Cancer Research Prevention Award  Frontiers in Basic Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, G.
Right arrow Articles by Jones, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, G.
Right arrow Articles by Jones, P. A.
[Cancer Research 60, 4907-4912, September 1, 2000]
© 2000 American Association for Cancer Research


Molecular Biology and Genetics

The Gene for a Novel Transmembrane Protein Containing Epidermal Growth Factor and Follistatin Domains Is Frequently Hypermethylated in Human Tumor Cells1

Gangning Liang2, Keith D. Robertson, Cathy Talmadge, Janos Sumegi and Peter A. Jones

Urologic Cancer Research Laboratory, Department of Biochemistry and Molecular Biology, University of Southern California/Norris Comprehensive Cancer Center, University of Southern California, School of Medicine, Los Angeles, California 90033 [G. L., K. D. R., P. A. J.], and University of Nebraska Medical Center, Department of Pathology, Omaha, Nebraska 68198 [C. T., J. S.]


    ABSTRACT
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A DNA fragment frequently hypermethylated in tumor cells was isolated using a novel screening strategy termed methylation-sensitive arbitrarily primed PCR. The isolated sequence corresponded to a CpG island at the 5' end of a previously unknown gene, TPEF (transmembrane protein containing epidermal growth factor and follistatin domains). Expression of TPEF was observed using Northern master blot analysis of a variety of normal tissues including colon, bladder, and prostate tissue. TPEF maps to human chromosome 2q33, where frequent loss of heterozygosity is seen in various human tumors, and TPEF was not expressed in most human colon and various other tumor cell lines examined by reverse transcription-PCR. Nine of 11 tumor cell lines were highly methylated in the 5' region and the first exon of the gene that demonstrated features characteristic of a CpG island. However the other two cell lines, which expressed TPEF, were hypomethylated in the 5' end of the gene. The region was also hypermethylated in 11 of 16 primary bladder tumors and in 3 of 4 primary colon tumors when compared with adjacent normal tissue. Our results suggest that potential tumor suppressor genes can be isolated from human tumors by virtue of their altered methylation patterns.


    INTRODUCTION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Changes in DNA methylation are often seen in tumor cells (1, 2, 3) . Many of these changes occur at CpG dinucleotides clustered in regions of about 1 kb, called CpG islands, in or near the promoter and first exon regions of genes (4) . CpG islands are commonly associated with genes and may regulate their transcription when located in promoter regions. Hypermethylation of CpG islands in the promoter regions of X-linked (5) and imprinted genes (6) is associated with loss of transcription. Many studies have indicated a correlation between CpG island methylation and tumorigenesis through the inactivation of tumor suppressor genes and other genes that contribute to tumorigenesis (7, 8, 9, 10, 11, 12, 13, 14, 15, 16) . The ability to detect methylation changes associated with oncogenic transformation is of critical importance in understanding how DNA methylation may contribute to tumorigenesis. We, and others, have developed a simple and reproducible fingerprinting method called Ms AP-PCR3 for screening the genome for regions of DNA that have altered patterns of DNA methylation (17, 18, 19, 20, 21) .

By using Ms AP-PCR, a hypermethylated DNA fragment (18 , 22) , which was described as band 5 in Ref. 18 , was isolated from a human colon tumor cell line and sequenced. The fragment, which was found to fulfill the criteria for a CpG island (23) , matched a portion of a human cDNA clone characterized as an EST in GenBank, and further investigation of this unknown gene (TPEF) revealed that it encodes a transmembrane protein containing EGF and follistatin domains. The gene maps to chromosome 2q33, where frequent loss of heterozygosity is detected in various tumors (24, 25, 26, 27, 28, 29, 30) . High-level expression in brain and prostate and low-level expression in a variety of other normal tissues were found by Northern master blot. To better understand the potential role for DNA methylation in the regulation of TPEF, we also cloned and sequenced the 5' region of the gene and examined its methylation status by Ms-SNuPE (31) . TPEF was found to be hypermethylated in 9 of 11 tumor cell lines and in 14 of 20 primary bladder and colon tumors when compared with adjacent normal tissues. The results in tumor cell lines also indicated that expression of TPEF could be silenced by DNA methylation, suggesting that epigenetic silencing of TPEF might have a role in carcinogenesis.


    MATERIALS AND METHODS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Sequencing the 5' End of the TPEF Gene.
The hypermethylated fragment was isolated by the Ms AP-PCR approach and used as a probe to screen a {lambda} genomic library (human placenta) according to the instructions of the manufacturer (Stratagene). A single phage clone was isolated, and a 12-kb insert was characterized by restriction enzyme analysis. Using a primer located in the hypermethylated fragment and walking through the 5' region of TPEF, about 2.5 kb of the insert was sequenced. A detailed description of this region is shown in Fig. 1Citation .



View larger version (10K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. The 5' region of TPEF (GenBank accession number AF242221). Each tick mark represents a CpG site, and each arrow represents a CpG site whose methylation status was determined by Ms-SNuPE. The light gray box represents a possible promoter region. Stars represent Sp1 consensus.

 
EST Clone.
The sequence of the hypermethylated fragment matched several EST clones using the BLAST network service provided by the National Center for Biotechnology Information. We ordered one IMAGE Consortium cDNA clone (GenBank accession number H05869), which contained the longest insert, from the United Kingdom Human Genome Mapping Project Resource Center. By using this EST cDNA clone, a 1.8-kb partial-length sequence was obtained.

Determination of the 5' End of the TPEF Transcript by 5' RACE.
First-strand cDNA was synthesized from total SK-Mel-28 RNA using the GSP1 (CAAACGGCTTCCGAGGAACACAG) and Superscript II reverse transcriptase (Life Technologies, Inc.). After the first-strand cDNA synthesis, the mRNA template was digested with RNase, and the unincorporated deoxynucleotide triphosphates, GSP1, and proteins were removed. A homopolymeric tail was added to the 3' end of the purified cDNA using terminal deoxynucleotidyl transferase (Life Technologies, Inc.) and dCTP. The tailed cDNA was first amplified by PCR using GSP2 (CATCTCGAGAGTTTCAGCAACATCC), which anneals upstream of GSP1, and an abridged anchor primer (GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG; Life Technologies, Inc.). The first-round PCR product was used as template for the second round of PCR amplification using GSP3 (GAAGCTGCTGCCATAAGGAGGGA) and an abridged universal amplification primer (GGCCACGCGTCGACTAGTAC; Life Technologies, Inc.). The conditions for the PCR were 95°C for 2 min and 35 cycles of 95°C for 1 min, 55°C to 62°C for 45 s, and 72°C for 90 s, followed by elongation at 72°C for 8 min. The PCR product was excised from the gel and sequenced directly.

Chromosomal Mapping.
Fluorescence in situ hybridization was carried out on normal female lymphocyte chromosome spreads as described previously (32) . The probe for TPEF, which was derived from the phage clone that contained the 5' region of TPEF, was labeled with biotin, hybridized to chromosome spreads, r-banded, and then detected with fluorescein-avidin.

Northern Master Blot Analysis.
Northern master blots (Clontech Laboratories, Inc.) containing mRNA from 50 different human tissues were used. The probe was labeled with the Random-Prime DNA Label Kit (Boehringer Mannheim) and hybridized at 65°C in ExpressHyb hybridization buffer (Clontech Laboratories, Inc.) according to the manufacturer’s instructions. The cDNA probe was derived from the EST plasmid containing the partial-length TPEF cDNA (GenBank accession number H05869).

DNA Isolation from Tissues and Cell Lines.
Matched pairs of normal and tumor specimens were obtained from the colon and bladder of patients treated at the Los Angeles County, University of Southern California Medical Center and the University of Southern California/Norris Comprehensive Cancer Center (Los Angeles, CA). Mucosal tissues were first removed from the surrounding muscle and fat. Seven colon cancer cell lines (SW837, SW480, HT-29, LoVo, SW48, HCT116, and HCT15), two prostate cancer cell lines (LNCaP and DU145), one bladder tumor cell line (3576), and one melanoma cell line (SK-Mel-28) were obtained from American Type Culture Collection and grown in the recommended medium. DNA was isolated using standard procedures by treatment with proteinase K and phenol extraction (33) .

Quantitation of DNA Methylation by Ms-SNuPE.
We have developed a rapid quantitative method called Ms-SNuPE for assessing methylation differences at specific CpG sites (31) . Briefly, genomic DNA was first reacted with 5 M sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence was performed using PCR primers (sense primer, AATTAGTTATGGTGTTGTGG; antisense primer, CTAAAATAAACTAATCTATACTAAATAC) specific for bisulfite-converted DNA. The PCR products were then isolated and used as a template for methylation analysis at three CpG sites by three specific Ms-SNuPE primers (primer 1, TAGTGTAGTAGTTGGATATTTTG; primer 2, GTTGGTTGTTGTTGTTGTT; and primer 3, AATTGTTTTGGTAAGTTTAGAATTTT). PCR conditions were 95°C for 2 min and 40 cycles of 95°C for 1 min, 51°C for 30 s, and 72°C for 1 min, followed by 72°C for 4 min. Ms-SNuPE conditions were one cycle primer extension of 95°C for 1 min, 51°C for 2 min, and 72°C for 1 min. The final products were then resolved on a 15% polyacrylamide gel. Results were quantitated with a Molecular Dynamics PhosphorImager. The percentage methylation of each sample is the average of the three CpG sites examined by Ms-SNuPE.

Bisulfite Genomic Sequencing.
The PCR products from Ms-SNuPE were ligated into pCRII cloning vector (Invitrogen, San Diego, CA). Individual plasmid molecules were then sequenced by automated DNA sequencer at University of Southern California microchemical facility.

RT-PCR.
Total (2 µg) RNA from tumor cell lines was converted into cDNA by using 0.5 absorbance unit of random hexamers, 1 mM each deoxynucleotide triphosphate (Boehringer Mannheim), 10 units of Superscript II reverse transcriptase (Life Technologies, Inc.), 1 unit of RNasin (Promega), 0.01 M DTT, 75 µg of BSA, and 1x cDNA first-strand buffer in a 50 µl total volume. The mixture was then placed at room temperature for 10 min, 42°C for 45 min, and 90°C for 3 min and then rapidly cooled to 4°C. PCR was performed with 100 ng of cDNA. The primers used were as follows: (a) TPEF-sense, TTGACTCTCCCTCCACCCTG; and (b) TPEF-antisense, AGACGCAAGTCACAGTGTCTC. The PCR conditions were 95°C for 2 min and 35 cycles of 95°C for 1 min, 56°C for 30 s, and 72°C for 90 s, followed by 72°C for 4 min.


    RESULTS
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A Hypermethylated Fragment Located at the 5' Region of TPEF.
The hypermethylated DNA fragment isolated by Ms AP-PCR (18) fulfilled the criteria for a CpG island with a GC content greater than 0.5 and an observed:expected CpG ratio greater than 0.6 (23) . The fragment matched the 5' region of a human cDNA clone characterized as an EST, suggesting that the CpG island might be located at the 5' end or promoter region of the unknown gene (TPEF). The transcription initiation site of this unknown gene was determined by 5' RACE using GSPs (see "Materials and Methods") in the SK-Mel-28 tumor cell line. Sequencing of the 5' RACE-generated transcript showed that a putative transcription initiation site was just 12 bp upstream of the 5' end of the EST sequence (Fig. 1)Citation . To better understand the role of methylation in regulation of TPEF, we also cloned and sequenced the putative promoter region of TPEF. The sequence of a clone containing exon 1 indicated that the promoter of TPEF was TATA-less and was a CpG island (Fig. 1)Citation . The most CpG-rich region from -1100 to +750 (Fig. 1)Citation had a GC content of 0.64 and an observed:expected CpG ratio of 0.76. A potential promoter region (-650 to +1 bp; Fig. 1Citation ) was predicted using the computer program NNPP and TSSG available through the Baylor College of Medicine.4 It is important to note that were 10 potential Sp1 binding sites within this region that are common in TATA-less promoters such as this.

TPEF Encodes a Transmembrane Protein Containing EGF and Follistatin Domains.
BLAST searches with the DNA sequence of the hypermethylated fragment identified several EST clones containing sequences that were almost identical to the EST clone with the longest insert. Combining the sequence with the results from 5' RACE showed that the cDNA sequence of TPEF is 1836 bp and defines a single 1124-nucleotide open reading frame encoding 374 amino acids with a predicted molecular weight of 41,432. The putative translation initiation site begins with an ATG conforming to Kozak’s rules (34 , 35) . The 3' untranslated region includes a destabilizing ATTTA motif and two potential polyadenylation signals (AATAAA) followed by a polyadenylic acid stretch (36) . The protein also contains a predicted signal peptide and transmembrane region (Fig. 2)Citation .



View larger version (67K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, nucleotide and deduced amino acid sequence of TPEF (GenBank accession number AF242222). The destabilizing ATTTA motif is double underlined, and the potential polyadenylation signal AATAAA is underlined. B, direction of hydrophobic moment (48) of the deduced TPEF protein. SP, signal peptide; TM, transmembrane region.

 
BLAST searches of GenBank databases using the predicted protein revealed significant homology with two known proteins: (a) a novel transmembrane protein of Xenopus laevis with EGF and follistatin domains (37) ; and (b) a human protein (GenBank accession number U19878). The overall levels of identity and similarity between TPEF and the transmembrane protein (X. laevis and human) are 49–53% and 72–73%, respectively. The database searches also indicated that TPEF contained two follistatin domains and an EGF domain similar to the transmembrane proteins in X. laevis and human (Fig. 3)Citation .



View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Comparison of the TPEF protein with human and X. laevis transmembrane proteins. Boxed residues are those identical to TPEF at a given position. TP, transmembrane protein. {blacksquare}, follistatin-like domains; {square}, the EGF-like domain. The outline in black in the protein sequences indicates transmembrane regions. Amino acids highlighted in grayrepresent homology of the amino acids; amino acids highlighted in black represent homology of cysteine.

 
Expression Pattern and Chromosomal Location of the TPEF Gene.
Screening of a human Northern master blot containing RNAs from 50 different tissues revealed detectable expression of TPEF mRNA transcripts in most tissues when compared to control with the most abundant expression in brain and prostate (Fig. 4)Citation . Northern blot analysis revealed a similar result (data not shown).



View larger version (34K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 4. A human Northern master blot (Clontech Laboratories, Inc.). TPEF is highly expressed in brain and prostate and has a lower level of expression in a variety of other tissues.

 
A phage genomic clone that contained the 5' end of TPEF was used to map the chromosome location of the gene by fluorescence in situ hybridization. The human TPEF gene maps to chromosome 2q33.

The 5' Region of TPEF Is Hypermethylated and Silenced by Methylation in Tumor Cells.
We next examined the levels of methylation in the 5' region of TPEF, where the hypermethylated fragment identified by Ms AP-PCR was located (Fig. 1)Citation . Our previous results from Ms AP-PCR had already indicated that most colon and bladder tumors were hypermethylated in that region (18 , 22) . Analysis of the methylation level in the 5' region of TPEF by the quantitative Ms-SNuPE assay showed that the 5' region of TPEF was heavily methylated in 9 of 11 tumor cell lines (Fig. 5)Citation . The tumor cell lines with high levels of methylation in the 5' region showed no detectable mRNA expression by RT-PCR (Fig. 5)Citation . On the other hand, the tumor cell lines that had low levels of methylation showed expression of TPEF (Fig. 5)Citation . The fragment isolated by Ms AP-PCR is located near the 3' end of the CpG island. Methylation in this region may reflect either methylation throughout the entire CpG island or a localized event. To distinguish between these possibilities, Southern blot analysis was performed by using a probe from -1000 to +1 related to the transcription start site (Fig. 1)Citation to check the methylation status of the 5' end of the CpG island in four colon tumor cell lines. The results indicated hypermethylation at the 5' end of the CpG island consistent with the Ms-SNuPE analysis of the 3' end of the CpG island (data not shown).



View larger version (45K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 5. Methylation and expression of TPEF in tumor cell lines. The methylation status at the 5' region of TPEF was analyzed by the Ms-SNuPE assay. Expression of TPEF was checked by RT-PCR. HCT15, LoVo, HCT116, SW48, SW480, SW837, and HT-29 are human colon tumor cell lines. 3657 is a human bladder tumor cell line. SK-Mel-28 is a human melanoma cell line. LNCaP and DU145 are human prostate tumor cell lines.

 
We also examined the levels of methylation in the 5' region of TPEF in uncultured tumors and adjacent normal tissues obtained from the same patients. Eleven of 16 bladder tumors were hypermethylated at the 5' region when compared with available adjacent normal tissues (assuming a value 10% or lower as a baseline; Fig. 6Citation ). Three of four colon tumors were hypermethylated at the 5' region compared with adjacent normal tissues (Fig. 6)Citation . One bladder tumor sample (B3) had increased methylation in both the tumor and adjacent normal tissue (Fig. 6)Citation . Bisulfite sequencing on samples from patient B15 showed patch methylation of some TPEF alleles in the normal tissues and a much increased level of methylation in the tumors (Fig. 7)Citation . Thus, the methylation changes may be initiated in premalignant tissues and become reinforced during tumorigenesis. The extensive level of methylation of individual TPEF alleles in the tumors suggested that this might be sufficient to induce transcriptional inactivation of the gene by comparison with the data for cell lines (Fig. 5)Citation . In summary, these data show that 14 of the 20 (70%) tumor tissues examined were hypermethylated at the TPEF locus.



View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 6. Methylation status of the 5' end region of TPEF in primary tumors and adjacent normal tissues of 16 patients with bladder cancer (B1-B16) and 4 patients with colon cancer (C1-C4). Methylation status of the 5' end of the TPEF gene was analyzed by the Ms-SNuPE assay.

 


View larger version (27K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 7. Genomic sequencing data of the 5' region of TPEF in adjacent normal tissue (B15 N) and tumor tissue (B15 T) of patient B15. Methylation status of CpG dinucleotides: {circ}, unmethylated; •, methylated. Horizontal rows of circles indicate individual plasmid molecules that were sequenced after PCR amplification and cloning of bisulfite-treated DNA. The region amplified by PCR is from +384 to +645. Tick marks are the positions of CpG sites, and arrows represent the CpG sites whose methylation status was determined by the Ms-SNuPE assay as shown in Fig. 6Citation .

 

    DISCUSSION
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The role of DNA methylation in cancer has largely been studied by analysis of known tumor suppressor genes. We have developed a genome scanning method, Ms AP-PCR, to survey global methylation pattern changes in tumors to identify CpG islands associated with genes that become abnormally methylated in cancer (18 , 22) . Using genomic scanning approaches, we and others have identified novel genes as hypermethylated fragments in tumor cells (17, 18, 19, 20 , 38) .

The 5' region of TPEF is a typical CpG island. The fragment isolated by Ms AP-PCR is located near the 3' end of the CpG island; however, its methylation status likely reflects the methylation status of the entire CpG island because most studies have indicated that aberrant methylation can spread across a CpG island (1 , 16 , 39, 40, 41) . Our results have shown that the methylation patterns at the 5' end of the CpG island are consistent with the 3' end of the CpG island. The CpG island in TPEF is densely methylated in most tumor cell lines, and the methylation correlates with TPEF silencing in tumor cell lines. Seventy percent of the primary tumors had a hypermethylated CpG island, and increased methylation of the CpG island was also observed in one adjacent normal tissue, possibly due to premalignant or age-related methylation changes (42) .

TPEF may be inactivated not only by methylation but also by chromosome deletion because it is located on chromosome 2q33, where a high frequency of loss is generally associated with esophageal squamous cell carcinoma and is less frequently associated with lung, colon, bladder, prostate, and breast cancers (24, 25, 26, 27, 28, 29) . Homozygous deletion at 2q33 is commonly seen in small cell lung carcinoma (30) .

The sequence analysis indicated that TPEF encodes a transmembrane protein containing two follistatin domains and one EGF domain (37) . Follistatin is able to bind and neutralize the actions of activin and many members of the transforming growth factor ß family (43) . TPEF, which contains two follistatin domains, might therefore bind growth factors such as activin and transforming growth factor ß and inhibit their action.

TPEF, like many growth factors, receptors, and adhesion molecules, contains EGF domains defined as CX7CX4–5CX10–13CXCX8GXRC (X is a amino acid other than C, G, or R) that can participate in protein-protein or protein-cell interactions (44, 45, 46) . When arginine (R) is mutated to histidine (H) in the EGF domain of human EGF, the EGF loses most of its affinity for the EGF receptor (47) . The absence of the corresponding arginine in the EGF domain of TPEF instead of histidine indicates that TPEF may play a role as a ligand, and EGF receptor inactivation is probably the function of this domain.

The structural analysis of the follistatin and EGF domains suggests that TPEF might act as an inhibitor of growth factors. More detailed studies need to be undertaken to better understand the potential function of TPEF in cancer; however, our results suggest that potential tumor suppressor genes can be isolated from human tumors by virtue of their altered methylation patterns.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by USPHS Grant 1 RO1 CA82422-01 (to P. A. J.) from the National Cancer Institute and by the American Foundation for Urologic Disease. Back

2 To whom requests for reprints should be addressed, at Urologic Cancer Research Laboratory, Department of Biochemistry and Molecular Biology, University of Southern California/Norris Comprehensive Cancer Center, MS 83, 1441 Eastlake Avenue, University of Southern California, School of Medicine, Los Angeles, CA 90033. Phone: (323) 865-0741; Fax: (323) 865-0102; E-Mail: gliang{at}hsc.usc.edu Back

3 The abbreviations used are: Ms AP-PCR, methylation-sensitive arbitrarily primed PCR; Ms-SNuPE, methylation-sensitive single nucleotide primer extension; RT-PCR, reverse transcription-PCR; EST, expressed sequence tag; EGF, epidermal growth factor; RACE, rapid amplification of cDNA ends; GSP, gene-specific primer. Back

4 launcher@http:11.imgen.bcm.tmc.edu:9331. Back

Received 10/28/99. Accepted 6/30/00.


    REFERENCES
 Top
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat Genet., 21: 163-167, 1999.[Medline]
  2. Jones P. A. DNA methylation errors and cancer. Cancer Res., 56: 2463-2467, 1996.[Free Full Text]
  3. Baylin S. B., Makos M., Wu J. J., Yen R. W., de Bustros A., Vertino P., Nelkin B. D. Abnormal patterns of DNA methylation in human neoplasia: potential consequences for tumor progression. Cancer Cells (Cold Spring Harbor), 3: 383-390, 1991.[Medline]
  4. Laird P. W., Jaenisch R. DNA methylation and cancer. Hum. Mol. Genet., 3: 1487-1495, 1994.[Abstract]
  5. Adam, R. L. R., and Burdon, R. H. Molecular Biology of DNA Methylation. New York: Springer-Verlag, 1985.
  6. Riggs A. D., Pfeifer G. P. X-chromosome inactivation and cell memory. Trends Genet., 8: 169-174, 1992.[Medline]
  7. Sakai T., Toguchida J., Ohtani N., Yandell D. W., Rapaport J. M., Dryja T. P. Allele-specific hypermethylation of the retinoblastoma tumor-suppressor gene. Am. J. Hum. Genet., 48: 880-888, 1991.[Medline]
  8. Zion M., Ben-Yehuda D., Avraham A., Cohen O., Wetzler M., Melloul D., Ben-Neriah Y. Progressive de novo DNA methylation at the bcr-abl locus in the course of chronic myelogenous leukemia. Proc. Natl. Acad. Sci. USA, 91: 10722-10726, 1994.[Abstract/Free Full Text]
  9. Herman J. G., Latif F., Weng Y., Lerman M. I., Zbar B., Liu S., Samid D., Duan D. S., Gnarra J. R., Linehan W. M., Baylin S. B. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma. Proc. Natl. Acad. Sci. USA, 91: 9700-9704, 1994.[Abstract/Free Full Text]
  10. Issa J. P., Zehnbauer B. A., Civin C. I., Collector M. I., Sharkis S. J., Davidson N. E., Kaufmann S. H., Baylin S. B. The estrogen receptor CpG island is methylated in most hematopoietic neoplasms. Cancer Res., 56: 973-977, 1996.[Abstract/Free Full Text]
  11. Graff J. R., Herman J. G., Lapidus R. G., Chopra H., Xu R., Jarrard D. F., Isaacs W. B., Pitha P. M., Davidson N. E., Baylin S. B. E-cadherin expression is silenced by DNA hypermethylation in human breast and prostate carcinomas. Cancer Res., 55: 5195-5199, 1995.[Abstract/Free Full Text]
  12. Gonzalez-Zulueta M., Bender C. M., Yang A. S., Nguyen T., Beart R. W., Van Tornout J. M., Jones P. A. Methylation of the 5' CpG island of the p16/CDKN2 tumor suppressor gene in normal and transformed human tissues correlates with gene silencing. Cancer Res., 55: 4531-4535, 1995.[Abstract/Free Full Text]
  13. Katzenellenbogen R. A., Baylin S. B., Herman J. G. Hypermethylation of the DAP-kinase CpG island is a common alteration in B-cell malignancies. Blood, 93: 4347-4353, 1999.[Abstract/Free Full Text]
  14. Tanaka H., Shimada Y., Harada H., Shinoda M., Hatooka S., Imamura M., Ishizaki K. Methylation of the 5' CpG island of the FHIT gene is closely associated with transcriptional inactivation in esophageal squamous cell carcinomas. Cancer Res., 58: 3429-3434, 1998.[Abstract/Free Full Text]
  15. Esteller M., Hamilton S. R., Burger P. C., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res., 59: 793-797, 1999.[Abstract/Free Full Text]
  16. Bachman K. E., Herman J. G., Corn P. G., Merlo A., Costello J. F., Cavenee W. K., Baylin S. B., Graff J. R. Methylation-associated silencing of the tissue inhibitor of metalloproteinase-3 gene suggests a suppressor role in kidney, brain, and other human cancers. Cancer Res., 59: 798-802, 1999.[Abstract/Free Full Text]
  17. Gonzalgo M. L., Liang G., Spruck C. H., III, Zingg J. M., Rideout W. M., III, Jones P. A. Identification and characterization of differentially methylated regions of genomic DNA by methylation-sensitive arbitrarily primed PCR. Cancer Res., 57: 594-599, 1997.[Abstract/Free Full Text]
  18. Liang G., Salem C. E., Yu M. C., Nguyen H. D., Gonzales F. A., Nguyen T. T., Nichols P. W., Jones P. A. DNA methylation differences associated with tumor tissues identified by genome scanning analysis. Genomics, 53: 260-268, 1998.[Medline]
  19. Huang T. H., Laux D. E., Hamlin B. C., Tran P., Tran H., Lubahn D. B. Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique. Cancer Res., 57: 1030-1034, 1997.[Abstract/Free Full Text]
  20. Kohno T., Kawanishi M., Inazawa J., Yokota J. Identification of CpG islands hypermethylated in human lung cancer by the arbitrarily primed-PCR method. Hum. Genet., 102: 258-264, 1998.[Medline]
  21. Salme C. E., Markl I. D., Bender C. M., Gonzales F. A., Jones P. A., Liang G. PAX6 methylation and ectopic expression in human tumor cells. Int. J. Cancer, 87: 179-185, 2000.[Medline]
  22. Salme C. E., Liang G., Tsai Y. C., Coulter J., Knowles M. A., Feng A-C., Groshen S., Nichols P. W., Jones P. A. Progressive increases in de novo methylation of CpG islands in bladder cancer. Cancer Res., 60: 2473-2476, 2000.[Abstract/Free Full Text]
  23. Cardiner-Garden M., Formmer M. CpG island in vertebrate genome. J. Mol. Biol., 196: 261-282, 1987.[Medline]
  24. Pack S. D., Karkera J. D., Zhuang Z., Pak E. D., Balan K. V., Hwu P., Park W. S., Pham T., Ault D. O., Glaser M., Liotta L., Detera-Wadleigh S. D., Wadleigh R. G. Molecular cytogenetic fingerprinting of esophageal squamous cell carcinoma by comparative genomic hybridization reveals a consistent pattern of chromosomal alterations. Genes Chromosomes Cancer, 25: 160-168, 1999.[Medline]
  25. Ransom D. T., Barnett T. C., Bot J., de Boer B., Metcalf C., Davidson J. A., Turbett G. R. Loss of heterozygosity on chromosome 2q: possibly a poor prognostic factor in head and neck cancer. Head Neck, 20: 404-410, 1998.[Medline]
  26. Brothman A. R. Cytogenetic studies in prostate cancer: are we making progress?. Cancer Genet. Cytogenet., 95: 116-121, 1997.[Medline]
  27. Jiricny J. Mismatch repair and cancer. Cancer Surv., 28: 47-68, 1996.[Medline]
  28. Simon R., Burger H., Brinkschmidt C., Bocker W., Hertle L., Terpe H. J. Chromosomal aberrations associated with invasion in papillary superficial bladder cancer. J. Pathol., 185: 345-351, 1998.[Medline]
  29. Huiping C., Johannsdottir J. T., Arason A., Olafsdottir G. H., Eiriksdottir G., Egilsson V., Ingvarsson S. Replication error in human breast cancer: comparison with clinical variables and family history of cancer. Oncol. Rep., 6: 117-122, 1999.[Medline]
  30. Kohno T., Otsuka T., Inazawa J., Abe T., Yokota J. Breakpoint junction of interstitial homozygous deletion at chromosome 2q33 in a small cell lung carcinoma. DNA Res., 3: 421-424, 1996.[Abstract]
  31. Gonzalgo M. L., Jones P. A. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res., 25: 2529-2531, 1997.[Abstract/Free Full Text]
  32. Lanyi A., Li B., Li S., Talmadge C. B., Brichacek B., Davis J. R., Kozel B. A., Trask B., van den Engh G., Uzvolgyi E., Stanbridge E. J., Nelson D. L., Chinault C., Heslop H., Gross T. G., Seemayer T. A., Klein G., Purtilo D. T., Sumegi J. A yeast artificial chromosome (YAC) contig encompassing the critical region of the X-linked lymphoproliferative disease (XLP) locus. Genomics, 39: 55-65, 1997.[Medline]
  33. Michalowsky L. A., Jones P. A. Gene structure and transcription in mouse cells with extensively demethylated DNA. Mol. Cell. Biol., 9: 885-892, 1989.[Abstract/Free Full Text]
  34. Kozak M. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res., 15: 8125-8148, 1987.[Abstract/Free Full Text]
  35. Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem., 266: 19867-19870, 1991.[Free Full Text]
  36. Shaw G., Kamen R. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell, 46: 659-667, 1986.[Medline]
  37. Eib D. W., Martens G. J. A novel transmembrane protein with epidermal growth factor and follistatin domains expressed in the hypothalamo-hypophysial axis of Xenopus laevis. J. Neurochem., 67: 1047-1055, 1996.[Medline]
  38. Toyota M., Ho C., Ohe-Toyota M., Baylin S. B., Issa J. P. Inactivation of CACNA1G, a T-type calcium channel gene, by aberrant methylation of its 5' CpG island in human tumors. Cancer Res., 59: 4535-4541, 1999.[Abstract/Free Full Text]
  39. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  40. Stirzaker C., Millar D. S., Paul C. L., Warnecke P. M., Harrison J., Vincent P. C., Frommer M., Clark S. J. Extensive DNA methylation spanning the Rb promoter in retinoblastoma tumors. Cancer Res., 57: 2229-2237, 1997.[Abstract/Free Full Text]
  41. Smiraglia D. J., Fruhwald M. C., Costello J. F., McCormick S. P., Dai Z., Peltomaki P., O’Dorisio M. S., Cavenee W. K., Plass C. A new tool for the rapid cloning of amplified and hypermethylated human DNA sequences from restriction landmark genome scanning gels. Genomics, 58: 254-262, 1999.[Medline]
  42. Toyota M., Ho C., Ahuja N., Jair K. W., Li Q., Ohe-Toyota M., Baylin S. B., Issa J. P. Identification of differentially methylated sequences in colorectal cancer by methylated CpG island amplification. Cancer Res., 59: 2307-2312, 1999.[Abstract/Free Full Text]
  43. Patel K. Follistatin. Int. J. Biochem. Cell Biol., 30: 1087-1093, 1998.[Medline]
  44. Wahl M. I., Nishibe S., Kim J. W., Kim H., Rhee S. G., Carpenter G. Identification of two epidermal growth factor-sensitive tyrosine phosphorylation sites of phospholipase C-{gamma} in intact HSC-1 cells. J. Biol. Chem., 265: 3944-3948, 1990.[Abstract/Free Full Text]
  45. Campbell C. D., Bork P. Epidermal growth factor-like modules. Curr. Opin. Struct. Biol., 3: 385-392, 1993.
  46. Appella E., Weber I. T., Blasi F. Structure and function of epidermal growth factor-like regions in proteins. FEBS Lett., 231: 1-4, 1988.[Medline]
  47. Engler D. A., Montelione G. T., Niyogi S. K. Human epidermal growth factor. Distinct roles of tyrosine 37 and arginine 41 in receptor binding as determined by site-directed mutagenesis and nuclear magnetic resonance spectroscopy. FEBS Lett., 271: 47-50, 1990.[Medline]
  48. Eisenberg D., Wilcox W., McLachlan A. D. Hydrophobicity and amphiphilicity in protein structure. J. Cell. Biochem., 31: 11-17, 1986.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Chen, M. Sinha, B. A. Luxon, A. R. Bresnick, and K. L. O'Connor
Integrin {alpha}6{beta}4 Controls the Expression of Genes Associated with Cell Motility, Invasion, and Metastasis, Including S100A4/Metastasin
J. Biol. Chem., January 16, 2009; 284(3): 1484 - 1494.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Ali and V. Knauper
Phorbol Ester-induced Shedding of the Prostate Cancer Marker Transmembrane Protein with Epidermal Growth Factor and Two Follistatin Motifs 2 Is Mediated by the Disintegrin and Metalloproteinase-17
J. Biol. Chem., December 28, 2007; 282(52): 37378 - 37388.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
H. Zou, J. J. Harrington, A. M. Shire, R. L. Rego, L. Wang, M. E. Campbell, A. L. Oberg, and D. A. Ahlquist
Highly Methylated Genes in Colorectal Neoplasia: Implications for Screening
Cancer Epidemiol. Biomarkers Prev., December 1, 2007; 16(12): 2686 - 2696.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
R. M. Brena and J. F. Costello
Genome-epigenome interactions in cancer
Hum. Mol. Genet., April 15, 2007; 16(R1): R96 - R105.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
F. Model, N. Osborn, D. Ahlquist, R. Gruetzmann, B. Molnar, F. Sipos, O. Galamb, C. Pilarsky, H.-D. Saeger, Z. Tulassay, et al.
Identification and Validation of Colorectal Neoplasia-Specific Methylation Markers for Accurate Classification of Disease
Mol. Cancer Res., February 1, 2007; 5(2): 153 - 163.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Wallner, A. Herbst, A. Behrens, A. Crispin, P. Stieber, B. Goke, R. Lamerz, and F. T. Kolligs
Methylation of Serum DNA Is an Independent Prognostic Marker in Colorectal Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7347 - 7352.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
X.-Y. Zhao, D. Schneider, S. L. Biroc, R. Parry, B. Alicke, P. Toy, J.-A. Xuan, C. Sakamoto, K. Wada, M. Schulze, et al.
Targeting Tomoregulin for Radioimmunotherapy of Prostate Cancer
Cancer Res., April 1, 2005; 65(7): 2846 - 2853.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. G. Friedrich, D. J. Weisenberger, J. C. Cheng, S. Chandrasoma, K. D. Siegmund, M. L. Gonzalgo, M. I. Toma, H. Huland, C. Yoo, Y. C. Tsai, et al.
Detection of Methylated Apoptosis-Associated Genes in Urine Sediments of Bladder Cancer Patients
Clin. Cancer Res., November 15, 2004; 10(22): 7457 - 7465.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
D. E.H. Afar, V. Bhaskar, E. Ibsen, D. Breinberg, S. M. Henshall, J. G. Kench, M. Drobnjak, R. Powers, M. Wong, F. Evangelista, et al.
Preclinical validation of anti-TMEFF2-auristatin E-conjugated antibodies in the treatment of prostate cancer
Mol. Cancer Ther., August 1, 2004; 3(8): 921 - 932.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. M. Luger, P. Honore, M. A. C. Sabino, M. J. Schwei, S. D. Rogers, D. B. Mach, D. R. Clohisy, and P. W. Mantyh
Osteoprotegerin Diminishes Advanced Bone Cancer Pain
Cancer Res., May 1, 2001; 61(10): 4038 - 4047.
[Abstract] [Full Text]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman
A Gene Hypermethylation Profile of Human Cancer
Cancer Res., April 1, 2001; 61(8): 3225 - 3229.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Young, K. G. Biden, L. A. Simms, P. Huggard, R. Karamatic, H. J. Eyre, G. R. Sutherland, N. Herath, M. Barker, G. J. Anderson, et al.
HPP1: A transmembrane protein-encoding gene commonly methylated in colorectal polyps and cancers
PNAS, January 2, 2001; 98(1): 265 - 270.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, G.
Right arrow Articles by Jones, P. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, G.
Right arrow Articles by Jones, P. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online