Cancer Research Annual Meeting 2010  Telomeres
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eads, C. A.
Right arrow Articles by Skinner, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eads, C. A.
Right arrow Articles by Skinner, K. A.
[Cancer Research 60, 5021-5026, September 15, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Fields of Aberrant CpG Island Hypermethylation in Barrett’s Esophagus and Associated Adenocarcinoma1

Cindy A. Eads, Reginald V. Lord, Soudamini K. Kurumboor, Kumari Wickramasinghe, Margaret L. Skinner, Tiffany I. Long, Jeffrey H. Peters, Tom R. DeMeester, Kathleen D. Danenberg, Peter V. Danenberg, Peter W. Laird2,3 and Kristin A. Skinner2

Departments of Surgery [C. A. E., R. V. L., S. K. K., M. L. S., T. I. L., J. H. P., T. R. D., P. W. L., K. A. S.], Biochemistry and Molecular Biology [C. A. E., T. I. L., K. D. D., P. V. D., P. W. L.], and Pathology [K. W.], University of Southern California, Keck School of Medicine, Norris Comprehensive Cancer Center, Los Angeles, California 90089-9176


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Esophageal adenocarcinoma (EAC) is thought to develop through a multistage process in which Barrett’s metaplasia progresses through low- and high-grade dysplasia to invasive cancer. Transcriptional silencing of tumor suppressor genes by promoter CpG island hypermethylation has been observed in many types of human cancer. Analysis of CpG island hypermethylation in EAC has thus far been limited to the CDKN2A (p16) gene. In this study, we extend the methylation analysis of EAC to include three other genes, APC, CDH1 (E-cadherin), and ESR1 (ER, estrogen receptor {alpha}), in addition to CDKN2A. Molecular analysis can provide insight into the complex relationships between tissues with different histologies in Barrett’s esophagus and associated adenocarcinoma. Therefore, we have mapped the spatial distribution of methylation patterns in six esophagectomy cases in detail. Hypermethylation of the four CpG islands was analyzed by the MethyLight technique in 107 biopsies derived from these six patients for a total of 428 methylation analyses. Our results show that normal esophageal squamous epithelium is unmethylated at all four CpG islands. CDH1 is unmethylated in most other tissue types as well. Hypermethylation of ESR1 is seen at high frequency in inflammatory reflux esophagitis and at all subsequent stages, whereas APC and CDKN2A hypermethylation is found in Barrett’s metaplasia, dysplasia, and EAC. When it occurs, hypermethylation of APC, CDKN2A, and ESR1 is usually found in a large contiguous field, suggesting either a concerted methylation change associated with metaplasia or a clonal expansion of cells with abnormal hypermethylation.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
The incidence of EAC4 has increased significantly in the Western world over the last three decades (1) . EAC is thought to evolve from a multistep process whereby the normal esophageal squamous epithelium is replaced by specialized columnar epithelium in Barrett’s esophagus (IM), followed by progression through LGD and HGD stages to invasive cancer (2) . This complex sequence of events provides an excellent system to study the molecular events associated with defined histological change (3) . Several reports have described genetic alterations in this system, including aneuploidy and LOH, mutation or homozygous deletion of the tumor-suppressor genes APC, CDKN2A (p16), TP53, and RB1 (3, 4, 5, 6, 7, 8, 9, 10) . However, genetic alterations could not always fully account for the inactivation of both alleles of these tumor suppressor genes. For instance, LOH at the APC locus has been observed in 85% of informative EAC, but mutations in the remaining allele were detected infrequently (3 , 4 , 6 , 8 , 10 , 11) . Reduced levels of CDH1 (E-cadherin) protein expression have been observed in dysplastic Barrett’s and EAC relative to normal esophageal epithelium (12, 13, 14) . LOH of the CDH1 locus was found in 65% of EAC cases, but mutations were rare (15) . This suggests that other, nongenetic events could contribute to gene inactivation in esophageal adenocarcinoma. It is known that abnormal hypermethylation of CpG islands associated with tumor suppressor genes can lead to transcriptional silencing, providing an alternative mechanism for gene inactivation in cancer cells (16 , 17) . Evidence for this mechanism of gene inactivation in esophageal adenocarcinoma was provided by the documentation of promoter CpG island hypermethylation of the CDKN2A gene in tumors with CDKN2A LOH but lacking mutations in the remaining allele (18 , 19) . The low frequency of mutations accompanying LOH at the APC and CDH1 loci may indicate that the contribution by DNA hypermethylation is more widespread in Barrett’s-associated esophageal adenocarcinoma. Therefore, we have extended the analysis of DNA hypermethylation in Barrett’s-associated adenocarcinoma to include 5' CpG islands associated with the APC, CDH1, and ESR1 genes, in addition to CDKN2A. These CpG islands are known to become hypermethylated in adenocarcinomas of other parts of the gastrointestinal tract (20, 21, 22, 23) and are good candidates to study DNA methylation changes in esophageal adenocarcinoma.

We have used the analysis of hypermethylation of these four CpG islands to address two separate issues: (a) in a limited number of patients, we have determined which DNA methylation changes are associated with specific histologies; (b) in each patient, we have extensively characterized how these methylation changes are distributed throughout each type of tissue. Such a study of the heterogeneity of methylation patterns within histologies, preserving the precise topological context of the tissue samples relative to each other, has not been reported previously and should add to our understanding of the molecular evolution of Barrett’s-associated esophageal adenocarcinoma. To achieve this detailed analysis of methylation abnormalities, we collected between 7 and 27 biopsies from the esophagus and stomach of six esophagectomy cases, using a 1-cm grid to preserve their topological context, for a total of 107 biopsies. We determined the methylation status of the four CpG islands in each of these samples by MethyLight (23 , 24) . We report for the first time the hypermethylation of APC and ESR1 in EAC and confirm the hypermethylation of CDKN2A in this system. Our results indicate that in patients with dysplasia and/or EAC, abnormal hypermethylation occurs both in the dysplastic and malignant tissues, as well as in earlier stage tissues, such as Barrett’s metaplasia. Aberrant methylation is very rarely seen in the normal squamous epithelium of the esophagus. The hypermethylation patterns are present throughout Barrett’s esophagus and EAC tissue as a contiguous field, suggesting either a concerted alteration of DNA methylation patterns associated with metaplasia or a clonal expansion of cells with abnormal hypermethylation of CpG islands.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Sample Collection.
Multiple tissue samples from six patients [three males and three females; median age, 69 years (range, 47–80)] who underwent esophagectomy for adenocarcinoma (n = 4) or for Barrett’s esophagus with HGD (n = 2, patients 16 and 18) were collected fresh and immediately frozen in liquid nitrogen. The esophagectomy specimen was photographed and traced out on a 1-cm grid, marking the sites of biopsy to preserve the topographic relationships between biopsies. Biopsies from areas of visible Barrett’s esophagus or cancer and from adjacent and nonadjacent areas of macroscopically normal esophageal and gastric mucosa were taken using a sterile 6-mm skin biopsy punch (Miltex, Tuttlingen, Germany). The samples were taken at 1-cm (patients 16 and 17) or 2-cm (patients 18 and 19) intervals from abnormal and adjacent normal areas or at 1-cm intervals from both adjacent and separate areas (patients 50 and 51). Part of the specimen was fixed in formalin and paraffin for histopathological examination by a single pathologist (K. W.). Frozen section examination of the study tissue was performed if the diagnosis was uncertain. The specimens were classified according to the highest grade histopathological lesion present. The diagnosis of cardiac mucosa required the presence of a columnar mucosa with glands containing mucous cells but no parietal or chief cells. All areas of cardiac mucosa showed inflammation ("carditis"), as is usual (25) . The diagnosis of reflux esophagitis was made if intraepithelial eosinophils, papillary elongation, and basal hyperplasia were all present within squamous epithelium.

The site of origin of the cancers was classified as esophageal if the epicenter of the tumor was above the anatomical gastroesophageal junction, with the junction defined as the proximal margin of the gastric rugal folds. Patient 51 was classified as having a junctional (syn. cardia) cancer because the epicenter was situated at the gastroesophageal junction. TNM stages and grades of differentiation for the cancer patients were: stage 1, moderately well differentiated (patient 19); stage 2B, poorly differentiated (patient 50); stage 4A (celiac node metastasis), moderately well differentiated (patient 51); and stage 4A, poorly differentiated (patient 17). Approval for this study was obtained from the Institutional Review Board of the University of Southern California Keck School of Medicine.

Nucleic Acid Isolation.
Genomic DNA was isolated by the standard method of proteinase K digestion and phenol-chloroform extraction (26) .

Sodium Bisulfite Conversion.
Sodium bisulfite conversion of genomic DNA was performed as described previously (27) . The beads were incubated for 14 h at 50°C to ensure complete conversion.

Methylation Analysis.
After sodium bisulfite conversion, genomic DNA was analyzed by the MethyLight technique (23 , 24) . Three oligos were used in every reaction: two locus-specific PCR primers flanking an oligonucleotide probe with a 5' fluorescent reporter dye (6FAM) and a 3' quencher dye (TAMRA; Ref. 28 ). The PCR amplification was performed as described previously (23 , 24) . Two sets of primers and probes, designed specifically for bisulfite-converted DNA, were used: a methylated set for the gene of interest [APC, CDH1, CDKN2A (p16), or ESR1], each spanning from 7 to 10 CpG dinucleotides, and a reference set, ß-actin (ACTB), to normalize for input DNA. Specificity of the reactions for methylated DNA were confirmed separately using human sperm DNA (unmethylated) and SssI (New England Biolabs) treated sperm DNA (methylated). The reference primers and the probe were designed in a region of the ACTB gene that lacks any CpG dinucleotides to allow for equal amplification, regardless of methylation levels. Parallel TaqMan PCR reactions were performed with primers specific for the bisulfite-converted methylated sequence for a particular locus and with the ACTB reference primers. The ratio between the values obtained in these two TaqMan analyses was used as a measure for the degree of methylation at that locus. The percentage of fully methylated molecules at a specific locus was calculated by dividing the GENE:ACTB ratio of a sample by the GENE:ACTB ratio of SssI-treated sperm DNA and multiplying by 100. Samples containing >=4% fully methylated molecules were designated as methylated, whereas samples containing <4% were designated as unmethylated. The 4% cutoff gave the best discrimination between normal and premalignant/malignant tissues. The primer and probe sequences are listed below. In all cases, the first primer listed is the forward PCR primer, the second is the TaqMan probe, and the third is the reverse PCR primer. The GenBank accession number and amplicon location for each reaction are indicated between parentheses; APC (U02509, 759–832), GAACCAAAACGCTCCCCAT, 6FAM5'-CCCGTCGAAAACCCGCCGATTA-3'TAMRA, TTATATGTCGGTTACGTGCGTTTATAT; CDH1 (L34545, 842–911), AATTTTAGGTTAGAGGGTTATCGCGT, 6FAM5'-CGCCCACCCGACCTCGCAT-3'TAMRA, TCCCCAAAACGAAACTAACGAC; CDKN2A (NM_000077, 66–133, there are two bases in our primers that differ from this GenBank sequence, because a preliminary high-throughput GenBank entry was the only available sequence at the time of our primer design), TGGAATTTTCGGTTGATTGGTT, 6FAM5'-ACCCGACCCCGAACCGCG-3'TAMRA, AACAACGTCCGCACCTCCT; ESR1 (X62462, 2784–2884) GGCGTTCGTTTTGGGATTG, 6FAM5'-CGATAAAACCGAACGACCCGACGA-3'TAMRA, GCCGACACGCGAACTCTAA; and ACTB (Y00474, 390–522), TGGTGATGGAGGAGGTTTAGTAAGT, 6FAM5'ACCACCACCCAACACACAATAACAAACACA-3'TAMRA, AACCAATAAAACCTACTCCTCCCTTAA.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
We selected CpG islands located in the 5' regions of the APC, CDH1, CDKN2A, and ESR1 genes to examine the methylation patterns in the progression of EAC. A quantitative, fluorescence-based (TaqMan) bisulfite-PCR method called MethyLight was used (23 , 24) . Briefly, methylation-specific oligos were designed to amplify completely methylated molecules. The reaction for each specific gene (APC, CDH1, CDKN2A, or ESR1) was run in parallel with a reference reaction (ß-actin, ACTB) to correct for input DNA for each sample. The ratio between the gene of interest and the reference gene is indicative of the relative prevalence of fully methylated molecules in a given sample. The efficiencies of our methylation reactions are controlled for in each analysis by including unmethylated control DNA and fully methylated control DNA (Fig. 1, A and B)Citation . As shown for the unmethylated control, only the reference gene (ACTB) amplifies, whereas all reactions showed amplification in the fully methylated control DNA, as expected. This discrimination allows us to detect fully methylated molecules in heterogeneous samples such as normal and tumor esophageal tissue (Fig. 1, C and D)Citation . Fig. 1CCitation demonstrates that for a representative normal esophageal mucosa tissue, the reference reaction (ACTB) amplifies, whereas APC, CDH1, CDKN2A, and ESR1 specific oligos do not, indicating a lack of methylation at these CpG islands in this normal sample. In the matched EAC sample, however, APC and ESR1 amplify along with ACTB, whereas CDKN2A and CDH1 are negative, indicating APC- and ESR1-specific hypermethylation (Fig. 1D)Citation .



View larger version (66K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Methylation analysis of APC, CDH1, CDKN2A, and ESR1 using fluorescence-based, quantitative, real-time PCR (TaqMan). In the PCR reaction, an oligonucleotide probe tagged with a 5' fluorescent reporter and 3' quencher is added in addition to the standard PCR components. As the Taq polymerase synthesizes the new strand, its 5' to 3' nuclease activity cleaves the probe, separating the quencher and fluorescent reporter. The fluorescence emitted is proportional to the amount of product accumulated with each cycle. Horizontal bold line, fluorescence level used for the threshold cycle determination in this particular example. {Delta}Rn is defined as the cycle-to-cycle change in the reporter fluorescence signal normalized to a passive reference fluorescence signal. Two sets of primers and probes, designed specifically for bisulfite-converted DNA, were used: a methylated set for the gene of interest [APC, CDH1, CDKN2A (p16), or ESR1] and a reference set (ACTB) to control for input DNA. Specificity of the reactions for methylated DNA were confirmed separately using sperm DNA (unmethylated; A) and SssI-treated sperm DNA (methylated; B). C and D show a representative analysis from a normal esophageal mucosa sample and a matched esophageal adenocarcinoma sample from case 51. L9 and F9 designate the sample location in Fig. 2Citation .

 
The methylation results of APC, CDH1, CDKN2A, and ESR1 obtained from the four most extensive mappings of the six esophagectomy patients (cases 16, 17, 50, and 51) are depicted in Fig. 2Citation . The results for the other two mappings (cases 18 and 19) are summarized in Table 1Citation . Each case contains a unique combination and topography of various tissue types. All four genes are unmethylated in almost all normal esophageal mucosa samples (Fig. 2Citation and Table 1Citation ). CDH1 is rarely methylated in any tissue. It is most commonly methylated in normal stomach (24%; Table 1Citation ), which is consistent with a previous report of occasional CDH1 methylation in gastric mucosa (22) . APC and ESR1 are methylated in the majority of Barrett’s metaplastic and dysplastic samples and/or adenocarcinoma samples (Fig. 2)Citation . APC hypermethylation is present throughout the Barrett’s IM (cases 16 and 17), whereas ESR1 hypermethylation is found ubiquitously in adenocarcinoma tissue (cases 17, 50, and 51). APC is also frequently methylated (76%) in the normal stomach in every patient (Table 1)Citation . APC and ESR1 methylation changes are even detected in samples of reflux esophagitis and cardiac mucosa in case 16 (Fig. 2Citation ; Table 1Citation ). CDKN2A hypermethylation is observed only in cases 16 and 17. Both tumor samples in case 17 show CDKN2A hypermethylation. It is detected throughout the metaplastic and dysplastic Barrett’s tissues in case 16 and in some samples of IM, LGD, and adenocarcinoma in case 17 (Fig. 2Citation ; Table 1Citation ).



View larger version (102K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Schematic of methylation results obtained from four esophagectomy patients. The esophagus for each case (cases 16, 17, 50, and 51) is illustrated to scale in each row, with the distance between points on the grid being 1 cm. The different tissue types are designated as varying degrees of gray and labeled with a corresponding letter (E, normal esophageal mucosa; S, stomach; B, Barrett’s esophagus; T, adenocarcinoma). The methylation status of APC, CDH1, CDKN2A (p16), or ESR1 is shown in each column. Each circle represents a 6-mm punch biopsy. •, samples in which >4% of the DNA molecules analyzed have full methylation of all of the CpG dinucleotides covered by the respective assay. {circ}, those samples in which this value was >=4%. Case 16 has normal squamous epithelium (D1–3, 6), normal stomach (A1–2, 6), reflux esophagitis (C4, 5 and D4), cardiac mucosa (A5 and B2), Barrett’s IM (A4; B1, 4, 5; and C2), Barrett’s with LGD (B6 and C3) and HGD (A3) but lacks adenocarcinoma tissue. Case 17 has normal squamous epithelium (E2; F2–5; and G1–4), and normal stomach (A1–4; B2–4; and C2, 4), Barrett’s IM (B1; D2, 4; and E3), LGD (D1 and E1, 4), and adenocarcinoma (C3 and D3). Case 50 has normal esophageal squamous epithelium (J2–5 and L2–5) and normal stomach (A1, 7), one sample of Barrett’s IM (I2), and adenocarcinoma (D2–6; H2–5; and I3–5). Case 51 has normal esophageal squamous epithelium (F6; G5–8; L6–9; and S7–10), normal stomach (A1; E5–7; and F5, 7), and adenocarcinoma (E9–10; and F9–10).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Frequency of CpG island hypermethylation for different tissue types

 
Both APC and CDKN2A methylation are found at higher frequency in Barrett’s tissues than in the adenocarcinoma samples (Table 1)Citation . This could be attributable to the reversible nature of DNA methylation, as other events such as mutation take over in the tumor. Alternatively, the decreased methylation signal could reflect the deletion of methylated alleles attributable to LOH of APC and/or CDKN2A in the adenocarcinoma samples. Either of these scenarios would be consistent with DNA methylation acting as an early-stage inactivation mechanism that is later supplanted by irreversible genetic events (29) . In contrast, ESR1 methylation is retained in all adenocarcinoma samples. The ESR1 gene is not a classical tumor suppressor gene and does not commonly undergo LOH or mutational events.


    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Previous studies of hypermethylation in Barrett’s esophagus and EAC have been limited to the CDKN2A gene and have focused on the analysis of a very small number of samples from each patient with Barrett’s esophagus and/or esophageal adenocarcinoma. In this study, we have used an alternative approach that not only documents the occurrence of hypermethylation of four CpG islands (APC, CDH1, CDKN2A, and ESR1) but also provides the topological context in which this hypermethylation occurs in histologically defined areas of Barrett’s-associated EAC. Because this experimental approach by necessity involves the analysis of a large number of samples per patient, we have restricted the number of cases to six. Although the limited number of patients does not allow us to extrapolate on the general occurrence of hypermethylation of these four genes in Barrett’s-associated EAC, this alternative strategy revealed interesting trends.

Our results demonstrate two important points:

(a) Abnormal methylation patterns are not restricted to the adenocarcinoma tissue but are also found in premalignant Barrett’s tissue. This suggests that DNA hypermethylation is an early epigenetic alteration in the multistep progression of EAC. We have argued previously that the features of DNA methylation are particularly well suited for a role early in the cancer process (29) . An early role for DNA methylation in gastrointestinal tumors is further supported by the observation that polyp formation in ApcMin/+ mice is dependent upon sufficient levels of DNA methyltransferase activity early in polyp development (30) .

(b) These aberrant methylation patterns tend to occur in large contiguous fields. This would be expected for a monoclonally expanded tissue such as an adenocarcinoma. It has been reported that the clonal status of Barrett’s IM is related to the proximity of dysplastic or malignant tissue (3) . However, some of the nondysplastic IM samples with widespread hypermethylation in our study do not show evidence of dysplasia in adjacent biopsies located 1 cm away (e.g., both samples B1 in cases 16 and 17). Therefore, some of the concerted hypermethylation observed in IM in our study may represent a nonmonoclonal process, associated with metaplasia or ongoing repetitive injury, rather than clonal expansion. For instance, the APC hypermethylation observed in Barrett’s tissue may be a consequence of the metaplastic change to columnar epithelium, because it is also frequently found to be methylated in the normal columnar epithelium of the stomach, whereas the hypermethylation observed in the esophagitis samples could indicate changes associated with chronic reflux-induced damage to the squamous mucosa. Such nonclonal changes might create a field of abnormal hypermethylation that predisposes the tissue to further progression. On the other hand, it is also possible that the contiguous methylation patterns observed in the Barrett’s tissue represent a clonal expansion of a hypermethylated cell. Many studies have reported LOH or mutations of APC, TP53, and CDKN2A that support a clonal expansion in premalignant Barrett’s esophagus (3 , 8 , 9) . These molecular events have usually been found to be associated with dysplasia. Our results show the frequent and widespread occurrence of aberrant methylation patterns in nondysplastic tissues. However, all of the cases that we have investigated also have associated HGD and/or adenocarcinoma. It is possible that nondysplastic tissues in individuals with IM as their most advanced stage of disease would not show such aberrant hypermethylation. Such patients are not included in our study, because they do not undergo esophagectomy.

The clonality of a tissue can be determined by tracing a specific mutation or LOH event through the different stages of EAC or, in female patients, by analyzing the homogeneity of X-chromosomal inactivation in the tissue sample (3) . Barrett’s tissue is very heterogeneous and requires cell sorting to remove contaminating normal cells for an accurate detection of clonality. Because our tissue specimens were not microdissected or cell sorted, we are unable to determine the clonality in the fields of DNA hypermethylation. The presence of substantial amounts of normal tissue in our specimens also prevents an assessment of the gene inactivation effects of the CpG island hypermethylation that we have detected. Gene expression in the normal stromal and epithelial cells in the specimen can mask a lack of expression in a subset of cells with CpG island hypermethylation. Indeed, samples from our study with substantial levels of complete methylation of the CDKN2A promoter CpG island still showed significant CDKN2A gene expression, as analyzed by quantitative real-time reverse transcription-PCR (data not shown), despite the fact that there is strong evidence for the gene silencing effects of CDKN2A promoter CpG island hypermethylation in more homogeneous tissues and cell lines (31) . Similar results showing a lack of clear inverse correlation between the methylation and gene expression data were obtained for APC and ESR1 as well (data not shown). Therefore, we believe that the analysis of aberrant DNA hypermethylation offers an advantage over deletion analysis and gene expression analysis in that it has greater sensitivity in the presence of contaminating normal cells. This alleviates the need for cell sorted populations and microdissected tissue samples, which are generally used in LOH and deletion studies of esophageal tumors.

Regardless of whether the observed CpG island hypermethylation events are attributable to field effects that arise from either clonal expansion or nonclonal concerted changes, it is clear that aberrant methylation patterns can occur in early-stage tissues associated with dysplasia and/or malignancy. A prospective longitudinal study should reveal whether these molecular alterations in early-stage tissues are predictive of imminent dysplastic disease.


    ACKNOWLEDGMENTS
 
We thank David VandenBerg for advice on the design of Fig. 2Citation .


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by American Cancer Society Grant RPG-98-214-01-CCE (to K. A. S.) and NIH/National Cancer Institute Grant R01-CA-75090 (to P. W. L.). Back

2 These authors contributed equally to this work. Back

3 To whom requests for reprints should be addressed, at University of Southern California, Norris Comprehensive Cancer Center, Room 6418, 1441 Eastlake Avenue, Los Angeles, CA 90089-9176. Phone: (323) 865-0650; Fax: (323) 865-0158; E-mail: plaird{at}hsc.usc.edu Back

4 The abbreviations used are: EAC, esophageal adenocarcinoma; IM, intestinal metaplasia; LGD, low-grade dysplasia; HGD, high-grade dysplasia; LOH, loss of heterozygosity; 6FAM, 6-carboxy-fluorescein; TAMRA, 6-carboxy-tetramethylrhodamine. Back

Received 2/24/00. Accepted 8/ 4/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Devesa S. S., Blot W. J., Fraumeni J. F., Jr. Changing patterns in the incidence of esophageal and gastric carcinoma in the United States. Cancer (Phila.), 83: 2049-2053, 1998.[Medline]
  2. Jankowski J. A., Wright N. A., Meltzer S. J., Triadafilopoulos G., Geboes K., Casson A. G., Kerr D., Young L. S. Molecular evolution of the metaplasia-dysplasia-adenocarcinoma sequence in the esophagus. Am. J. Pathol., 154: 965-973, 1999.[Abstract/Free Full Text]
  3. Zhuang Z., Vortmeyer A. O., Mark E. J., Odze R., Emmert-Buck M. R., Merino M. J., Moon H., Liotta L. A., Duray P. H. Barrett’s esophagus: metaplastic cells with loss of heterozygosity at the APC gene locus are clonal precursors to invasive adenocarcinoma. Cancer Res., 56: 1961-1964, 1996.[Abstract/Free Full Text]
  4. Boynton R. F., Blount P. L., Yin J., Brown V. L., Huang Y., Tong Y., McDaniel T., Newkirk C., Resau J. H., Raskind W. H. Loss of heterozygosity involving the APC and MCC genetic loci occurs in the majority of human esophageal cancers. Proc. Natl. Acad. Sci. USA, 89: 3385-3388, 1992.[Abstract/Free Full Text]
  5. Huang Y., Meltzer S. J., Yin J., Tong Y., Chang E. H., Srivastava S., McDaniel T., Boynton R. F., Zou Z. Q. Altered messenger RNA and unique mutational profiles of p53 and Rb in human esophageal carcinomas. Cancer Res., 53: 1889-1894, 1993.[Abstract/Free Full Text]
  6. Huang Y., Boynton R. F., Blount P. L., Silverstein R. J., Yin J., Tong Y., McDaniel T. K., Newkirk C., Resau J. H., Sridhara R., et al Loss of heterozygosity involves multiple tumor suppressor genes in human esophageal cancers. Cancer Res., 52: 6525-6530, 1992.[Abstract/Free Full Text]
  7. Barrett M. T., Sanchez C. A., Galipeau P. C., Neshat K., Emond M., Reid B. J. Allelic loss of 9p21 and mutation of the CDKN2/p16 gene develop as early lesions during neoplastic progression in Barrett’s esophagus. Oncogene, 13: 1867-1873, 1996.[Medline]
  8. Barrett M. T., Sanchez C. A., Prevo L. J., Wong D. J., Galipeau P. C., Paulson T. G., Rabinovitch P. S., Reid B. J. Evolution of neoplastic cell lineages in Barrett oesophagus. Nat. Genet., 22: 106-109, 1999.[Medline]
  9. Prevo L. J., Sanchez C. A., Galipeau P. C., Reid B. J. p53-mutant clones and field effects in Barrett’s esophagus. Cancer Res., 59: 4784-4787, 1999.[Abstract/Free Full Text]
  10. Gonzalez M. V., Artimez M. L., Rodrigo L., Lopez-Larrea C., Menendez M. J., Alvarez V., Perez R., Fresno M. F., Perez M. J., Sampedro A., Coto E. Mutation analysis of the p53, APC, and p16 genes in the Barrett’s oesophagus, dysplasia, and adenocarcinoma. J. Clin. Pathol., 50: 212-217, 1997.[Abstract/Free Full Text]
  11. Powell S. M., Papadopoulos N., Kinzler K. W., Smolinski K. N., Meltzer S. J. APC gene mutations in the mutation cluster region are rare in esophageal cancers. Gastroenterology, 107: 1759-1763, 1994.[Medline]
  12. Bongiorno P. F., al-Kasspooles M., Lee S. W., Rachwal W. J., Moore J. H., Whyte R. I., Orringer M. B., Beer D. G. E-Cadherin expression in primary and metastatic thoracic neoplasms and in Barrett’s oesophagus. Br. J. Cancer, 71: 166-172, 1995.[Medline]
  13. Swami S., Kumble S., Triadafilopoulos G. E-Cadherin expression in gastroesophageal reflux disease, Barrett’s esophagus, and esophageal adenocarcinoma: an immunohistochemical and immunoblot study. Am. J. Gastroenterol., 90: 1808-1813, 1995.[Medline]
  14. Washington K., Chiappori A., Hamilton K., Shyr Y., Blanke C., Johnson D., Sawyers J., Beauchamp D. Expression of ß-catenin, {alpha}-catenin, and E-cadherin in Barrett’s esophagus and esophageal adenocarcinomas. Mod. Pathol., 11: 805-813, 1998.[Medline]
  15. Wijnhoven B. P., de Both N. J., van Dekken H., Tilanus H. W., Dinjens W. N. E-Cadherin gene mutations are rare in adenocarcinomas of the oesophagus. Br. J. Cancer, 80: 1652-1657, 1999.[Medline]
  16. Jones P. A., Laird P. W. Cancer epigenetics comes of age. Nat. Genet., 21: 163-167, 1999.[Medline]
  17. Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alterations in DNA methylation: a fundamental aspect of neoplasia. Adv. Cancer Res., 72: 141-196, 1998.[Medline]
  18. Wong D. J., Barrett M. T., Stoger R., Emond M. J., Reid B. J. p16INK4a promoter is hypermethylated at a high frequency in esophageal adenocarcinomas. Cancer Res., 57: 2619-2622, 1997.[Abstract/Free Full Text]
  19. Klump B., Hsieh C. J., Holzmann K., Gregor M., Porschen R. Hypermethylation of the CDKN2/p16 promoter during neoplastic progression in Barrett’s esophagus. Gastroenterology, 115: 1381-1386, 1998.[Medline]
  20. Hiltunen M. O., Alhonen L., Koistinaho J., Myohanen S., Paakkonen M., Marin S., Kosma V. M., Janne J. Hypermethylation of the APC (adenomatous polyposis coli) gene promoter region in human colorectal carcinoma. Int. J. Cancer, 70: 644-648, 1997.[Medline]
  21. Issa J. P., Ottaviano Y. L., Celano P., Hamilton S. R., Davidson N. E., Baylin S. B. Methylation of the oestrogen receptor CpG island links aging and neoplasia in human colon. Nat. Genet., 7: 536-540, 1994.[Medline]
  22. Suzuki H., Itoh F., Toyota M., Kikuchi T., Kakiuchi H., Hinoda Y., Imai K. Distinct methylation pattern and microsatellite instability in sporadic gastric cancer. Int. J. Cancer, 83: 309-313, 1999.[Medline]
  23. Eads C. A., Danenberg K. D., Kawakami K., Saltz L. B., Danenberg P. V., Laird P. W. CpG island hypermethylation in human colorectal tumors is not associated with DNA methyltransferase overexpression. Cancer Res., 59: 2302-2306, 1999.[Abstract/Free Full Text]
  24. Eads C. A., Danenberg K. D., Kawakami K., Saltz L. B., Blake C., Shibata D., Danenberg P. V., Laird P. W. MethyLight: a high-throughput assay to measure DNA methylation. Nucleic Acids Res., 28: E32 2000.
  25. Oberg, S., Peters, J. H., DeMeester, T. R., Chandrasoma, P., Hagen, J. A., Ireland, A. P., Ritter, M. P., Mason, R. J., Crookes, P., and Bremner, C. G. Inflammation and specialized intestinal metaplasia of cardiac mucosa is a manifestation of gastroesophageal reflux disease. Ann. Surg., 226: 522–530; discussion 530–532, 1997.
  26. Wolff R. K., Frazer K. A., Jackler R. K., Lanser M. J., Pitts L. H., Cox D. R. Analysis of chromosome 22 deletions in neurofibromatosis type 2-related tumors. Am. J. Hum Genet., 51: 478-485, 1992.[Medline]
  27. Olek A., Oswald J., Walter J. A modified and improved method for bisulphite based cytosine methylation analysis. Nucleic Acids Res., 24: 5064-5066, 1996.[Abstract/Free Full Text]
  28. Livak K. J., Flood S. J., Marmaro J., Giusti W., Deetz K. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Applications, 4: 357-362, 1995.[Medline]
  29. Laird P. W. Oncogenic mechanisms mediated by DNA methylation. Mol. Med. Today, 3: 223-229, 1997.[Medline]
  30. Laird P. W., Jackson-Grusby L., Fazeli A., Dickinson S. L., Jung W. E., Li E., Weinberg R. A., Jaenisch R. Suppression of intestinal neoplasia by DNA hypomethylation. Cell, 81: 197-205, 1995.[Medline]
  31. Gonzalgo M. L., Hayashida T., Bender C. M., Pao M. M., Tsai Y. C., Gonzales F. A., Nguyen H. D., Nguyen T. T., Jones P. A. The role of DNA methylation in expression of the p19/p16 locus in human bladder cancer cell lines. Cancer Res., 58: 1245-1252, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
C. Rhiner and E. Moreno
Super competition as a possible mechanism to pioneer precancerous fields
Carcinogenesis, May 1, 2009; 30(5): 723 - 728.
[Abstract] [Full Text] [PDF]


Home page
Ann OncolHome page
T. Liu, Y. Niu, Y. Yu, Y. Liu, and F. Zhang
Increased {gamma}-tubulin expression and P16INK4A promoter methylation occur together in preinvasive lesions and carcinomas of the breast
Ann. Onc., March 1, 2009; 20(3): 441 - 448.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Kong, H. Nakagawa, B. K. Isariyawongse, S. Funakoshi, D. G. Silberg, A. K. Rustgi, and J. P. Lynch
Induction of intestinalization in human esophageal keratinocytes is a multistep process
Carcinogenesis, January 1, 2009; 30(1): 122 - 130.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Sabo, P. A. Meitner, R. Tavares, C. L. Corless, G. Y. Lauwers, S. F. Moss, and M. B. Resnick
Expression Analysis of Barrett's Esophagus-Associated High-Grade Dysplasia in Laser Capture Microdissected Archival Tissue
Clin. Cancer Res., October 15, 2008; 14(20): 6440 - 6448.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
H. Asada, Y. Yamagata, T. Taketani, A. Matsuoka, H. Tamura, N. Hattori, J. Ohgane, N. Hattori, K. Shiota, and N. Sugino
Potential link between estrogen receptor-{alpha} gene hypomethylation and uterine fibroid formation
Mol. Hum. Reprod., September 1, 2008; 14(9): 539 - 545.
[Abstract] [Full Text] [PDF]


Home page
Cancer Prevention ResearchHome page
J.-P. Issa
Cancer Prevention: Epigenetics Steps Up to the Plate
Cancer Prevention Research, September 1, 2008; 1(4): 219 - 222.
[Full Text] [PDF]


Home page
Cancer Res.Home page
E. M. Wolff, G. Liang, C. C. Cortez, Y. C. Tsai, J. E. Castelao, V. K. Cortessis, D. D. Tsao-Wei, S. Groshen, and P. A. Jones
RUNX3 Methylation Reveals that Bladder Tumors Are Older in Patients with a History of Smoking
Cancer Res., August 1, 2008; 68(15): 6208 - 6214.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
B. C. Christensen, J. J. Godleski, C. J. Marsit, E. A. Houseman, C. Y. Lopez-Fagundo, J. L. Longacker, R. Bueno, D. J. Sugarbaker, H. H. Nelson, and K. T. Kelsey
Asbestos exposure predicts cell cycle control gene promoter methylation in pleural mesothelioma
Carcinogenesis, August 1, 2008; 29(8): 1555 - 1559.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Tada, F. Kanai, Y. Tanaka, K. Tateishi, M. Ohta, Y. Asaoka, M. Seto, R. Muroyama, K. Fukai, F. Imazeki, et al.
Down-Regulation of Hedgehog-Interacting Protein through Genetic and Epigenetic Alterations in Human Hepatocellular Carcinoma
Clin. Cancer Res., June 15, 2008; 14(12): 3768 - 3776.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
Q. Feng, S. E. Hawes, J. E. Stern, L. Wiens, H. Lu, Z. M. Dong, C. D. Jordan, N. B. Kiviat, and H. Vesselle
DNA Methylation in Tumor and Matched Normal Tissues from Non-Small Cell Lung Cancer Patients
Cancer Epidemiol. Biomarkers Prev., March 1, 2008; 17(3): 645 - 654.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
K. Chen, R. Sawhney, M. Khan, M. S. Benninger, Z. Hou, S. Sethi, J. K. Stephen, and M. J. Worsham
Methylation of Multiple Genes as Diagnostic and Therapeutic Markers in Primary Head and Neck Squamous Cell Carcinoma
Arch Otolaryngol Head Neck Surg, November 1, 2007; 133(11): 1131 - 1138.
[Abstract] [Full Text] [PDF]


Home page
Postgrad. Med. J.Home page
E. Zagorowicz and J. Jankowski
Molecular changes in the progression of Barrett's oesophagus
Postgrad. Med. J., August 1, 2007; 83(982): 529 - 535.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
J. K. Stephen, L. E. Vaught, K. M. Chen, V. Shah, V. G. Schweitzer, G. Gardner, M. S. Benninger, and M. J. Worsham
An Epigenetically Derived Monoclonal Origin for Recurrent Respiratory Papillomatosis
Arch Otolaryngol Head Neck Surg, July 1, 2007; 133(7): 684 - 692.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Gu, D. Berman, C. Lu, I. I. Wistuba, J. A. Roth, M. Frazier, M. R. Spitz, and X. Wu
Aberrant Promoter Methylation Profile and Association with Survival in Patients with Non-Small Cell Lung Cancer
Clin. Cancer Res., December 15, 2006; 12(24): 7329 - 7338.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
R C Fitzgerald
Molecular basis of Barrett's oesophagus and oesophageal adenocarcinoma.
Gut, December 1, 2006; 55(12): 1810 - 1820.
[Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
S. Ogino, T. Kawasaki, G. J. Kirkner, M. Loda, and C. S. Fuchs
CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations
J. Mol. Diagn., November 1, 2006; 8(5): 582 - 588.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
S L Preston and J A Jankowski
Drinking from the fountain of promise: biomarkers in the surveillance of Barrett's oesophagus--the glass is half full!
Gut, October 1, 2006; 55(10): 1377 - 1379.
[Full Text] [PDF]


Home page
GutHome page
S Ogino, M Cantor, T Kawasaki, M Brahmandam, G J Kirkner, D J Weisenberger, M Campan, P W Laird, M Loda, and C S Fuchs
CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies
Gut, July 1, 2006; 55(7): 1000 - 1006.
[Abstract] [Full Text] [PDF]


Home page
Arch Otolaryngol Head Neck SurgHome page
M. J. Worsham, K. M. Chen, V. Meduri, A. O. H. Nygren, A. Errami, J. P. Schouten, and M. S. Benninger
Epigenetic events of disease progression in head and neck squamous cell carcinoma.
Arch Otolaryngol Head Neck Surg, June 1, 2006; 132(6): 668 - 677.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
S. Ogino, T. Kawasaki, M. Brahmandam, M. Cantor, G. J. Kirkner, D. Spiegelman, G. M. Makrigiorgos, D. J. Weisenberger, P. W. Laird, M. Loda, et al.
Precision and Performance Characteristics of Bisulfite Conversion and Real-Time PCR (MethyLight) for Quantitative DNA Methylation Analysis
J. Mol. Diagn., May 1, 2006; 8(2): 209 - 217.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Katoh, T. Shibata, A. Kokubu, H. Ojima, M. Fukayama, Y. Kanai, and S. Hirohashi
Epigenetic Instability and Chromosomal Instability in Hepatocellular Carcinoma
Am. J. Pathol., April 1, 2006; 168(4): 1375 - 1384.
[Abstract] [Full Text] [PDF]


Home page
CA Cancer J ClinHome page
R. F. Souza and S. J. Spechler
Concepts in the Prevention of Adenocarcinoma of the Distal Esophagus and Proximal Stomach
CA Cancer J Clin, November 1, 2005; 55(6): 334 - 351.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
E. Giovannucci and S. Ogino
DNA Methylation, Field Effects, and Colorectal Cancer
J Natl Cancer Inst, September 21, 2005; 97(18): 1317 - 1319.
[Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Brabender, P. Marjoram, R. V.N. Lord, R. Metzger, D. Salonga, D. Vallbohmer, H. Schafer, K. D. Danenberg, P. V. Danenberg, F. M. Selaru, et al.
The Molecular Signature of Normal Squamous Esophageal Epithelium Identifies the Presence of a Field Effect and Can Discriminate between Patients with Barrett's Esophagus and Patients with Barrett's-Associated Adenocarcinoma
Cancer Epidemiol. Biomarkers Prev., September 1, 2005; 14(9): 2113 - 2117.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
P. W. Laird
Cancer epigenetics
Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R65 - R76.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. An, I.-S. Choi, J. C. Yao, S. Worah, K. Xie, P. F. Mansfield, J. A. Ajani, A. Rashid, S. R. Hamilton, and T.-T. Wu
Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma
Clin. Cancer Res., January 15, 2005; 11(2): 656 - 663.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
J. Chen, C. Rocken, C. Lofton-Day, H.-U. Schulz, O. Muller, N. Kutzner, P. Malfertheiner, and M. P.A. Ebert
Molecular analysis of APC promoter methylation and protein expression in colorectal cancer metastasis
Carcinogenesis, January 1, 2005; 26(1): 37 - 43.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
H. M. Muller, S. Millinger, H. Fiegl, G. Goebel, L. Ivarsson, A. Widschwendter, E. Muller-Holzner, C. Marth, and M. Widschwendter
Analysis of Methylated Genes in Peritoneal Fluids of Ovarian Cancer Patients: A New Prognostic Tool
Clin. Chem., November 1, 2004; 50(11): 2171 - 2173.
[Full Text] [PDF]


Home page
Cancer Res.Home page
G. Clement, F. T. Bosman, C. Fontolliet, and J. Benhattar
Monoallelic Methylation of the APC Promoter Is Altered in Normal Gastric Mucosa Associated with Neoplastic Lesions
Cancer Res., October 1, 2004; 64(19): 6867 - 6873.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Widschwendter, G. Jiang, C. Woods, H. M. Muller, H. Fiegl, G. Goebel, C. Marth, E. Muller-Holzner, A. G. Zeimet, P. W. Laird, et al.
DNA Hypomethylation and Ovarian Cancer Biology
Cancer Res., July 1, 2004; 64(13): 4472 - 4480.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. C. Maley, P. C. Galipeau, X. Li, C. A. Sanchez, T. G. Paulson, and B. J. Reid
Selectively Advantageous Mutations and Hitchhikers in Neoplasms: p16 Lesions Are Selected in Barrett's Esophagus
Cancer Res., May 15, 2004; 64(10): 3414 - 3427.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Deng, G.-A. Song, E. Pong, M. Sleisenger, and Y. S. Kim
Promoter Methylation Inhibits APC Gene Expression by Causing Changes in Chromatin Conformation and Interfering with the Binding of Transcription Factor CCAAT-Binding Factor
Cancer Res., April 15, 2004; 64(8): 2692 - 2698.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. T. McManus, A. Olaru, and S. J. Meltzer
Biomarkers of Esophageal Adenocarcinoma and Barrett's Esophagus
Cancer Res., March 1, 2004; 64(5): 1561 - 1569.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. V. Brock, M. Gou, Y. Akiyama, A. Muller, T.-T. Wu, E. Montgomery, M. Deasel, P. Germonpre, L. Rubinson, R. F. Heitmiller, et al.
Prognostic Importance of Promoter Hypermethylation of Multiple Genes in Esophageal Adenocarcinoma
Clin. Cancer Res., August 1, 2003; 9(8): 2912 - 2919.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M.-Y. Yang, T.-C. Liu, J.-G. Chang, P.-M. Lin, and S.-F. Lin
JunB gene expression is inactivated by methylation in chronic myeloid leukemia
Blood, April 15, 2003; 101(8): 3205 - 3211.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
M. Mareel and A. Leroy
Clinical, Cellular, and Molecular Aspects of Cancer Invasion
Physiol Rev, April 1, 2003; 83(2): 337 - 376.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Sato, D. Shibata, N. Harpaz, Y. Xu, J. Yin, Y. Mori, S. Wang, A. Olaru, E. Deacu, F. M. Selaru, et al.
Aberrant Methylation of the HPP1 Gene in Ulcerative Colitis-associated Colorectal Carcinoma
Cancer Res., December 1, 2002; 62(23): 6820 - 6822.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
T. Tokugawa, H. Sugihara, T. Tani, and T. Hattori
Modes of Silencing of p16 in Development of Esophageal Squamous Cell Carcinoma
Cancer Res., September 1, 2002; 62(17): 4938 - 4944.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
J. Park, S. Schulz, J. Haaf, J. C. Kairys, and S. A. Waldman
Ectopic Expression of Guanylyl Cyclase C in Adenocarcinomas of the Esophagus and Stomach
Cancer Epidemiol. Biomarkers Prev., August 1, 2002; 11(8): 739 - 744.
[Abstract] [Full Text] [PDF]


Home page
JNCI J Natl Cancer InstHome page
L. Shen, N. Ahuja, Y. Shen, N. A. Habib, M. Toyota, A. Rashid, and J.-P. J. Issa
DNA Methylation and Environmental Exposures in Human Hepatocellular Carcinoma
J Natl Cancer Inst, May 15, 2002; 94(10): 755 - 761.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
B. N. Trinh, T. I. Long, A. E. Nickel, D. Shibata, and P. W. Laird
DNA Methyltransferase Deficiency Modifies Cancer Susceptibility in Mice Lacking DNA Mismatch Repair
Mol. Cell. Biol., May 1, 2002; 22(9): 2906 - 2917.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Sato, N. Harpaz, D. Shibata, Y. Xu, J. Yin, Y. Mori, T.-T. Zou, S. Wang, K. Desai, A. Leytin, et al.
Hypermethylation of the p14ARF Gene in Ulcerative Colitis-associated Colorectal Carcinogenesis
Cancer Res., February 1, 2002; 62(4): 1148 - 1151.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
U. Lehmann, F. Langer, H. Feist, S. Glockner, B. Hasemeier, and H. Kreipe
Quantitative Assessment of Promoter Hypermethylation during Breast Cancer Development
Am. J. Pathol., February 1, 2002; 160(2): 605 - 612.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. J. Wong, T. G. Paulson, L. J. Prevo, P. C. Galipeau, G. Longton, P. L. Blount, and B. J. Reid
p16INK4a Lesions Are Common, Early Abnormalities that Undergo Clonal Expansion in Barrett's Metaplastic Epithelium
Cancer Res., November 1, 2001; 61(22): 8284 - 8289.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
J. F Costello and C. Plass
Methylation matters
J. Med. Genet., May 1, 2001; 38(5): 285 - 303.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
G. Hoon Kang, Y.-H. Shim, H.-Y. Jung, W. Ho Kim, J. Y. Ro, and M.-G. Rhyu
CpG Island Methylation in Premalignant Stages of Gastric Carcinoma
Cancer Res., April 1, 2001; 61(7): 2847 - 2851.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman
A Gene Hypermethylation Profile of Human Cancer
Cancer Res., April 1, 2001; 61(8): 3225 - 3229.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
C. A. Eads, R. V. Lord, K. Wickramasinghe, T. I. Long, S. K. Kurumboor, L. Bernstein, J. H. Peters, S. R. DeMeester, T. R. DeMeester, K. A. Skinner, et al.
Epigenetic Patterns in the Progression of Esophageal Adenocarcinoma
Cancer Res., April 1, 2001; 61(8): 3410 - 3418.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Eads, C. A.
Right arrow Articles by Skinner, K. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Eads, C. A.
Right arrow Articles by Skinner, K. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online