
[Cancer Research 60, 4907-4912, September 1, 2000]
© 2000 American Association for Cancer Research
Molecular Biology and Genetics |
The Gene for a Novel Transmembrane Protein Containing Epidermal Growth Factor and Follistatin Domains Is Frequently Hypermethylated in Human Tumor Cells1
Gangning Liang2,
Keith D. Robertson,
Cathy Talmadge,
Janos Sumegi and
Peter A. Jones
Urologic Cancer Research Laboratory, Department of Biochemistry and Molecular Biology, University of Southern California/Norris Comprehensive Cancer Center, University of Southern California, School of Medicine, Los Angeles, California 90033 [G. L., K. D. R., P. A. J.], and University of Nebraska Medical Center, Department of Pathology, Omaha, Nebraska 68198 [C. T., J. S.]
 |
ABSTRACT
|
|---|
A DNA fragment frequently hypermethylated in tumor cells was isolated
using a novel screening strategy termed methylation-sensitive
arbitrarily primed PCR. The isolated sequence corresponded to a CpG
island at the 5' end of a previously unknown gene, TPEF
(transmembrane protein containing epidermal growth factor and
follistatin domains). Expression of TPEF was observed
using Northern master blot analysis of a variety of normal tissues
including colon, bladder, and prostate tissue. TPEF maps
to human chromosome 2q33, where frequent loss of heterozygosity is seen
in various human tumors, and TPEF was not expressed in
most human colon and various other tumor cell lines examined by reverse
transcription-PCR. Nine of 11 tumor cell lines were highly methylated
in the 5' region and the first exon of the gene that demonstrated
features characteristic of a CpG island. However the other two
cell lines, which expressed TPEF, were hypomethylated in
the 5' end of the gene. The region was also hypermethylated in 11 of 16
primary bladder tumors and in 3 of 4 primary colon tumors when compared
with adjacent normal tissue. Our results suggest that potential tumor
suppressor genes can be isolated from human tumors by virtue of their
altered methylation patterns.
 |
INTRODUCTION
|
|---|
Changes in DNA methylation are often seen in tumor cells
(1, 2, 3)
. Many of these changes occur at CpG dinucleotides
clustered in regions of about 1 kb, called CpG islands, in or near the
promoter and first exon regions of genes (4)
. CpG islands
are commonly associated with genes and may regulate their transcription
when located in promoter regions. Hypermethylation of CpG islands in
the promoter regions of X-linked (5)
and imprinted genes
(6)
is associated with loss of transcription. Many studies
have indicated a correlation between CpG island methylation and
tumorigenesis through the inactivation of tumor suppressor genes and
other genes that contribute to tumorigenesis (7, 8, 9, 10, 11, 12, 13, 14, 15, 16)
. The
ability to detect methylation changes associated with oncogenic
transformation is of critical importance in understanding how DNA
methylation may contribute to tumorigenesis. We, and others, have
developed a simple and reproducible fingerprinting method called Ms
AP-PCR3
for screening the genome for regions of DNA that have altered patterns
of DNA methylation (17, 18, 19, 20, 21)
.
By using Ms AP-PCR, a hypermethylated DNA fragment (18
, 22)
, which was described as band 5 in Ref. 18
, was
isolated from a human colon tumor cell line and sequenced. The
fragment, which was found to fulfill the criteria for a CpG island
(23)
, matched a portion of a human cDNA clone
characterized as an EST in GenBank, and further investigation of this
unknown gene (TPEF) revealed that it encodes a transmembrane
protein containing EGF and follistatin domains. The gene maps to
chromosome 2q33, where frequent loss of heterozygosity is detected in
various tumors (24, 25, 26, 27, 28, 29, 30)
. High-level expression in brain
and prostate and low-level expression in a variety of other normal
tissues were found by Northern master blot. To better understand the
potential role for DNA methylation in the regulation of
TPEF, we also cloned and sequenced the 5' region of the gene
and examined its methylation status by Ms-SNuPE (31)
.
TPEF was found to be hypermethylated in 9 of 11 tumor cell
lines and in 14 of 20 primary bladder and colon tumors when compared
with adjacent normal tissues. The results in tumor cell lines also
indicated that expression of TPEF could be silenced by DNA
methylation, suggesting that epigenetic silencing of
TPEF might have a role in carcinogenesis.
 |
MATERIALS AND METHODS
|
|---|
Cloning and Sequencing the 5' End of the TPEF
Gene.
The hypermethylated fragment was isolated by the Ms AP-PCR
approach and used as a probe to screen a
genomic library (human
placenta) according to the instructions of the manufacturer
(Stratagene). A single phage clone was isolated, and a 12-kb insert was
characterized by restriction enzyme analysis. Using a primer located in
the hypermethylated fragment and walking through the 5' region of
TPEF, about 2.5 kb of the insert was sequenced. A detailed
description of this region is shown in Fig. 1
.

View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. The 5' region of TPEF (GenBank accession
number AF242221). Each tick mark represents a CpG site,
and each arrow represents a CpG site whose methylation
status was determined by Ms-SNuPE. The light gray box
represents a possible promoter region. Stars represent
Sp1 consensus.
|
|
EST Clone.
The sequence of the hypermethylated fragment matched several EST clones
using the BLAST network service provided by the National Center
for Biotechnology Information. We ordered one IMAGE Consortium
cDNA clone (GenBank accession number H05869), which contained the
longest insert, from the United Kingdom Human Genome Mapping
Project Resource Center. By using this EST cDNA clone, a 1.8-kb
partial-length sequence was obtained.
Determination of the 5' End of the TPEF Transcript
by 5' RACE.
First-strand cDNA was synthesized from total SK-Mel-28 RNA using the
GSP1 (CAAACGGCTTCCGAGGAACACAG) and Superscript II reverse transcriptase
(Life Technologies, Inc.). After the first-strand cDNA synthesis, the
mRNA template was digested with RNase, and the unincorporated
deoxynucleotide triphosphates, GSP1, and proteins were removed. A
homopolymeric tail was added to the 3' end of the purified cDNA using
terminal deoxynucleotidyl transferase (Life Technologies, Inc.) and
dCTP. The tailed cDNA was first amplified by PCR using GSP2
(CATCTCGAGAGTTTCAGCAACATCC), which anneals upstream of GSP1, and
an abridged anchor primer (GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG; Life
Technologies, Inc.). The first-round PCR product was used as template
for the second round of PCR amplification using GSP3
(GAAGCTGCTGCCATAAGGAGGGA) and an abridged universal amplification
primer (GGCCACGCGTCGACTAGTAC; Life Technologies, Inc.). The conditions
for the PCR were 95°C for 2 min and 35 cycles of 95°C for 1 min,
55°C to 62°C for 45 s, and 72°C for 90 s, followed by
elongation at 72°C for 8 min. The PCR product was excised from the
gel and sequenced directly.
Chromosomal Mapping.
Fluorescence in situ hybridization was carried out on normal
female lymphocyte chromosome spreads as described previously
(32)
. The probe for TPEF, which was derived
from the phage clone that contained the 5' region of TPEF,
was labeled with biotin, hybridized to chromosome spreads, r-banded,
and then detected with fluorescein-avidin.
Northern Master Blot Analysis.
Northern master blots (Clontech Laboratories, Inc.) containing mRNA
from 50 different human tissues were used. The probe was labeled with
the Random-Prime DNA Label Kit (Boehringer Mannheim) and hybridized at
65°C in ExpressHyb hybridization buffer (Clontech Laboratories, Inc.)
according to the manufacturers instructions. The cDNA probe was
derived from the EST plasmid containing the partial-length
TPEF cDNA (GenBank accession number H05869).
DNA Isolation from Tissues and Cell Lines.
Matched pairs of normal and tumor specimens were obtained from the
colon and bladder of patients treated at the Los Angeles County,
University of Southern California Medical Center and the University of
Southern California/Norris Comprehensive Cancer Center (Los Angeles,
CA). Mucosal tissues were first removed from the surrounding muscle and
fat. Seven colon cancer cell lines (SW837, SW480, HT-29, LoVo, SW48,
HCT116, and HCT15), two prostate cancer cell lines (LNCaP and
DU145), one bladder tumor cell line (3576), and one melanoma
cell line (SK-Mel-28) were obtained from American Type Culture
Collection and grown in the recommended medium. DNA was isolated using
standard procedures by treatment with proteinase K and phenol
extraction (33)
.
Quantitation of DNA Methylation by Ms-SNuPE.
We have developed a rapid quantitative method called Ms-SNuPE for
assessing methylation differences at specific CpG sites
(31)
. Briefly, genomic DNA was first reacted with 5
M sodium bisulfite to convert unmethylated cytosine to
uracil while leaving 5-methylcytosine unchanged. Amplification of the
desired target sequence was performed using PCR primers (sense primer,
AATTAGTTATGGTGTTGTGG; antisense primer, CTAAAATAAACTAATCTATACTAAATAC)
specific for bisulfite-converted DNA. The PCR products were then
isolated and used as a template for methylation analysis at three CpG
sites by three specific Ms-SNuPE primers (primer 1,
TAGTGTAGTAGTTGGATATTTTG; primer 2, GTTGGTTGTTGTTGTTGTT; and primer 3,
AATTGTTTTGGTAAGTTTAGAATTTT). PCR conditions were 95°C for 2 min and
40 cycles of 95°C for 1 min, 51°C for 30 s, and 72°C for 1
min, followed by 72°C for 4 min. Ms-SNuPE conditions were one
cycle primer extension of 95°C for 1 min, 51°C for 2 min, and
72°C for 1 min. The final products were then resolved on a 15%
polyacrylamide gel. Results were quantitated with a Molecular Dynamics
PhosphorImager. The percentage methylation of each sample is the
average of the three CpG sites examined by Ms-SNuPE.
Bisulfite Genomic Sequencing.
The PCR products from Ms-SNuPE were ligated into pCRII cloning vector
(Invitrogen, San Diego, CA). Individual plasmid molecules were then
sequenced by automated DNA sequencer at University of Southern
California microchemical facility.
RT-PCR.
Total (2 µg) RNA from tumor cell lines was converted into cDNA by
using 0.5 absorbance unit of random hexamers, 1 mM each
deoxynucleotide triphosphate (Boehringer Mannheim), 10 units of
Superscript II reverse transcriptase (Life Technologies, Inc.), 1 unit
of RNasin (Promega), 0.01 M DTT, 75 µg of BSA, and 1x
cDNA first-strand buffer in a 50 µl total volume. The mixture
was then placed at room temperature for 10 min, 42°C for 45 min, and
90°C for 3 min and then rapidly cooled to 4°C. PCR was performed
with 100 ng of cDNA. The primers used were as follows: (a)
TPEF-sense, TTGACTCTCCCTCCACCCTG; and (b)
TPEF-antisense, AGACGCAAGTCACAGTGTCTC. The PCR conditions
were 95°C for 2 min and 35 cycles of 95°C for 1 min, 56°C for
30 s, and 72°C for 90 s, followed by 72°C for 4 min.
 |
RESULTS
|
|---|
A Hypermethylated Fragment Located at the 5' Region of
TPEF.
The hypermethylated DNA fragment isolated by Ms AP-PCR
(18)
fulfilled the criteria for a CpG island with a GC
content greater than 0.5 and an observed:expected CpG ratio greater
than 0.6 (23)
. The fragment matched the 5' region of a
human cDNA clone characterized as an EST, suggesting that the CpG
island might be located at the 5' end or promoter region of the unknown
gene (TPEF). The transcription initiation site of this
unknown gene was determined by 5' RACE using GSPs (see "Materials and
Methods") in the SK-Mel-28 tumor cell line. Sequencing of the 5'
RACE-generated transcript showed that a putative transcription
initiation site was just 12 bp upstream of the 5' end of the EST
sequence (Fig. 1)
. To better understand the role of methylation in
regulation of TPEF, we also cloned and sequenced the
putative promoter region of TPEF. The sequence of a clone
containing exon 1 indicated that the promoter of TPEF was
TATA-less and was a CpG island (Fig. 1)
. The most CpG-rich region from
-1100 to +750 (Fig. 1)
had a GC content of 0.64 and an
observed:expected CpG ratio of 0.76. A potential promoter region (-650
to +1 bp; Fig. 1
) was predicted using the computer program NNPP
and TSSG available through the Baylor College of
Medicine.4
It is important to note that were 10 potential Sp1 binding sites within
this region that are common in TATA-less promoters such as this.
TPEF Encodes a Transmembrane Protein Containing EGF
and Follistatin Domains.
BLAST searches with the DNA sequence of the hypermethylated fragment
identified several EST clones containing sequences that were almost
identical to the EST clone with the longest insert. Combining
the sequence with the results from 5' RACE showed that the cDNA
sequence of TPEF is 1836 bp and defines a single
1124-nucleotide open reading frame encoding 374 amino acids with a
predicted molecular weight of 41,432. The putative translation
initiation site begins with an ATG conforming to Kozaks rules
(34
, 35)
. The 3' untranslated region includes a
destabilizing ATTTA motif and two potential polyadenylation signals
(AATAAA) followed by a polyadenylic acid stretch
(36)
. The protein also contains a predicted signal peptide
and transmembrane region (Fig. 2)
.

View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. A, nucleotide and deduced amino acid
sequence of TPEF (GenBank accession number AF242222).
The destabilizing ATTTA motif is double underlined, and
the potential polyadenylation signal AATAAA is
underlined. B, direction of hydrophobic
moment (48)
of the deduced TPEF protein.
SP, signal peptide; TM, transmembrane
region.
|
|
BLAST searches of GenBank databases using the predicted protein
revealed significant homology with two known proteins: (a) a
novel transmembrane protein of Xenopus laevis with EGF and
follistatin domains (37)
; and (b) a
human protein (GenBank accession number U19878). The overall
levels of identity and similarity between TPEF and the
transmembrane protein (X. laevis and human) are 4953% and
7273%, respectively. The database searches also indicated that
TPEF contained two follistatin domains and an EGF domain
similar to the transmembrane proteins in X. laevis and human
(Fig. 3)
.
Expression Pattern and Chromosomal Location of the
TPEF Gene.
Screening of a human Northern master blot containing RNAs from 50
different tissues revealed detectable expression of TPEF
mRNA transcripts in most tissues when compared to control with the most
abundant expression in brain and prostate (Fig. 4)
. Northern blot analysis revealed a similar result (data not shown).
A phage genomic clone that contained the 5' end of TPEF was
used to map the chromosome location of the gene by fluorescence
in situ hybridization. The human TPEF gene maps
to chromosome 2q33.
The 5' Region of TPEF Is Hypermethylated and
Silenced by Methylation in Tumor Cells.
We next examined the levels of methylation in the 5' region of
TPEF, where the hypermethylated fragment identified by Ms
AP-PCR was located (Fig. 1)
. Our previous results from Ms AP-PCR had
already indicated that most colon and bladder tumors were
hypermethylated in that region (18
, 22)
. Analysis of the
methylation level in the 5' region of TPEF by the
quantitative Ms-SNuPE assay showed that the 5' region of
TPEF was heavily methylated in 9 of 11 tumor cell lines
(Fig. 5)
. The tumor cell lines with high levels of methylation in the 5' region
showed no detectable mRNA expression by RT-PCR (Fig. 5)
. On the other
hand, the tumor cell lines that had low levels of methylation showed
expression of TPEF (Fig. 5)
. The fragment isolated by Ms
AP-PCR is located near the 3' end of the CpG island. Methylation in
this region may reflect either methylation throughout the entire CpG
island or a localized event. To distinguish between these
possibilities, Southern blot analysis was performed by using a probe
from -1000 to +1 related to the transcription start site (Fig. 1)
to
check the methylation status of the 5' end of the CpG island in four
colon tumor cell lines. The results indicated hypermethylation at the
5' end of the CpG island consistent with the Ms-SNuPE analysis of the
3' end of the CpG island (data not shown).

View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. Methylation and expression of TPEF in tumor
cell lines. The methylation status at the 5' region of
TPEF was analyzed by the Ms-SNuPE assay. Expression of
TPEF was checked by RT-PCR. HCT15, LoVo, HCT116, SW48,
SW480, SW837, and HT-29 are human colon tumor cell lines. 3657 is a
human bladder tumor cell line. SK-Mel-28 is a human melanoma cell line.
LNCaP and DU145 are human prostate tumor cell lines.
|
|
We also examined the levels of methylation in the 5' region of
TPEF in uncultured tumors and adjacent normal tissues
obtained from the same patients. Eleven of 16 bladder tumors were
hypermethylated at the 5' region when compared with available adjacent
normal tissues (assuming a value 10% or lower as a baseline; Fig. 6
). Three of four colon tumors were hypermethylated at the 5' region
compared with adjacent normal tissues (Fig. 6)
. One bladder tumor
sample (B3) had increased methylation in both the tumor and adjacent
normal tissue (Fig. 6)
. Bisulfite sequencing on samples from patient
B15 showed patch methylation of some TPEF alleles in
the normal tissues and a much increased level of methylation in the
tumors (Fig. 7)
. Thus, the methylation changes may be initiated in premalignant
tissues and become reinforced during tumorigenesis. The extensive level
of methylation of individual TPEF alleles in the tumors
suggested that this might be sufficient to induce transcriptional
inactivation of the gene by comparison with the data for cell lines
(Fig. 5)
. In summary, these data show that 14 of the 20 (70%) tumor
tissues examined were hypermethylated at the TPEF locus.

View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Methylation status of the 5' end region of
TPEF in primary tumors and adjacent normal tissues of 16
patients with bladder cancer (B1-B16)
and 4 patients with colon cancer
(C1-C4). Methylation status of the 5'
end of the TPEF gene was analyzed by the Ms-SNuPE
assay.
|
|
 |
DISCUSSION
|
|---|
The role of DNA methylation in cancer has largely been
studied by analysis of known tumor suppressor genes. We have developed
a genome scanning method, Ms AP-PCR, to survey global methylation
pattern changes in tumors to identify CpG islands associated with genes
that become abnormally methylated in cancer (18
, 22)
.
Using genomic scanning approaches, we and others have identified novel
genes as hypermethylated fragments in tumor cells (17, 18, 19, 20
, 38) .
The 5' region of TPEF is a typical CpG island. The fragment
isolated by Ms AP-PCR is located near the 3' end of the CpG island;
however, its methylation status likely reflects the methylation status
of the entire CpG island because most studies have indicated that
aberrant methylation can spread across a CpG island (1
, 16
, 39, 40, 41)
. Our results have shown that the methylation patterns at
the 5' end of the CpG island are consistent with the 3' end of the CpG
island. The CpG island in TPEF is densely methylated in most
tumor cell lines, and the methylation correlates with TPEF
silencing in tumor cell lines. Seventy percent of the primary tumors
had a hypermethylated CpG island, and increased methylation of the CpG
island was also observed in one adjacent normal tissue, possibly due to
premalignant or age-related methylation changes (42)
.
TPEF may be inactivated not only by methylation but also by
chromosome deletion because it is located on chromosome 2q33, where a
high frequency of loss is generally associated with esophageal squamous
cell carcinoma and is less frequently associated with lung, colon,
bladder, prostate, and breast cancers (24, 25, 26, 27, 28, 29)
.
Homozygous deletion at 2q33 is commonly seen in small cell lung
carcinoma (30)
.
The sequence analysis indicated that TPEF encodes a
transmembrane protein containing two follistatin domains and one EGF
domain (37)
. Follistatin is able to bind and neutralize
the actions of activin and many members of the transforming growth
factor ß family (43)
. TPEF, which contains
two follistatin domains, might therefore bind growth factors such as
activin and transforming growth factor ß and inhibit their action.
TPEF, like many growth factors, receptors, and
adhesion molecules, contains EGF domains defined as
CX7CX45CX1013CXCX8GXRC
(X is a amino acid other than C, G, or R) that can
participate in protein-protein or protein-cell interactions
(44, 45, 46)
. When arginine (R) is mutated to histidine (H) in
the EGF domain of human EGF, the EGF loses most of its affinity for the
EGF receptor (47)
. The absence of the corresponding
arginine in the EGF domain of TPEF instead of histidine
indicates that TPEF may play a role as a ligand, and EGF
receptor inactivation is probably the function of this domain.
The structural analysis of the follistatin and EGF domains suggests
that TPEF might act as an inhibitor of growth factors. More
detailed studies need to be undertaken to better understand the
potential function of TPEF in cancer; however, our results
suggest that potential tumor suppressor genes can be isolated from
human tumors by virtue of their altered methylation patterns.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 Supported by USPHS Grant 1 RO1 CA82422-01 (to
P. A. J.) from the National Cancer Institute and by the American
Foundation for Urologic Disease. 
2 To whom requests for reprints should be
addressed, at Urologic Cancer Research Laboratory, Department of
Biochemistry and Molecular Biology, University of Southern
California/Norris Comprehensive Cancer Center, MS 83, 1441 Eastlake
Avenue, University of Southern California, School of Medicine, Los
Angeles, CA 90033. Phone: (323) 865-0741; Fax: (323) 865-0102;
E-Mail: gliang{at}hsc.usc.edu 
3 The abbreviations used are: Ms AP-PCR,
methylation-sensitive arbitrarily primed PCR; Ms-SNuPE,
methylation-sensitive single nucleotide primer extension; RT-PCR,
reverse transcription-PCR; EST, expressed sequence tag; EGF, epidermal
growth factor; RACE, rapid amplification of cDNA ends; GSP,
gene-specific primer. 
4 launcher@http:11.imgen.bcm.tmc.edu:9331. 
Received 10/28/99.
Accepted 6/30/00.
 |
REFERENCES
|
|---|
-
Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat Genet., 21: 163-167, 1999.[Medline]
-
Jones P. A. DNA methylation errors and cancer. Cancer Res., 56: 2463-2467, 1996.[Free Full Text]
-
Baylin S. B., Makos M., Wu J. J., Yen R. W., de Bustros A., Vertino P., Nelkin B. D. Abnormal patterns of DNA methylation in human neoplasia: potential consequences for tumor progression. Cancer Cells (Cold Spring Harbor), 3: 383-390, 1991.[Medline]
-
Laird P. W., Jaenisch R. DNA methylation and cancer. Hum. Mol. Genet., 3: 1487-1495, 1994.[Abstract]
-
Adam, R. L. R., and Burdon, R. H. Molecular Biology of DNA Methylation. New York: Springer-Verlag, 1985.
-
Riggs A. D., Pfeifer G. P. X-chromosome inactivation and cell memory. Trends Genet., 8: 169-174, 1992.[Medline]
-
Sakai T., Toguchida J., Ohtani N., Yandell D. W., Rapaport J. M., Dryja T. P. Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am. J. Hum. Genet., 48: 880-888, 1991.[Medline]
-
Zion M., Ben-Yehuda D., Avraham A., Cohen O., Wetzler M., Melloul D., Ben-Neriah Y. Progressive de novo DNA methylation at the bcr-abl locus in the course of chronic myelogenous leukemia. Proc. Natl. Acad. Sci. USA, 91: 10722-10726, 1994.[Abstract/Free Full Text]
-
Herman J. G., Latif F., Weng Y., Lerman M. I., Zbar B., Liu S., Samid D., Duan D. S., Gnarra J. R., Linehan W. M., Baylin S. B. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Natl. Acad. Sci. USA, 91: 9700-9704, 1994.[Abstract/Free Full Text]
-
Issa J. P., Zehnbauer B. A., Civin C. I., Collector M. I., Sharkis S. J., Davidson N. E., Kaufmann S. H., Baylin S. B. The estrogen receptor CpG island is methylated in most hematopoietic neoplasms. Cancer Res., 56: 973-977, 1996.[Abstract/Free Full Text]
-
Graff J. R., Herman J. G., Lapidus R. G., Chopra H., Xu R., Jarrard D. F., Isaacs W. B., Pitha P. M., Davidson N. E., Baylin S. B. E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res., 55: 5195-5199, 1995.[Abstract/Free Full Text]
-
Gonzalez-Zulueta M., Bender C. M., Yang A. S., Nguyen T., Beart R. W., Van Tornout J. M., Jones P. A. Methylation of the 5' CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res., 55: 4531-4535, 1995.[Abstract/Free Full Text]
-
Katzenellenbogen R. A., Baylin S. B., Herman J. G. Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. Blood, 93: 4347-4353, 1999.[Abstract/Free Full Text]
-
Tanaka H., Shimada Y., Harada H., Shinoda M., Hatooka S., Imamura M., Ishizaki K. Methylation of the 5' CpG island of the FHIT gene is closely associated with transcriptional inactivation in esophageal squamous cell carcinomas. Cancer Res., 58: 3429-3434, 1998.[Abstract/Free Full Text]
-
Esteller M., Hamilton S. R., Burger P. C., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59: 793-797, 1999.[Abstract/Free Full Text]
-
Bachman K. E., Herman J. G., Corn P. G., Merlo A., Costello J. F., Cavenee W. K., Baylin S. B., Graff J. R. Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggests a suppressor role in kidney, brain, and other human cancers. Cancer Res., 59: 798-802, 1999.[Abstract/Free Full Text]
-
Gonzalgo M. L., Liang G., Spruck C. H., III, Zingg J. M., Rideout W. M., III, Jones P. A. Identification and characterization of differentially methylated regions of genomic DNA by methylation-sensitive arbitrarily primed PCR. Cancer Res., 57: 594-599, 1997.[Abstract/Free Full Text]
-
Liang G., Salem C. E., Yu M. C., Nguyen H. D., Gonzales F. A., Nguyen T. T., Nichols P. W., Jones P. A. DNA methylation differences associated with tumor tissues identified by genome scanning analysis. Genomics, 53: 260-268, 1998.[Medline]
-
Huang T. H., Laux D. E., Hamlin B. C., Tran P., Tran H., Lubahn D. B. Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique. Cancer Res., 57: 1030-1034, 1997.[Abstract/Free Full Text]
-
Kohno T., Kawanishi M., Inazawa J., Yokota J. Identification of CpG islands hypermethylated in human lung cancer by the arbitrarily primed-PCR method. Hum. Genet., 102: 258-264, 1998.[Medline]
-
Salme C. E., Markl I. D., Bender C. M., Gonzales F. A., Jones P. A., Liang G. PAX6 methylation and ectopic expression in human tumor cells. Int. J. Cancer, 87: 179-185, 2000.[Medline]
-
Salme C. E., Liang G., Tsai Y. C., Coulter J., Knowles M. A., Feng A-C., Groshen S., Nichols P. W., Jones P. A. Progressive increases in de novo methylation of CpG islands in bladder cancer. Cancer Res., 60: 2473-2476, 2000.[Abstract/Free Full Text]
-
Cardiner-Garden M., Formmer M. CpG island in vertebrate genome. J. Mol. Biol., 196: 261-282, 1987.[Medline]
-
Pack S. D., Karkera J. D., Zhuang Z., Pak E. D., Balan K. V., Hwu P., Park W. S., Pham T., Ault D. O., Glaser M., Liotta L., Detera-Wadleigh S. D., Wadleigh R. G. Molecular cytogenetic fingerprinting of esophageal squamous cell carcinoma by comparative genomic hybridization reveals a consistent pattern of chromosomal alterations. Genes Chromosomes Cancer, 25: 160-168, 1999.[Medline]
-
Ransom D. T., Barnett T. C., Bot J., de Boer B., Metcalf C., Davidson J. A., Turbett G. R. Loss of heterozygosity on chromosome 2q: possibly a poor prognostic factor in head and neck cancer. Head Neck, 20: 404-410, 1998.[Medline]
-
Brothman A. R. Cytogenetic studies in prostate cancer: are we making progress?. Cancer Genet. Cytogenet., 95: 116-121, 1997.[Medline]
-
Jiricny J. Mismatch repair and cancer. Cancer Surv., 28: 47-68, 1996.[Medline]
-
Simon R., Burger H., Brinkschmidt C., Bocker W., Hertle L., Terpe H. J. Chromosomal aberrations associated with invasion in papillary superficial bladder cancer. J. Pathol., 185: 345-351, 1998.[Medline]
-
Huiping C., Johannsdottir J. T., Arason A., Olafsdottir G. H., Eiriksdottir G., Egilsson V., Ingvarsson S. Replication error in human breast cancer: comparison with clinical variables and family history of cancer. Oncol. Rep., 6: 117-122, 1999.[Medline]
-
Kohno T., Otsuka T., Inazawa J., Abe T., Yokota J. Breakpoint junction of interstitial homozygous deletion at chromosome 2q33 in a small cell lung carcinoma. DNA Res., 3: 421-424, 1996.[Abstract]
-
Gonzalgo M. L., Jones P. A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res., 25: 2529-2531, 1997.[Abstract/Free Full Text]
-
Lanyi A., Li B., Li S., Talmadge C. B., Brichacek B., Davis J. R., Kozel B. A., Trask B., van den Engh G., Uzvolgyi E., Stanbridge E. J., Nelson D. L., Chinault C., Heslop H., Gross T. G., Seemayer T. A., Klein G., Purtilo D. T., Sumegi J. A yeast artificial chromosome (YAC) contig encompassing the critical region of the X-linked lymphoproliferative disease (XLP) locus. Genomics, 39: 55-65, 1997.[Medline]
-
Michalowsky L. A., Jones P. A. Gene structure and transcription in mouse cells with extensively demethylated DNA. Mol. Cell. Biol., 9: 885-892, 1989.[Abstract/Free Full Text]
-
Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res., 15: 8125-8148, 1987.[Abstract/Free Full Text]
-
Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem., 266: 19867-19870, 1991.[Free Full Text]
-
Shaw G., Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell, 46: 659-667, 1986.[Medline]
-
Eib D. W., Martens G. J. A novel transmembrane protein with epidermal growth factor and follistatin domains expressed in the hypothalamo-hypophysial axis of Xenopus laevis. J. Neurochem., 67: 1047-1055, 1996.[Medline]
-
Toyota M., Ho C., Ohe-Toyota M., Baylin S. B., Issa J. P. Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5' CpG island in human tumors. Cancer Res., 59: 4535-4541, 1999.[Abstract/Free Full Text]
-
Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
-
Stirzaker C., Millar D. S., Paul C. L., Warnecke P. M., Harrison J., Vincent P. C., Frommer M., Clark S. J. Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors. Cancer Res., 57: 2229-2237, 1997.[Abstract/Free Full Text]
-
Smiraglia D. J., Fruhwald M. C., Costello J. F., McCormick S. P., Dai Z., Peltomaki P., ODorisio M. S., Cavenee W. K., Plass C. A new tool for the rapid cloning of amplified and hypermethylated human DNA sequences from restriction landmark genome scanning gels. Genomics, 58: 254-262, 1999.[Medline]
-
Toyota M., Ho C., Ahuja N., Jair K. W., Li Q., Ohe-Toyota M., Baylin S. B., Issa J. P. Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification. Cancer Res., 59: 2307-2312, 1999.[Abstract/Free Full Text]
-
Patel K. Follistatin. Int. J. Biochem. Cell Biol., 30: 1087-1093, 1998.[Medline]
-
Wahl M. I., Nishibe S., Kim J. W., Kim H., Rhee S. G., Carpenter G. Identification of two epidermal growth factor-sensitive tyrosine phosphorylation sites of phospholipase C-
in intact HSC-1 cells. J. Biol. Chem., 265: 3944-3948, 1990.[Abstract/Free Full Text]
-
Campbell C. D., Bork P. Epidermal growth factor-like modules. Curr. Opin. Struct. Biol., 3: 385-392, 1993.
-
Appella E., Weber I. T., Blasi F. Structure and function of epidermal growth factor-like regions in proteins. FEBS Lett., 231: 1-4, 1988.[Medline]
-
Engler D. A., Montelione G. T., Niyogi S. K. Human epidermal growth factor. Distinct roles of tyrosine 37 and arginine 41 in receptor binding as determined by site-directed mutagenesis and nuclear magnetic resonance spectroscopy. FEBS Lett., 271: 47-50, 1990.[Medline]
-
Eisenberg D., Wilcox W., McLachlan A. D. Hydrophobicity and amphiphilicity in protein structure. J. Cell. Biochem., 31: 11-17, 1986.[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
M. Chen, M. Sinha, B. A. Luxon, A. R. Bresnick, and K. L. O'Connor
Integrin {alpha}6{beta}4 Controls the Expression of Genes Associated with Cell Motility, Invasion, and Metastasis, Including S100A4/Metastasin
J. Biol. Chem.,
January 16, 2009;
284(3):
1484 - 1494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Ali and V. Knauper
Phorbol Ester-induced Shedding of the Prostate Cancer Marker Transmembrane Protein with Epidermal Growth Factor and Two Follistatin Motifs 2 Is Mediated by the Disintegrin and Metalloproteinase-17
J. Biol. Chem.,
December 28, 2007;
282(52):
37378 - 37388.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zou, J. J. Harrington, A. M. Shire, R. L. Rego, L. Wang, M. E. Campbell, A. L. Oberg, and D. A. Ahlquist
Highly Methylated Genes in Colorectal Neoplasia: Implications for Screening
Cancer Epidemiol. Biomarkers Prev.,
December 1, 2007;
16(12):
2686 - 2696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. M. Brena and J. F. Costello
Genome-epigenome interactions in cancer
Hum. Mol. Genet.,
April 15, 2007;
16(R1):
R96 - R105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Model, N. Osborn, D. Ahlquist, R. Gruetzmann, B. Molnar, F. Sipos, O. Galamb, C. Pilarsky, H.-D. Saeger, Z. Tulassay, et al.
Identification and Validation of Colorectal Neoplasia-Specific Methylation Markers for Accurate Classification of Disease
Mol. Cancer Res.,
February 1, 2007;
5(2):
153 - 163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Wallner, A. Herbst, A. Behrens, A. Crispin, P. Stieber, B. Goke, R. Lamerz, and F. T. Kolligs
Methylation of Serum DNA Is an Independent Prognostic Marker in Colorectal Cancer
Clin. Cancer Res.,
December 15, 2006;
12(24):
7347 - 7352.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-Y. Zhao, D. Schneider, S. L. Biroc, R. Parry, B. Alicke, P. Toy, J.-A. Xuan, C. Sakamoto, K. Wada, M. Schulze, et al.
Targeting Tomoregulin for Radioimmunotherapy of Prostate Cancer
Cancer Res.,
April 1, 2005;
65(7):
2846 - 2853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. G. Friedrich, D. J. Weisenberger, J. C. Cheng, S. Chandrasoma, K. D. Siegmund, M. L. Gonzalgo, M. I. Toma, H. Huland, C. Yoo, Y. C. Tsai, et al.
Detection of Methylated Apoptosis-Associated Genes in Urine Sediments of Bladder Cancer Patients
Clin. Cancer Res.,
November 15, 2004;
10(22):
7457 - 7465.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. E.H. Afar, V. Bhaskar, E. Ibsen, D. Breinberg, S. M. Henshall, J. G. Kench, M. Drobnjak, R. Powers, M. Wong, F. Evangelista, et al.
Preclinical validation of anti-TMEFF2-auristatin E-conjugated antibodies in the treatment of prostate cancer
Mol. Cancer Ther.,
August 1, 2004;
3(8):
921 - 932.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. M. Luger, P. Honore, M. A. C. Sabino, M. J. Schwei, S. D. Rogers, D. B. Mach, D. R. Clohisy, and P. W. Mantyh
Osteoprotegerin Diminishes Advanced Bone Cancer Pain
Cancer Res.,
May 1, 2001;
61(10):
4038 - 4047.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. F Costello and C. Plass
Methylation matters
J. Med. Genet.,
May 1, 2001;
38(5):
285 - 303.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman
A Gene Hypermethylation Profile of Human Cancer
Cancer Res.,
April 1, 2001;
61(8):
3225 - 3229.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Young, K. G. Biden, L. A. Simms, P. Huggard, R. Karamatic, H. J. Eyre, G. R. Sutherland, N. Herath, M. Barker, G. J. Anderson, et al.
HPP1: A transmembrane protein-encoding gene commonly methylated in colorectal polyps and cancers
PNAS,
January 2, 2001;
98(1):
265 - 270.
[Abstract]
[Full Text]
[PDF]
|
 |
|