transactivator CIITA, and it was shown
that class II-negative cells acquired the capacity to present antigens
on class II molecules after transfection with CIITA (19
, 22)
. We confirmed that 293-EBNA cells transfected with a CIITA
cDNA expressed the DR, DRß
(DRß1*1501) DMA, DMB, and
Ii genes and carried HLA-DR molecules on their surface.
These results suggested that 293-EBNA cells could be made to carry an
antigen presented by class II molecules upon cotransfection of cDNA
clones coding for the antigen, for CIITA, and for the appropriate DRß
chain. To verify this, we conducted a reconstruction experiment with a
defined antigen. We made use of CD4 T-cell clone 37, which recognizes a
MAGE-A3 peptide presented by HLA-DR13 molecules (23)
. It
had been shown that HLA-DR13 melanoma cells that did not express gene
MAGE-A3 were recognized by clone 37 after transfection with
a cDNA coding for an Ii-MAGE-A3 chimeric protein (23)
.
Therefore, we cotransfected 293-EBNA cells with various amounts of the
Ii-MAGE-A3 cDNA and with a constant amount of the CIITA and DRB1*1301
cDNA. After 24 h, the transfected cells were tested for the
expression of the MAGE-A3.DR13 antigen by adding clone 37 and measuring
the production of GM-CSF (Fig. 3)
. The CD4 clone recognized the transfectants. No recognition was
observed when CIITA was not cotransfected (data not shown).
Surprisingly, the additional cotransfection of a cDNA clone coding for
a full-length Ii dramatically improved the results (Fig. 3)
. When
293-EBNA cells were cotransfected with DR13, CIITA, and Ii, and with
100 ng of mixtures of pCEP4 and pCEP4 containing the Ii-MAGE-A3 cDNA, a
clear recognition of the transfectants by the CD4 clone could be
obtained with only 0.1 ng of pCEP4-Ii-MAGE-A3, corresponding to 1/1000
of the total amount of pCEP4. These results suggested that if this CD4
clone was used to screen 293-EBNA cells transfected with a cDNA library
from a MAGE-A3-positive tumor, the library could be divided in pools of
1000 cDNA clones.
|
100 clones. About
100 ng of DNA extracted from each pool were cotransfected with the
DRB1*1101, CIITA, and Ii cDNA into 293-EBNA. After 24 h, the
transfectants that expressed antigen LB33-Z were detected by their
capacity to stimulate the production of GM-CSF by clone 19. Two pools
of cDNA proved positive. They were subcloned, and cDNA clones 60 and
279 were isolated (Fig. 4A)
. Their sequences corresponded to that of the human
tyrosine kinase receptor HEK (GenBank M83941), a member of the Eph
family of receptors that was originally cloned from the human pre-B
cell leukemia cell line LK63 (24)
. This receptor was
recently renamed EphA3 by the Eph Nomenclature Committee
(25)
.
|
. cDNA 60 was 2546
bp long and contained a poly(A) tail, a polyadenylation signal, and an
open reading frame that was identical to that of cDNA 279 but ended
before the transmembrane region. It is likely to code for a secreted
form of the receptor, similar to those described for other
Eph gene products (20
, 26
, 27)
.
Identification of the Antigenic Peptide.
293-EBNA cells were cotransfected with CIITA, Ii, DRB1*1101, and with
constructs coding for membrane-bound truncated proteins corresponding
to the extracellular portion of EphA3. The transfectants were tested
for recognition by CD4 clone 19, and the results indicated that the
antigenic peptide was encoded between nucleotides 1064 and 1237 of cDNA
279 (Fig. 4B)
.
Two peptides in this region contain the HLA-DRB1*1101 binding motif,
i.e., W or Y or F at position 1, R/K/H at position 6, and
A/G/S/P at position 9 (28)
. One peptide of 16 amino acids,
DVTFNIICKKCGWNIK, contained this
motif and bound to purified DR11 molecules with an affinity similar to
that of the reference influenza peptide HA306–318 (Fig. 5A)
. It sensitized autologous EBV-B cells to recognition by
clone 19, with a half-maximal effect at 2 µM
(Fig. 5B)
. Considering that peptides presented by HLA class
I molecules are usually recognized by CTL when present at a
concentration of about 100 nM, we explored the
possibility that the antigenic EphA3 peptide was shorter than 16
residues. Several peptides were tested, but none of them was recognized
better than the original peptide. The smallest peptide that was
recognized, FNIICKKCG, was only
nine amino acids long and contained the putative DR11 anchor residues
(Fig. 5B)
.
|
. Variant peptides incorporating
substitutions of the putative anchor residues F at relative position 1,
and K at position 6, bound with 100-fold less affinity, whereas binding
was not affected by changing the isoleucine residues at positions 3 or
4 (Fig. 5A)
. These results indicated that the peptide bound
to DR11 molecules with a canonical motif, including a F residue most
probably anchored into pocket 1. As expected from these binding data,
peptides without the anchoring residues F or G were not recognized by
the CD4 clone (Fig. 5B)
.
Expression of Gene EphA3.
Expression in normal tissues was studied by RT-PCR amplification (Fig. 6)
. High levels of expression were found in fetal brain and retina.
Samples of adult brain, colon, liver, bladder, and prostate expressed
EphA3 at levels between 10 and 30% of that found in MEL.A-1
cells. Samples of skin, muscle, lung, kidney, adrenals, ovary, testis,
heart, liver, and breast expressed between 3 and 10% of that level. In
several tissues, no expression of EphA3 was detected. It is
important to note that tissues expected to contain a significant
proportion of hematopoietic cells that carry HLA class II molecules,
such as bone marrow, blood mononuclear cells, or thymus, were negative.
EBV-transformed B lymphocytes, or CTL clones, which express HLA class
II molecules, were also found negative. We also failed to detect
expression of EphA3 in immature dendritic cells derived from adherent
blood mononuclear cells cultivated with GM-CSF and IL-4 for 7 days
(29)
or in mature dendritic cells obtained by incubating
the immature cells for 2 days with TNF-, IL-1, IL-6, and
prostaglandin E2 (30)
.
|
. It is noteworthy that this level of expression was higher than that
found in the corresponding normal tissues; some lung cancer samples,
for example, expressed EphA3 100 times more than normal lung
tissue.
|
In Vivo Selection of LB33 Melanoma Cells That Do Not
Carry the EphA3 Antigen.
Considering that the melanoma cells MEL.B-1, derived from a metastasis
resected from patient LB33 in 1993, were shown previously to resist
lysis by most of the autologous CTL clones that recognized MEL.A-1
(9)
, we explored the possibility that they also avoided
recognition by the anti-EphA3 CD4 T lymphocytes. MEL.B-1 has been
derived from the cell line MEL.B by limiting dilution (9)
,
but only 60% of the cells were labeled with the anti-HLA-DR monoclonal
antibody, suggesting that it was not a clone. The cells expressed
EphA3 but, surprisingly, were not recognized by CD4 clone 19
(Fig. 8)
.
|
Patient LB33 relapsed in 1999 with a unique lymph node metastasis that was resected and from which a new cell line, MEL.D, was derived. MEL.D was not recognized by clone 19, because it did not express EphA3. Altogether, these results suggest that melanoma cells derived from patient LB33 in 1988 carried the EphA3 antigen, whereas tumor cells derived in 1993 and 1999 did not. It is possible that, in vivo, the anti-EphA3 CD4 T lymphocytes participated in the selection of tumor cells that escaped recognition by these T cells.
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The name Eph was given to a putative receptor cloned from a human erythropoietin-producing hepatocarcinoma cell line (33 , 34) . Eph was then found to belong to a family of 14 receptors, divided into two classes on the basis of sequence homologies in their extracellular domains. Eight EphA receptors interact with a group of five glycosylphosphatidylinositol-linked membrane proteins known collectively as ephrin-A. Six EphB receptors interact with three transmembrane proteins known as ephrin-B. Ephrins act as repulsive factors of receptor-bearing cells. Eph receptors and ephrins are involved in a range of developmental processes related to embryonic patterning. One well-studied example is the specification of the retinotectal topography in the chicken. Cek4, the chicken homologue of EphA3, is expressed in retinal neurons with an increasing nasal to temporal gradient. In the tectum, the two ligands, ephrins A2 and A5, are distributed with an increasing anterior-posterior gradient (35, 36, 37, 38) . Temporal retinal axons, which express Cek4 at a high level, grow to the anterior tectum because they are repulsed from the posterior tectum, where the expression of the two ligands is high.
EphA3 is frequently expressed in tumors. In melanomas, it seems to be a tumor-specific expression, because the two melanocyte RNA preparations that were tested were negative. In other types of tumors, such as sarcomas or lung carcinomas, EphA3 appears to be overexpressed compared with the corresponding normal tissues. Finally, in brain tumors, for example, levels of EphA3 expression are comparable with that of normal tissue. Several reports suggest that a dysregulated expression of Eph receptors or ephrins plays a role in tumorigenesis. Several EphB receptors and B ephrins were shown to be coexpressed in small cell lung cancer samples and cell lines, suggesting that ephrin B-EphB autocrine loops contributed to tumor growth (39) . The EphB4 receptor and its ligand, ephrin-B2, are implicated in the hormone-dependent morphogenesis of the mammary gland, and abnormal patterns of expression were observed in breast tumors (40) . EphA2 and ephrin B2 were reported to be expressed at higher levels in metastatic melanoma samples than in normal melanocytes (41) . Interestingly, melanoma biopsies did not contain large amounts of the EphA2 transcript, as tested with in situ hybridization and immunohistochemistry, whereas >90% of melanoma cell lines clearly expressed EphA2 (42) . This difference between melanocytes and melanomas is very similar to what we observed for EphA3.
A recent analysis of the EphA3 gene promoter in leukemia cells lines and in blood samples containing high proportions of leukemic cells indicated a correlation between EphA3 expression and demethylation of CpG dinucleotides surrounding the transcription initiation site (43) . However, this correlation was not seen with normal tissues; EphA3 was expressed at low levels, and the gene was not methylated. In accordance with these results, we observed that the treatment of fibroblasts or phytohemagglutinin A-stimulated blood mononuclear cells with demethylating agent 5-aza-2'deoxycytidine did not activate the EphA3 gene, whereas it did activate gene MAGE-A1, which is activated after demethylation of its promoter (44) . This treatment also failed to induce the expression of EphA3 in melanoma, sarcoma, renal carcinoma, and choriocarcinoma cell lines that did not express EphA3. These results suggest that neoplastic transformation results in EphA3 regulation by DNA methylation in leukemias but not in solid tumors.
Because CD4 clone 19 did not recognize autologous EBV-transformed B
cells, it appeared to specifically recognize tumor cells. To
understand the basis of this specificity, we carefully analyzed the
expression of EphA3 by normal tissues. Several Eph receptors
are known to be expressed in adult tissues, predominantly in the brain
(45)
. In accordance with these results, we observed
expression of the EphA3 gene in various human tissues,
although at levels that are 30–1000 times lower than in fetal brain.
The only adult tissue where we found a high level of expression of
EphA3 is retina. It is important to note that we did not
detect expression of EphA3 in tissues that express HLA class
II molecules, such as bone marrow, blood mononuclear cells, or thymus.
Cell lines derived from these tissues, such as CTL clones or
EBV-transformed B cells, were also negative, as well as
monocyte-derived mature or immature dendritic cells. We cannot exclude
the possibility that some normal cells present the EphA3 antigenic
peptide on HLA class II molecules. The presence of class II molecules
appears to be restricted to immune cells of hematopoietic origin, which
do not express EphA3, with the exception of endothelial cells.
Expression of HLA class II molecules was shown on microvascular
endothelial cells but not on endothelial cells of large vessels
(46)
. This normal HLA class II expression was lost when
the endothelial cells were cultured, suggesting that it is maintained
by circulating factors. In vitro, endothelial cells can be
induced to express class II molecules by IFN- or by contact with
natural killer cells. Natural killer cells induce HLA class II
expression not only through the production of IFN- but also through
an adhesion-dependent and IFN--independent mechanism, which does not
depend on the induction of CIITA in the endothelial cells (47
, 48)
. Whether class II-positive endothelial cells express EphA3
is not known.
The combined patterns of expression of HLA class II molecules and of EphA3 suggest that the antigen described here is a truly tumor-specific antigen. Interestingly, tumoral specificity does not result solely from the pattern of expression of the antigen encoding gene, as is the case for the tumor-specific antigens presented on HLA class I molecules, but from the mutually exclusive patterns of expression of the HLA class II and the antigen encoding genes. The presence of anti-EphA3 CD4 T cells in patient LB33, who has no symptoms of autoimmunity, and the apparent loss of expression of the EphA3 antigen during the progression of the disease suggest that EphA3 could be a safe and efficient source of antigens for the specific immunotherapy of class II-positive tumors such as melanomas.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This work was supported by the Belgian Program
on Interuniversity Poles of Attraction initiated by the Belgian State,
Prime Minister’s Office, Office for Science, Technology and Culture,
Science Policy Programming; by grants from the Association Contre le
Cancer, Brussels, Belgium; from the BIOMED2 program of the European
Community; from the Fonds J. Maisin, Belgium; from FB Assurances and
VIVA, Brussels, Belgium; by grants from the Fédération
Belge Contre le Cancer (Belgium); by the Axe Immunologie des Tumeurs,
Ligue Nationale Contre le Cancer, Paris, France; and from the Fonds
National de la Recherche Scientifique (TELEVIE grants), Brussels,
Belgium. 
2 Present address: Dipartimento di Medicina
Clinica e Sperimentale, Sezione di Medicina Interna e Scienze
Oncologiche, Policlinico Monteluce, Via Brunamonti, 06100 Perugia,
Italy.
3 To whom requests for reprints should be
addressed, at Cellular Genetics Unit, Université Catholique de
Louvain, 74 Avenue Hippocrate, UCL 7459, B-1200 Brussels, Belgium.
4 The abbreviations used are: IL, interleukin;
RT-PCR, reverse transcription-PCR; GM-CSF,
granulocyte/macrophage-colony stimulating factor; TNF, tumor necrosis
factor; CIITA, class II transactivator.
Received 4/ 5/00. Accepted 7/ 5/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Int. J. Cancer, 78: 189-195, 1998.[Medline]
-fluorenylmethysoxycarbamylamino acid on polyamide supports. Synthesis of substance P and of acyl carrier protein 65-74 decapeptide. J. Chem. Soc. Lond. Perkin Trans., 1: 538-546, 1981.
-dependent and -independent mechanisms. J. Immunol., 154: 3222-3233, 1995.[Abstract]
This article has been cited by other articles:
|
|
 |
|
  M. Lackmann and A. W. Boyd Eph, a Protein Family Coming of Age: More Confusion, Insight, or Complexity? Sci. Signal., April 15, 2008; 1(15): re2 - re2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ivanov, T. Aarts, S. Hol, A. Doornenbal, A. Hagenbeek, E. Petersen, and S. Ebeling Identification of a 40S Ribosomal Protein S4-Derived H-Y Epitope Able to Elicit a Lymphoblast-Specific Cytotoxic T Lymphocyte Response Clin. Cancer Res., March 1, 2005; 11(5): 1694 - 1703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Hafner, G. Schmitz, S. Meyer, F. Bataille, P. Hau, T. Langmann, W. Dietmaier, M. Landthaler, and T. Vogt Differential Gene Expression of Eph Receptors and Ephrins in Benign Human Tissues and Cancers Clin. Chem., March 1, 2004; 50(3): 490 - 499. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Novellino, N. Renkvist, F. Rini, A. Mazzocchi, L. Rivoltini, A. Greco, P. Deho, P. Squarcina, P. F. Robbins, G. Parmiani, et al. Identification of a Mutated Receptor-Like Protein Tyrosine Phosphatase {kappa} as a Novel, Class II HLA-Restricted Melanoma Antigen J. Immunol., June 15, 2003; 170(12): 6363 - 6370. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Kanaseki, H. Ikeda, Y. Takamura, M. Toyota, Y. Hirohashi, T. Tokino, T. Himi, and N. Sato Histone Deacetylation, But Not Hypermethylation, Modifies Class II Transactivator and MHC Class II Gene Expression in Squamous Cell Carcinomas J. Immunol., May 15, 2003; 170(10): 4980 - 4985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Das, J.-H. Lin, J. Papamatheakis, Y. Sykulev, and P. N. Tsichlis Differential Splicing Generates Tvl-1/RFXANK Isoforms with Different Functions J. Biol. Chem., November 15, 2002; 277(47): 45172 - 45180. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. F. Robbins, M. El-Gamil, Y. F. Li, G. Zeng, M. Dudley, and S. A. Rosenberg Multiple HLA Class II-Restricted Melanocyte Differentiation Antigens Are Recognized by Tumor-Infiltrating Lymphocytes from a Patient with Melanoma J. Immunol., November 15, 2002; 169(10): 6036 - 6047. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Dorothee, I. Vergnon, J. Menez, H. Echchakir, D. Grunenwald, M. Kubin, S. Chouaib, and F. Mami-Chouaib Tumor-Infiltrating CD4+ T Lymphocytes Express APO2 Ligand (APO2L)/TRAIL upon Specific Stimulation with Autologous Lung Carcinoma Cells: Role of IFN-{alpha} on APO2L/TRAIL Expression and -Mediated Cytotoxicity J. Immunol., July 15, 2002; 169(2): 809 - 817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Parmiani, C. Castelli, P. Dalerba, R. Mortarini, L. Rivoltini, F. M. Marincola, and A. Anichini Cancer Immunotherapy With Peptide-Based Vaccines: What Have We Achieved? Where Are We Going? J Natl Cancer Inst, June 5, 2002; 94(11): 805 - 818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. D. Lawrenson, S. H. Wimmer-Kleikamp, P. Lock, S. M. Schoenwaelder, M. Down, A. W. Boyd, P. F. Alewood, and M. Lackmann Ephrin-A5 induces rounding, blebbing and de-adhesion of EphA3-expressing 293T and melanoma cells by CrkII and Rho-mediated signalling J. Cell Sci., January 3, 2002; 115(5): 1059 - 1072. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. B. Beck-Engeser, P. A. Monach, D. Mumberg, F. Yang, S. Wanderling, K. Schreiber, R. Espinosa III, M. M. Le Beau, S. C. Meredith, and H. Schreiber Point Mutation in Essential Genes with Loss or Mutation of the Second Allele: Relevance to the Retention of Tumor-specific Antigens J. Exp. Med., August 6, 2001; 194(3): 285 - 300. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. So, M. Takenoyama, M. Sugaya, M. Yasuda, R. Eifuku, T. Yoshimatsu, T. Hanagiri, T. Oyama, M. Kodate, T. Osaki, et al. Generation of Autologous Tumor-specific T Cell Clones From a Patient With Adenosquamous Carcinoma of the Lung Jpn. J. Clin. Oncol., July 1, 2001; 31(7): 311 - 317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Nisini, G. Romagnoli, M. J. Gomez, R. La Valle, A. Torosantucci, S. Mariotti, R. Teloni, and A. Cassone Antigenic Properties and Processing Requirements of 65-Kilodalton Mannoprotein, a Major Antigen Target of Anti-Candida Human T-Cell Response, as Disclosed by Specific Human T-Cell Clones Infect. Immun., June 1, 2001; 69(6): 3728 - 3736. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |
