| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Departments of Surgery [C. A. E., R. V. L., S. K. K., M. L. S., T. I. L., J. H. P., T. R. D., P. W. L., K. A. S.], Biochemistry and Molecular Biology [C. A. E., T. I. L., K. D. D., P. V. D., P. W. L.], and Pathology [K. W.], University of Southern California, Keck School of Medicine, Norris Comprehensive Cancer Center, Los Angeles, California 90089-9176
| ABSTRACT |
|---|
|
|
|---|
), in
addition to CDKN2A. Molecular analysis can provide
insight into the complex relationships between tissues with different
histologies in Barretts esophagus and associated adenocarcinoma.
Therefore, we have mapped the spatial distribution of methylation
patterns in six esophagectomy cases in detail. Hypermethylation of the
four CpG islands was analyzed by the MethyLight technique in 107
biopsies derived from these six patients for a total of 428 methylation
analyses. Our results show that normal esophageal squamous epithelium
is unmethylated at all four CpG islands. CDH1 is
unmethylated in most other tissue types as well. Hypermethylation of
ESR1 is seen at high frequency in inflammatory reflux
esophagitis and at all subsequent stages, whereas APC
and CDKN2A hypermethylation is found in Barretts
metaplasia, dysplasia, and EAC. When it occurs, hypermethylation of
APC, CDKN2A, and ESR1 is
usually found in a large contiguous field, suggesting either a
concerted methylation change associated with metaplasia or a clonal
expansion of cells with abnormal hypermethylation. | Introduction |
|---|
|
|
|---|
We have used the analysis of hypermethylation of these four CpG islands to address two separate issues: (a) in a limited number of patients, we have determined which DNA methylation changes are associated with specific histologies; (b) in each patient, we have extensively characterized how these methylation changes are distributed throughout each type of tissue. Such a study of the heterogeneity of methylation patterns within histologies, preserving the precise topological context of the tissue samples relative to each other, has not been reported previously and should add to our understanding of the molecular evolution of Barretts-associated esophageal adenocarcinoma. To achieve this detailed analysis of methylation abnormalities, we collected between 7 and 27 biopsies from the esophagus and stomach of six esophagectomy cases, using a 1-cm grid to preserve their topological context, for a total of 107 biopsies. We determined the methylation status of the four CpG islands in each of these samples by MethyLight (23 , 24) . We report for the first time the hypermethylation of APC and ESR1 in EAC and confirm the hypermethylation of CDKN2A in this system. Our results indicate that in patients with dysplasia and/or EAC, abnormal hypermethylation occurs both in the dysplastic and malignant tissues, as well as in earlier stage tissues, such as Barretts metaplasia. Aberrant methylation is very rarely seen in the normal squamous epithelium of the esophagus. The hypermethylation patterns are present throughout Barretts esophagus and EAC tissue as a contiguous field, suggesting either a concerted alteration of DNA methylation patterns associated with metaplasia or a clonal expansion of cells with abnormal hypermethylation of CpG islands.
| Materials and Methods |
|---|
|
|
|---|
The site of origin of the cancers was classified as esophageal if the epicenter of the tumor was above the anatomical gastroesophageal junction, with the junction defined as the proximal margin of the gastric rugal folds. Patient 51 was classified as having a junctional (syn. cardia) cancer because the epicenter was situated at the gastroesophageal junction. TNM stages and grades of differentiation for the cancer patients were: stage 1, moderately well differentiated (patient 19); stage 2B, poorly differentiated (patient 50); stage 4A (celiac node metastasis), moderately well differentiated (patient 51); and stage 4A, poorly differentiated (patient 17). Approval for this study was obtained from the Institutional Review Board of the University of Southern California Keck School of Medicine.
Nucleic Acid Isolation.
Genomic DNA was isolated by the standard method of proteinase K
digestion and phenol-chloroform extraction (26)
.
Sodium Bisulfite Conversion.
Sodium bisulfite conversion of genomic DNA was performed as described
previously (27)
. The beads were incubated for 14 h at
50°C to ensure complete conversion.
Methylation Analysis.
After sodium bisulfite conversion, genomic DNA was analyzed by the
MethyLight technique (23
, 24)
. Three oligos were used in
every reaction: two locus-specific PCR primers flanking an
oligonucleotide probe with a 5' fluorescent reporter dye (6FAM) and a
3' quencher dye (TAMRA; Ref. 28
). The PCR amplification
was performed as described previously (23
, 24)
. Two sets
of primers and probes, designed specifically for bisulfite-converted
DNA, were used: a methylated set for the gene of interest
[APC, CDH1, CDKN2A (p16), or
ESR1], each spanning from 7 to 10 CpG dinucleotides, and a
reference set, ß-actin (ACTB), to normalize for input DNA.
Specificity of the reactions for methylated DNA were confirmed
separately using human sperm DNA (unmethylated) and SssI
(New England Biolabs) treated sperm DNA (methylated). The reference
primers and the probe were designed in a region of the ACTB
gene that lacks any CpG dinucleotides to allow for equal amplification,
regardless of methylation levels. Parallel TaqMan PCR reactions
were performed with primers specific for the bisulfite-converted
methylated sequence for a particular locus and with the ACTB
reference primers. The ratio between the values obtained in these two
TaqMan analyses was used as a measure for the degree of methylation at
that locus. The percentage of fully methylated molecules at a specific
locus was calculated by dividing the GENE:ACTB ratio of a
sample by the GENE:ACTB ratio of
SssI-treated sperm DNA and multiplying by 100.
Samples containing
4% fully methylated molecules were designated as
methylated, whereas samples containing <4% were designated as
unmethylated. The 4% cutoff gave the best discrimination between
normal and premalignant/malignant tissues. The primer and probe
sequences are listed below. In all cases, the first primer listed is
the forward PCR primer, the second is the TaqMan probe, and the third
is the reverse PCR primer. The GenBank accession number and amplicon
location for each reaction are indicated between parentheses;
APC (U02509, 759832), GAACCAAAACGCTCCCCAT,
6FAM5'-CCCGTCGAAAACCCGCCGATTA-3'TAMRA,
TTATATGTCGGTTACGTGCGTTTATAT; CDH1 (L34545, 842911),
AATTTTAGGTTAGAGGGTTATCGCGT,
6FAM5'-CGCCCACCCGACCTCGCAT-3'TAMRA,
TCCCCAAAACGAAACTAACGAC; CDKN2A (NM_000077,
66133, there are two bases in our primers that differ from this
GenBank sequence, because a preliminary high-throughput GenBank entry
was the only available sequence at the time of our primer
design), TGGAATTTTCGGTTGATTGGTT,
6FAM5'-ACCCGACCCCGAACCGCG-3'TAMRA, AACAACGTCCGCACCTCCT; ESR1
(X62462, 27842884) GGCGTTCGTTTTGGGATTG,
6FAM5'-CGATAAAACCGAACGACCCGACGA-3'TAMRA, GCCGACACGCGAACTCTAA; and
ACTB (Y00474, 390522), TGGTGATGGAGGAGGTTTAGTAAGT,
6FAM5'ACCACCACCCAACACACAATAACAAACACA-3'TAMRA,
AACCAATAAAACCTACTCCTCCCTTAA.
| Results |
|---|
|
|
|---|
|
|
|
| Discussion |
|---|
|
|
|---|
Our results demonstrate two important points:
(a) Abnormal methylation patterns are not restricted to the adenocarcinoma tissue but are also found in premalignant Barretts tissue. This suggests that DNA hypermethylation is an early epigenetic alteration in the multistep progression of EAC. We have argued previously that the features of DNA methylation are particularly well suited for a role early in the cancer process (29) . An early role for DNA methylation in gastrointestinal tumors is further supported by the observation that polyp formation in ApcMin/+ mice is dependent upon sufficient levels of DNA methyltransferase activity early in polyp development (30) .
(b) These aberrant methylation patterns tend to occur in large contiguous fields. This would be expected for a monoclonally expanded tissue such as an adenocarcinoma. It has been reported that the clonal status of Barretts IM is related to the proximity of dysplastic or malignant tissue (3) . However, some of the nondysplastic IM samples with widespread hypermethylation in our study do not show evidence of dysplasia in adjacent biopsies located 1 cm away (e.g., both samples B1 in cases 16 and 17). Therefore, some of the concerted hypermethylation observed in IM in our study may represent a nonmonoclonal process, associated with metaplasia or ongoing repetitive injury, rather than clonal expansion. For instance, the APC hypermethylation observed in Barretts tissue may be a consequence of the metaplastic change to columnar epithelium, because it is also frequently found to be methylated in the normal columnar epithelium of the stomach, whereas the hypermethylation observed in the esophagitis samples could indicate changes associated with chronic reflux-induced damage to the squamous mucosa. Such nonclonal changes might create a field of abnormal hypermethylation that predisposes the tissue to further progression. On the other hand, it is also possible that the contiguous methylation patterns observed in the Barretts tissue represent a clonal expansion of a hypermethylated cell. Many studies have reported LOH or mutations of APC, TP53, and CDKN2A that support a clonal expansion in premalignant Barretts esophagus (3 , 8 , 9) . These molecular events have usually been found to be associated with dysplasia. Our results show the frequent and widespread occurrence of aberrant methylation patterns in nondysplastic tissues. However, all of the cases that we have investigated also have associated HGD and/or adenocarcinoma. It is possible that nondysplastic tissues in individuals with IM as their most advanced stage of disease would not show such aberrant hypermethylation. Such patients are not included in our study, because they do not undergo esophagectomy.
The clonality of a tissue can be determined by tracing a specific mutation or LOH event through the different stages of EAC or, in female patients, by analyzing the homogeneity of X-chromosomal inactivation in the tissue sample (3) . Barretts tissue is very heterogeneous and requires cell sorting to remove contaminating normal cells for an accurate detection of clonality. Because our tissue specimens were not microdissected or cell sorted, we are unable to determine the clonality in the fields of DNA hypermethylation. The presence of substantial amounts of normal tissue in our specimens also prevents an assessment of the gene inactivation effects of the CpG island hypermethylation that we have detected. Gene expression in the normal stromal and epithelial cells in the specimen can mask a lack of expression in a subset of cells with CpG island hypermethylation. Indeed, samples from our study with substantial levels of complete methylation of the CDKN2A promoter CpG island still showed significant CDKN2A gene expression, as analyzed by quantitative real-time reverse transcription-PCR (data not shown), despite the fact that there is strong evidence for the gene silencing effects of CDKN2A promoter CpG island hypermethylation in more homogeneous tissues and cell lines (31) . Similar results showing a lack of clear inverse correlation between the methylation and gene expression data were obtained for APC and ESR1 as well (data not shown). Therefore, we believe that the analysis of aberrant DNA hypermethylation offers an advantage over deletion analysis and gene expression analysis in that it has greater sensitivity in the presence of contaminating normal cells. This alleviates the need for cell sorted populations and microdissected tissue samples, which are generally used in LOH and deletion studies of esophageal tumors.
Regardless of whether the observed CpG island hypermethylation events are attributable to field effects that arise from either clonal expansion or nonclonal concerted changes, it is clear that aberrant methylation patterns can occur in early-stage tissues associated with dysplasia and/or malignancy. A prospective longitudinal study should reveal whether these molecular alterations in early-stage tissues are predictive of imminent dysplastic disease.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
1 Supported by American Cancer Society Grant
RPG-98-214-01-CCE (to K. A. S.) and NIH/National Cancer Institute
Grant R01-CA-75090 (to P. W. L.). ![]()
2 These authors contributed equally to this
work. ![]()
3 To whom requests for reprints should be
addressed, at University of Southern California, Norris Comprehensive
Cancer Center, Room 6418, 1441 Eastlake Avenue, Los Angeles, CA
90089-9176. Phone: (323) 865-0650; Fax: (323) 865-0158; E-mail: plaird{at}hsc.usc.edu ![]()
4 The abbreviations used are: EAC, esophageal
adenocarcinoma; IM, intestinal metaplasia; LGD, low-grade dysplasia;
HGD, high-grade dysplasia; LOH, loss of heterozygosity; 6FAM,
6-carboxy-fluorescein; TAMRA, 6-carboxy-tetramethylrhodamine. ![]()
Received 2/24/00. Accepted 8/ 4/00.
| REFERENCES |
|---|
|
|
|---|
-catenin, and E-cadherin in Barretts esophagus and esophageal adenocarcinomas. Mod. Pathol., 11: 805-813, 1998.[Medline]
This article has been cited by other articles:
![]() |
C. Rhiner and E. Moreno Super competition as a possible mechanism to pioneer precancerous fields Carcinogenesis, May 1, 2009; 30(5): 723 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Liu, Y. Niu, Y. Yu, Y. Liu, and F. Zhang Increased {gamma}-tubulin expression and P16INK4A promoter methylation occur together in preinvasive lesions and carcinomas of the breast Ann. Onc., March 1, 2009; 20(3): 441 - 448. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kong, H. Nakagawa, B. K. Isariyawongse, S. Funakoshi, D. G. Silberg, A. K. Rustgi, and J. P. Lynch Induction of intestinalization in human esophageal keratinocytes is a multistep process Carcinogenesis, January 1, 2009; 30(1): 122 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sabo, P. A. Meitner, R. Tavares, C. L. Corless, G. Y. Lauwers, S. F. Moss, and M. B. Resnick Expression Analysis of Barrett's Esophagus-Associated High-Grade Dysplasia in Laser Capture Microdissected Archival Tissue Clin. Cancer Res., October 15, 2008; 14(20): 6440 - 6448. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Asada, Y. Yamagata, T. Taketani, A. Matsuoka, H. Tamura, N. Hattori, J. Ohgane, N. Hattori, K. Shiota, and N. Sugino Potential link between estrogen receptor-{alpha} gene hypomethylation and uterine fibroid formation Mol. Hum. Reprod., September 1, 2008; 14(9): 539 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-P. Issa Cancer Prevention: Epigenetics Steps Up to the Plate Cancer Prevention Research, September 1, 2008; 1(4): 219 - 222. [Full Text] [PDF] |
||||
![]() |
E. M. Wolff, G. Liang, C. C. Cortez, Y. C. Tsai, J. E. Castelao, V. K. Cortessis, D. D. Tsao-Wei, S. Groshen, and P. A. Jones RUNX3 Methylation Reveals that Bladder Tumors Are Older in Patients with a History of Smoking Cancer Res., August 1, 2008; 68(15): 6208 - 6214. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Christensen, J. J. Godleski, C. J. Marsit, E. A. Houseman, C. Y. Lopez-Fagundo, J. L. Longacker, R. Bueno, D. J. Sugarbaker, H. H. Nelson, and K. T. Kelsey Asbestos exposure predicts cell cycle control gene promoter methylation in pleural mesothelioma Carcinogenesis, August 1, 2008; 29(8): 1555 - 1559. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tada, F. Kanai, Y. Tanaka, K. Tateishi, M. Ohta, Y. Asaoka, M. Seto, R. Muroyama, K. Fukai, F. Imazeki, et al. Down-Regulation of Hedgehog-Interacting Protein through Genetic and Epigenetic Alterations in Human Hepatocellular Carcinoma Clin. Cancer Res., June 15, 2008; 14(12): 3768 - 3776. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Feng, S. E. Hawes, J. E. Stern, L. Wiens, H. Lu, Z. M. Dong, C. D. Jordan, N. B. Kiviat, and H. Vesselle DNA Methylation in Tumor and Matched Normal Tissues from Non-Small Cell Lung Cancer Patients Cancer Epidemiol. Biomarkers Prev., March 1, 2008; 17(3): 645 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chen, R. Sawhney, M. Khan, M. S. Benninger, Z. Hou, S. Sethi, J. K. Stephen, and M. J. Worsham Methylation of Multiple Genes as Diagnostic and Therapeutic Markers in Primary Head and Neck Squamous Cell Carcinoma Arch Otolaryngol Head Neck Surg, November 1, 2007; 133(11): 1131 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zagorowicz and J. Jankowski Molecular changes in the progression of Barrett's oesophagus Postgrad. Med. J., August 1, 2007; 83(982): 529 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Stephen, L. E. Vaught, K. M. Chen, V. Shah, V. G. Schweitzer, G. Gardner, M. S. Benninger, and M. J. Worsham An Epigenetically Derived Monoclonal Origin for Recurrent Respiratory Papillomatosis Arch Otolaryngol Head Neck Surg, July 1, 2007; 133(7): 684 - 692. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gu, D. Berman, C. Lu, I. I. Wistuba, J. A. Roth, M. Frazier, M. R. Spitz, and X. Wu Aberrant Promoter Methylation Profile and Association with Survival in Patients with Non-Small Cell Lung Cancer Clin. Cancer Res., December 15, 2006; 12(24): 7329 - 7338. [Abstract] [Full Text] [PDF] |
||||
![]() |
R C Fitzgerald Molecular basis of Barrett's oesophagus and oesophageal adenocarcinoma. Gut, December 1, 2006; 55(12): 1810 - 1820. [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, G. J. Kirkner, M. Loda, and C. S. Fuchs CpG Island Methylator Phenotype-Low (CIMP-Low) in Colorectal Cancer: Possible Associations with Male Sex and KRAS Mutations J. Mol. Diagn., November 1, 2006; 8(5): 582 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
S L Preston and J A Jankowski Drinking from the fountain of promise: biomarkers in the surveillance of Barrett's oesophagus--the glass is half full! Gut, October 1, 2006; 55(10): 1377 - 1379. [Full Text] [PDF] |
||||
![]() |
S Ogino, M Cantor, T Kawasaki, M Brahmandam, G J Kirkner, D J Weisenberger, M Campan, P W Laird, M Loda, and C S Fuchs CpG island methylator phenotype (CIMP) of colorectal cancer is best characterised by quantitative DNA methylation analysis and prospective cohort studies Gut, July 1, 2006; 55(7): 1000 - 1006. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Worsham, K. M. Chen, V. Meduri, A. O. H. Nygren, A. Errami, J. P. Schouten, and M. S. Benninger Epigenetic events of disease progression in head and neck squamous cell carcinoma. Arch Otolaryngol Head Neck Surg, June 1, 2006; 132(6): 668 - 677. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ogino, T. Kawasaki, M. Brahmandam, M. Cantor, G. J. Kirkner, D. Spiegelman, G. M. Makrigiorgos, D. J. Weisenberger, P. W. Laird, M. Loda, et al. Precision and Performance Characteristics of Bisulfite Conversion and Real-Time PCR (MethyLight) for Quantitative DNA Methylation Analysis J. Mol. Diagn., May 1, 2006; 8(2): 209 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Katoh, T. Shibata, A. Kokubu, H. Ojima, M. Fukayama, Y. Kanai, and S. Hirohashi Epigenetic Instability and Chromosomal Instability in Hepatocellular Carcinoma Am. J. Pathol., April 1, 2006; 168(4): 1375 - 1384. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. F. Souza and S. J. Spechler Concepts in the Prevention of Adenocarcinoma of the Distal Esophagus and Proximal Stomach CA Cancer J Clin, November 1, 2005; 55(6): 334 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Giovannucci and S. Ogino DNA Methylation, Field Effects, and Colorectal Cancer J Natl Cancer Inst, September 21, 2005; 97(18): 1317 - 1319. [Full Text] [PDF] |
||||
![]() |
J. Brabender, P. Marjoram, R. V.N. Lord, R. Metzger, D. Salonga, D. Vallbohmer, H. Schafer, K. D. Danenberg, P. V. Danenberg, F. M. Selaru, et al. The Molecular Signature of Normal Squamous Esophageal Epithelium Identifies the Presence of a Field Effect and Can Discriminate between Patients with Barrett's Esophagus and Patients with Barrett's-Associated Adenocarcinoma Cancer Epidemiol. Biomarkers Prev., September 1, 2005; 14(9): 2113 - 2117. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W. Laird Cancer epigenetics Hum. Mol. Genet., April 15, 2005; 14(suppl_1): R65 - R76. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. An, I.-S. Choi, J. C. Yao, S. Worah, K. Xie, P. F. Mansfield, J. A. Ajani, A. Rashid, S. R. Hamilton, and T.-T. Wu Prognostic Significance of CpG Island Methylator Phenotype and Microsatellite Instability in Gastric Carcinoma Clin. Cancer Res., January 15, 2005; 11(2): 656 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, C. Rocken, C. Lofton-Day, H.-U. Schulz, O. Muller, N. Kutzner, P. Malfertheiner, and M. P.A. Ebert Molecular analysis of APC promoter methylation and protein expression in colorectal cancer metastasis Carcinogenesis, January 1, 2005; 26(1): 37 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Muller, S. Millinger, H. Fiegl, G. Goebel, L. Ivarsson, A. Widschwendter, E. Muller-Holzner, C. Marth, and M. Widschwendter Analysis of Methylated Genes in Peritoneal Fluids of Ovarian Cancer Patients: A New Prognostic Tool Clin. Chem., November 1, 2004; 50(11): 2171 - 2173. [Full Text] [PDF] |
||||
![]() |
G. Clement, F. T. Bosman, C. Fontolliet, and J. Benhattar Monoallelic Methylation of the APC Promoter Is Altered in Normal Gastric Mucosa Associated with Neoplastic Lesions Cancer Res., October 1, 2004; 64(19): 6867 - 6873. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Widschwendter, G. Jiang, C. Woods, H. M. Muller, H. Fiegl, G. Goebel, C. Marth, E. Muller-Holzner, A. G. Zeimet, P. W. Laird, et al. DNA Hypomethylation and Ovarian Cancer Biology Cancer Res., July 1, 2004; 64(13): 4472 - 4480. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Maley, P. C. Galipeau, X. Li, C. A. Sanchez, T. G. Paulson, and B. J. Reid Selectively Advantageous Mutations and Hitchhikers in Neoplasms: p16 Lesions Are Selected in Barrett's Esophagus Cancer Res., May 15, 2004; 64(10): 3414 - 3427. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Deng, G.-A. Song, E. Pong, M. Sleisenger, and Y. S. Kim Promoter Methylation Inhibits APC Gene Expression by Causing Changes in Chromatin Conformation and Interfering with the Binding of Transcription Factor CCAAT-Binding Factor Cancer Res., April 15, 2004; 64(8): 2692 - 2698. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. McManus, A. Olaru, and S. J. Meltzer Biomarkers of Esophageal Adenocarcinoma and Barrett's Esophagus Cancer Res., March 1, 2004; 64(5): 1561 - 1569. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Brock, M. Gou, Y. Akiyama, A. Muller, T.-T. Wu, E. Montgomery, M. Deasel, P. Germonpre, L. Rubinson, R. F. Heitmiller, et al. Prognostic Importance of Promoter Hypermethylation of Multiple Genes in Esophageal Adenocarcinoma Clin. Cancer Res., August 1, 2003; 9(8): 2912 - 2919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-Y. Yang, T.-C. Liu, J.-G. Chang, P.-M. Lin, and S.-F. Lin JunB gene expression is inactivated by methylation in chronic myeloid leukemia Blood, April 15, 2003; 101(8): 3205 - 3211. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mareel and A. Leroy Clinical, Cellular, and Molecular Aspects of Cancer Invasion Physiol Rev, April 1, 2003; 83(2): 337 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sato, D. Shibata, N. Harpaz, Y. Xu, J. Yin, Y. Mori, S. Wang, A. Olaru, E. Deacu, F. M. Selaru, et al. Aberrant Methylation of the HPP1 Gene in Ulcerative Colitis-associated Colorectal Carcinoma Cancer Res., December 1, 2002; 62(23): 6820 - 6822. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Tokugawa, H. Sugihara, T. Tani, and T. Hattori Modes of Silencing of p16 in Development of Esophageal Squamous Cell Carcinoma Cancer Res., September 1, 2002; 62(17): 4938 - 4944. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Park, S. Schulz, J. Haaf, J. C. Kairys, and S. A. Waldman Ectopic Expression of Guanylyl Cyclase C in Adenocarcinomas of the Esophagus and Stomach Cancer Epidemiol. Biomarkers Prev., August 1, 2002; 11(8): 739 - 744. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shen, N. Ahuja, Y. Shen, N. A. Habib, M. Toyota, A. Rashid, and J.-P. J. Issa DNA Methylation and Environmental Exposures in Human Hepatocellular Carcinoma J Natl Cancer Inst, May 15, 2002; 94(10): 755 - 761. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Trinh, T. I. Long, A. E. Nickel, D. Shibata, and P. W. Laird DNA Methyltransferase Deficiency Modifies Cancer Susceptibility in Mice Lacking DNA Mismatch Repair Mol. Cell. Biol., May 1, 2002; 22(9): 2906 - 2917. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Sato, N. Harpaz, D. Shibata, Y. Xu, J. Yin, Y. Mori, T.-T. Zou, S. Wang, K. Desai, A. Leytin, et al. Hypermethylation of the p14ARF Gene in Ulcerative Colitis-associated Colorectal Carcinogenesis Cancer Res., February 1, 2002; 62(4): 1148 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Lehmann, F. Langer, H. Feist, S. Glockner, B. Hasemeier, and H. Kreipe Quantitative Assessment of Promoter Hypermethylation during Breast Cancer Development Am. J. Pathol., February 1, 2002; 160(2): 605 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Wong, T. G. Paulson, L. J. Prevo, P. C. Galipeau, G. Longton, P. L. Blount, and B. J. Reid p16INK4a Lesions Are Common, Early Abnormalities that Undergo Clonal Expansion in Barrett's Metaplastic Epithelium Cancer Res., November 1, 2001; 61(22): 8284 - 8289. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F Costello and C. Plass Methylation matters J. Med. Genet., May 1, 2001; 38(5): 285 - 303. [Abstract] [Full Text] |
||||
![]() |
G. Hoon Kang, Y.-H. Shim, H.-Y. Jung, W. Ho Kim, J. Y. Ro, and M.-G. Rhyu CpG Island Methylation in Premalignant Stages of Gastric Carcinoma Cancer Res., April 1, 2001; 61(7): 2847 - 2851. [Abstract] [Full Text] |
||||
![]() |
M. Esteller, P. G. Corn, S. B. Baylin, and J. G. Herman A Gene Hypermethylation Profile of Human Cancer Cancer Res., April 1, 2001; 61(8): 3225 - 3229. [Abstract] [Full Text] |
||||
![]() |
C. A. Eads, R. V. Lord, K. Wickramasinghe, T. I. Long, S. K. Kurumboor, L. Bernstein, J. H. Peters, S. R. DeMeester, T. R. DeMeester, K. A. Skinner, et al. Epigenetic Patterns in the Progression of Esophageal Adenocarcinoma Cancer Res., April 1, 2001; 61(8): 3410 - 3418. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |