Cancer Research Meeting Calendar  Jordan
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takao, S.
Right arrow Articles by Aikou, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takao, S.
Right arrow Articles by Aikou, T.
[Cancer Research 60, 5345-5348, October 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

Suppression of Metastasis by Thymidine Phosphorylase Inhibitor1

Sonshin Takao2, Shin-ichi Akiyama, Akihiro Nakajo, Hiroyoshi Yoh, Masaki Kitazono, Shoji Natsugoe, Kazutaka Miyadera, Masakazu Fukushima, Yuji Yamada and Takashi Aikou

First Department of Surgery [S. T., A. N., H. Y., M. K., S. N., T. A.], Department of Cancer Chemotherapy, Institute for Cancer Research [S-i. A.], Kagoshima University School of Medicine, 8-35-1 Sakuragaoka, Kagoshima 890-8520, Japan, and Taiho Pharmaceutical Co., Ltd., [K. M., M. F., Y. Y.] Saitama 357, Japan


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
We developed a novel inhibitor of thymidine phosphorylase (TP), 5-chloro-6-[1-(2-iminopyrrolidinyl) methyl] uracil hydrochloride (TPI), that is about 1000-fold more active than 6-amino-5-chlorouracil, one of the most potent TP inhibitors. TPI inhibited the high chemotactic motility and basement membrane invasion of KB/TP cells, a TP-positive clone transfected with Rous sarcoma virus (RSV)/TP, to the levels seen in KB/CV cells, a control clone transfected with RSV. In nude mice, oral administration of TPI suppressed not only macroscopic liver metastases of highly metastatic KB/TP cells but also the level of human ß-globin as a molecular marker of micrometastases in the livers of the mice. These findings demonstrate that TP plays a key role in the invasiveness and metastasis of TP-expressing solid tumors and suggest that TPI might be a novel antimetastatic agent for blood-borne metastasis.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
TP3 catalyzes the reversible phosphorolysis of thymidine, deoxyuridine, and their analogues to their respective bases and 2-deoxyribose-1 phosphate (1) . TP also catalyzes the transfer of deoxyribose from one deoxynucleoside to another base to form a second deoxynucleoside (2) . In mammals, TP is a homodimer of Mr 55,000 (3) . We found that TP is identical to PD-ECGF (4 , 5) , which stimulates chemotaxis and [3 H]thymidine incorporation into endothelial cells in vitro, and has angiogenic activity in vivo (6 , 7) . We also demonstrated that TP enzymatic activity is indispensable for its angiogenic activity (7 , 8) . Among the products of thymidine degradation by TP, 2-deoxy-D-ribose, a dephosphorylated product derived from 2-deoxy-D-ribose-1-phosphate, has chemotactic activity in vitro and angiogenic activity in vivo (8) . These findings suggest that the products of TP activity stimulate the chemotaxis of endothelial cells and possibly other cells, causing angiogenesis. Transfection of PD-ECGF/TP into transformed fibroblasts in nude mice results in increased tumor vascularity (6) . Overexpression of TP in MCF-7 cells transfected with TP cDNA confers a growth advantage on these cells when they are xenografted into nude mice, but not on their growth in vitro, suggesting an increased angiogenic activity for TP-expressing cells (9) . Areas of high blood velocity in ovarian tumors are associated with increased expression of PD-ECGF/TP (10) . Compared with adjacent nonneoplastic tissues, higher levels of TP are found in a variety of malignant tumors (11 , 12) . Recently, we showed that in addition to angiogenesis, TP has some other roles in tumor growth. TP confers resistance to hypoxia-induced apoptosis of KB cells, and the degradation products of thymidine are involved in this resistance (13) .

We synthesized a novel inhibitor of TP, TPI (Ki = 2 x 10-8 M), that is about 1000-fold more active than 6-amino-5-chlorouracil (one of the most potent TP inhibitors) but does not inhibit uridine phosphorylase, another enzyme involved in pyrimidine nucleoside metabolism (14) . In the mouse dorsal air sac assay model, TPI completely suppressed the angiogenesis induced by KB/TP cells, which are KB cells transfected with RSV/TP (14) . The growth rate of cultured KB/TP cells was similar to that of KB/CV cells, which are KB cells transfected with RSV, and TPI (500 µM) did not affect the growth rate of either cell line (13) . However, KB/TP tumors in nude mice grew significantly faster than KB/CV tumors (14) , and TPI decreased the growth rate of KB/TP tumors considerably. These results suggest that TP plays an important role in tumor growth by inducing angiogenesis and decreasing the proportion of apoptotic cells, and TPI probably suppresses these activities of TP.

Here we present the first evidence that TPI suppresses chemotactic motility and basement membrane invasion of TP-expressing carcinoma cells in vitro. Furthermore, TPI suppressed liver metastases in nude mice. These results strongly indicate that TPI is a novel antimetastatic agent for blood-borne metastasis of TP-expressing carcinoma cells.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Chemical.
TPI, an inhibitor of TP, was synthesized by Taiho Pharmaceutical Co., Ltd.

Cell Lines.
Full-length human PD-ECGF cDNA was kindly supplied by Drs. K. Miyazono and C. H. Heldin (Ludwig Cancer Research Institute, Uppsala, Sweden). A KpnI-EcoRI fragment from ppL8 encompassing the PD-ECGF/TP coding region was cloned between the KpnI and EcoRI restriction sites of pT7T318U (Pharmacia, Uppsala, Sweden). An XbaI-EcoRI fragment from pT7T318U was then cloned between the NheI and EcoRI restriction sites of expression vector pBK-RSV (Stratagene, La Jolla, CA; RSV/TP). RSV/TP or RSV vector was transfected by electroporation into KB-3-1 cells, which were derived from a human epidermoid carcinoma and do not express TP. KB/TP cells, which had been transfected with RSV/TP, and KB/CV cells, which had been transfected with RSV, were examined. KB/TP cells expressed a protein that was detected with an anti-TP monoclonal antibody by immunoblotting analysis, whereas KB/CV cells did not express detectable amounts of TP. After selecting transfectants with Geneticin, expression of PD-ECGF/TP in each clone was examined by immunoblotting with anti-PD-ECGF/TP antibody. Thus, KB/TP cells, the TP-positive clone transfected with RSV/TP, and KB/CV cells, the TP-negative clone transfected with RSV, were established. The growth curves of these cell lines at 37°C in a 5% CO2 humidified atmosphere in RPMI 1640 supplemented with 10% FCS were the same.

Immunoblotting Analysis.
Cells were homogenized in lysis buffer that consisted of Tris-HCl (pH 7.5), 2 mM (p-amidinophenyl)-methanesulfonyl fluoride, 1% Triton X-100, and 0.02% 2-mercaptoethanol. Lysates were centrifuged at 15,000 x g for 20 min at 4°C, and the supernatants were used for immunoblotting.

Samples were resolved by 11% SDS-PAGE. Proteins in the gel were transferred electrophoretically onto polyvinylidene difluoride membranes (Immobilon-P transfer membrane; Millipore, Bedford, MA) with a Bio-Rad TRANSBLOT SD. The membranes were incubated with horseradish peroxidase-conjugated anti-PD-ECGF/TP antibody and developed using an enhanced chemiluminescence Western blotting detection system (Amersham, Buckinghamshire, United Kingdom).

Invasion MTT Assay.
The invasion MTT assay was performed as described previously (15) . Briefly, modified Chemotaxicell chambers (Kubota Co., Tokyo, Japan) treated with paraffin as a water repellent were used as the upper wells. Each filter was coated with 70 µl of a 50-fold dilution (0.2 mg/ml) of Matrigel (Collaborative Research Co., Bedford, MA) for tumor cells to invade. After 72 h of incubation, cells that invaded the lower surface and penetrated the Matrigel-coated filter were counted by the MTT (Sigma Chemical Co., St. Louis, MO) assay. A conditioned medium obtained by incubating NIH3T3 cells for 24 h in serum-free medium (Azinomoto Co., Tokyo, Japan) was used as a chemoattractant. DMSO (Nacalai Tesque, Kyoto, Japan) was used to dissolve the formazan crystals of MTT.

PI.
We defined the in vitro invasive ability of the tumor cells in the invasion MTT assay as PI. A standard curve was calculated from the absorbance of 1 x 104 cells, and the PI was calculated using the following formula.

(1)

Chemotaxis Assay.
The chemotaxis assay was carried out under the same conditions described for the invasion MTT assay using Chemotaxicell chambers (Kubota Co.). Cells were resuspended in RPMI 1640 supplemented with 10% FCS. The cells moved through the pores toward the attractant (conditioned medium from NIH3T3 albino cells) and were counted using the MTT assay. The percentage of chemotaxis was calculated as the number of attracted cells divided by the number of total cells.

i.p. Injection of KB/CV and KB/TP Cells in Nude Mice.
KB/CV and KB/TP cells were suspended in PBS at 106 cells/ml, and cells (105 cells/0.1 ml) were injected into the peritoneal cavity of 7–8-week-old male BALB/c nude mice. The survival of tumor-bearing nude mice was determined.

Experimental Liver Metastasis of KB/TP Cells in Nude Mice.
Male 7–8-week-old BALB/c nude mice were anesthetized with Nembutal (DAINIPPON Pharmaceutical Co., Toyko, Japan), and their spleens were exposed through small abdominal incisions. Then, 50 µl of PBS containing 1 x 105 KB/TP cells were injected into the spleens. One min later, the spleens were removed, and the abdominal incisions were closed. After injection of KB/TP cells, TPI (100 mg/kg/day) was administered p.o. for 4 weeks to the TPI-treated group, whereas pure distilled water was given to the control group. To detect micrometastasis in the liver by PCR, whole livers were removed 3, 7, 14, 19, and 24 days after the cells were injected.

Detection of Human ß-Globin by Quantitative PCR.
Quantitative PCR was performed using real-time TaqMan technology (16) and analyzed on a Model 7700 Sequence Detector (Applied Biosystems, Foster City, CA). Three primers, a common forward primer and two different reverse primers that discriminate between the two cDNAs, were used: (a) forward primer, CCAGAGGAATTTGGACAGAACATTGG; (b) reverse primer, AGGAGAAGTCTGCCGTTACTGC; and (c) TaqMan probe, ACCAACTTCATCCACGTTCACCTTGCC.

A hybridization probe that binds to the PCR products was labeled with a reporter dye, FAM, on the 5' nucleotide and a quencher dye, TAMURA, on the 3' nucleotide (17) . Fifty-µl reactions contained 100 ng of the DNA sample, 25 µl of 2*TaqMan universal master mix, each primer at a final concentration of 100 nM, and TaqMan probe at a final concentration of 200 nM. TaqMan universal master mix is optimized for TaqMan reactions and contains AmpliTaq Gold DNA polymerase, AmpErase UNG, deoxynucleotide triphosphates with dUTP, passive reference, and optimized buffer components (Perkin-Elmer, Foster City, CA). Thermal cycler parameters included 2 min at 50°C and 10 min at 95°C followed by 40 cycles of 30 s at 95°C, 2 min at 58°C, and 30 s at 72°C. Real-time PCR reactions were placed in 0.2-ml MicroAmp optical tubes with caps (Perkin-Elmer Applied Biosystems Division, Foster City, CA), and data were collected using the ABI PRISM 7700 SDS. The first three lanes contained serial dilutions of standard DNA in triplicate with known amounts of input cDNA from KB/TP cells (1 x 107, 2 x 106, 4 x 105, 8 x 104, 1.6 x 104, 3.2 x 103 , 6.4 x 102, and 1.3 x 102 molecules/well diluted in the water from a stock solution of known concentration) and three "no template" controls to create standard curves. All PCRs for human ß-globin cDNA quantification were performed using standard curves.

Statistical Analysis.
The Mann-Whitney U test, Kruskal-Wallis test, and Spearman rank correlation test were used for statistical analysis; P < 0.05 was considered significant.


    Results and Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 
Malignant Behavior of KB/TP and KB/CV Cells in Nude Mice.
Nude mice injected i.p. with KB/TP cells (106 cells) had bloody ascites 4–5 weeks later, and all of these mice died by 5 weeks after the injection. Nude mice injected i.p. with KB/CV cells had longer survival times (median survival time, 26 weeks) than those injected with KB/TP cells (median survival time, 3 weeks), and this difference was significant (P < 0.0001; Fig. 1Citation ). Thus, the potential for malignant behaviors is higher in KB/TP cells than in KB/CV cells, suggesting that TP plays an important role in tumor progression.



View larger version (16K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Comparison of survival curves of nude mice injected i.p. with KB/TP and nude mice injected i.p. with KB/CV cells (106 cells/mouse).

 
Toxicity of TPI.
To investigate the toxicity of TPI, the body weights of nude mice were determined after oral administration of 50 or 100 mg/kg/day TPI. There was no difference between the body weights of TPI-treated and control nude mice. In addition, TPI did not cause symptoms such as diarrhea in nude mice.

Relationship between TP Expression and Chemotactic Motility or Basement Membrane Invasion.
The chemotactic motility of KB/TP cells was much higher than that of KB/CV cells. TPI inhibited the motility level of KB/TP cells to that of KB/CV cells, whereas it did not significantly affect the motility of KB/CV cells (Fig. 2a)Citation . The PI level of KB/TP cells without TPI treatment was higher than that of KB/CV cells. TPI treatment suppressed the PI level of KB/TP cells to that of KB/CV cells in a dose-dependent manner, whereas any dose of TPI did not suppress the PI of KB/CV cells that did not express TP (Fig. 2b)Citation . In our clinical study, the high PI rates of human gastrointestinal carcinomas were strongly correlated with liver metastases, suggesting that the basement membrane invasion is associated with blood-borne metastasis (15) . These results suggest that TP plays an important role in invasion and metastasis through high chemotactic motility and basement membrane invasion in TP-expressing carcinoma cells.



View larger version (36K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. A, comparison of cell motility of control and TPI-treated KB/TP [{square} (n = 6) and {blacksquare} (n = 6), respectively] and KB/CV cells [ (n = 6) and (n = 6), respectively] by the chemotaxis assay. The percentage of motility of KB/TP cells was significantly higher than that of KB/CV cells (P < 0.001), and the motility of both increased from 3 to 24 h. TPI (100 µM) significantly suppressed the percentage of motility of KB/TP cells to at least that of KB/CV cells (*, P < 0.005). There was no significant difference in motility between control and TPI-treated KB/CV cells. B, comparison of basement membrane invasion of KB/CV and KB/TP cells with/without TPI treatment using the invasion MTT assay. The PI of KB/TP cells (n = 6) was significantly higher than that of KB/CV cells (n = 6). TPI suppressed the PI of KB/TP cells to the level of KB/CV cells in a dose-dependent manner. TPI did not significantly affect the PI of KB/CV cells. * versus PI of KB/TP without TPI treatment, P < 0.001.

 
Suppression of Liver Metastases by TPI.
We determined whether TPI can suppress blood-borne metastasis such as hepatic metastasis of KB/TP cells in nude mice. KB/TP cells (1 x 105) were injected into the spleens of nude mice, the spleens were removed 1 min later, and TPI (100 mg/kg/day) was administered p.o. to the mice for 4 weeks. To detect micrometastasis in the liver, whole livers were removed every 4 days. Expression of human ß-globin as a molecular marker in the livers of nude mice was detected by PCR at 3, 7, 14, 19, and 24 days after injection of the KB/TP cells into the spleens. At day 24, the expression level of human ß-globin mRNA in the livers of the control group was 6-fold higher than that in the livers of the TPI-treated group (Table 1)Citation . The number of macroscopic metastatic nodules (115 ± 58) in the livers of mice injected with KB/TP cells was significantly higher than that in the livers of mice injected with KB/CV cells. TPI significantly lowered the number of the nodules to 18 ± 14. Injection of KB/CV cells resulted in a small number of metastatic nodules, and TPI hardly affected the number of the nodules (Fig. 3)Citation . These findings clearly demonstrated that TP plays a key role in high invasiveness and blood-borne metastasis of KB/TP cells. The action of TPI seems to be limited to TP-expressing cells because TPI did not affect cell motility, invasion, and metastasis of KB/CV cells that do not express TP.


View this table:
[in this window]
[in a new window]

 
Table 1 Comparison of the levels of human ß-globin mRNA in the livers of control and TPI-treated nude mice by quantitative PCR

A standard curve of serial dilutions of plasmid DNA of human ß-globin was used to calculate the relative number of ß-globin mRNA molecules from the CT value. The fold difference between the number of human ß-globin mRNA molecules from the control and TPI-treated nude mice is shown.

 


View larger version (21K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 3. Effect of TPI treatment on liver metastases in nude mice after intrasplenic injection of KB/CV or KB/TP cells. Intrasplenic injection of KB/TP cells resulted in a large number of metastatic nodules in the livers of nude mice 4 weeks after the injection, whereas injection of KB/CV cells resulted in a significantly smaller number of nodules (P < 0.0005). TPI (100 mg/kg/day) treatment significantly decreased the number of metastatic nodules in the liver of the group injected with KB/TP cells (18 ± 14) as compared with the control group (115 ± 58; P < 0.001). TPI did not significantly affect the liver metastasis of KB/CV cells.

 
When tumors reach a few millimeters in size, new capillaries develop that allow for rapid tumor growth. These new vessels may facilitate tumor invasion into the vasculature and subsequent metastasis; therefore, angiogenesis correlates with the probability of metastases (18) . Recent studies have demonstrated that angiogenesis in human solid tumors is a risk factor for metastasis and recurrence (19 , 20) . Consequently, the inhibition of tumor angiogenesis has been suggested as a new antimetastatic and anticancer therapy. This study suggests that high motility and basement membrane invasive potential as well as high angiogenic activity (8) and resistance to hypoxia-induced apoptosis of KB/TP cells (13 , 14) confer high liver metastatic activity on the cells.

In summary, our findings indicate that the inhibition of TP activity by TPI causes suppression of motility and invasion in addition to enhanced hypoxia-induced apoptosis and inhibition of angiogenesis. These may be the reasons why TPI inhibits blood-borne metastasis. TPI might be valuable as an antimetastatic agent for treating patients with TP-expressing tumors.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported in part by grants-in-aid for scientific research and for cancer research from the Ministry of Science and Culture, Japan. Back

2 To whom requests for reprints should be addressed, at First Department of Surgery, Kagoshima University School of Medicine, 8-35-1 Sakuragaoka, Kagoshima 890-8520, Japan. Phone: 81-99-275-5359; Fax: 81-99-265-7426; E-mail: sonshin{at}med6.kufm.kagoshima-u.ac.jp Back

3 The abbreviations used are: TP, thymidine phosphorylase; TPI, 5-chloro-6-[1-(2-iminopyrrolidinyl) methyl] uracil hydrochloride; PD-ECGF, platelet-derived endothelial cell growth factor; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PI, percent invasion; RSV, Rous sarcoma virus; FAM, 6-carboxy-fluorescein. Back

Received 2/15/00. Accepted 8/14/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results and Discussion
 REFERENCES
 

  1. Iltzsch M. H., el Kouni M. H., Cha S. Kinetic studies of thymidine phosphorylase from mouse liver. Biochemistry, 24: 6799-6807, 1986.
  2. Gallo R. C., Perry S., Breitman T. R. The enzymatic mechanisms for deoxythymidine synthesis in human leukocytes. I. Substrate inhibition by thymine and activation by phosphate or arsenate. J. Biol. Chem., 242: 5059-5068, 1967.[Abstract/Free Full Text]
  3. Desgranges C., Razaka G., Rabaud M., Bricaud H. Catabolism of thymidine in human blood platelets: purification and properties of thymidine phosphorylase. Biochim. Biophys. Acta, 654: 211-218, 1981.[Medline]
  4. Furukawa T., Yosimura A., Sumizawa T., Haraguchi M., Akiyama S., Fukui K., Ishizawa M., Yamada Y. Angiogenic factor. Nature (Lond.), 356: 668 1992.[Medline]
  5. Sumizawa T., Furukawa T., Haraguchi M., Yoshimura A., Takeyasu A., Ishizawa M., Yamada Y., Akiyama S. Thymidine phosphorylase activity associated with platelet-derived endothelial cell growth factor. J. Biochem. (Tokyo), 114: 9-14, 1993.[Abstract/Free Full Text]
  6. Ishikawa F., Miyazono K., Hellman U., Drexler H., Wernstedt C., Hagiwara K., Usuki K., Takaku F., Risau W., Heldin C. H. Identification of angiogenic activity and the cloning and expression of platelet-derived endothelial cell growth factor. Nature (Lond.), 338: 556-562, 1989.
  7. Haraguchi M., Miyadera K., Uemura K., Sumizawa T., Furukawa T., Yamada K., Akiyama S., Yamada Y. Angiogenic activity of enzymes. Nature (Lond.), 368: 198 1994.[Medline]
  8. Miyadera K., Sumizawa T., Haraguchi M., Yoshida H., Konstanty W., Yamada Y., Akiyama S. Role of thymidine phosphorylase activity in the angiogenic effect of platelet-derived endothelial cell growth factor/thymidine phosphorylase. Cancer Res., 55: 1687-1690, 1995.[Abstract/Free Full Text]
  9. Moghaddam A., Zhang H. T., Fan T. P., Hu D. E., Lees V. C., Turley H., Fox S. B., Gatter K. C., Harris A. L., Bicknell R. Thymidine phosphorylase is angiogenic and promotes tumor growth. Proc. Natl. Acad. Sci. USA, 92: 998-1002, 1995.[Abstract/Free Full Text]
  10. Reynolds K., Farzaneh F., Collins W. P., Campbell S., Bourne T. H., Lawton F., Moghaddam A., Harris A. L., Bicknell R. Association of ovarian malignancy with expression of platelet-derived endothelial cell growth factor. J. Natl. Cancer Inst., 86: 1234-1238, 1994.[Abstract/Free Full Text]
  11. Yoshimura A., Kuwazuru Y., Furukawa T., Yoshida H., Yamada K., Akiyama S. Purification and tissue distribution of human thymidine phosphorylase; high expression in lymphocytes, reticulocytes and tumors. Biochim. Biophys. Acta, 1034: 107-113, 1990.[Medline]
  12. Takebayashi Y., Yamada K., Miyadera K., Sumizawa T., Furukawa T., Kinoshita F., Aoki D., Okumura H., Yamada Y., Akiyama S., Aikou T. The activity and expression of thymidine phosphorylase in human solid tumours. Eur. J. Cancer, 32A: 1227-1232, 1996.
  13. Kitazono M., Takebayashi Y., Ishitsuka K., Takao S., Tani A., Furukawa T., Miyadera K., Yamada Y., Aikou T., Akiyama S. Prevention of hypoxia-induced apoptosis by the angiogenic factor thymidine phosphorylase. Biochem. Biophys. Res. Commun., 253: 797-803, 1998.[Medline]
  14. Matsushita S., Nitanda T., Furukawa T., Sumizawa T., Tani A., Nishimoto K., Akiba S., Miyadera K., Fukushima M., Yamada Y., Yoshida H., Kanzaki T., Akiyama S. The effect of a thymidine phosphorylase inhibitor on angiogenesis and apoptosis in tumors. Cancer Res., 59: 1911-1916, 1999.[Abstract/Free Full Text]
  15. Uemura K., Takao S., Aikou T. In vitro determination of basement membrane invasion predicts liver metastases in human gastrointestinal carcinoma. Cancer Res., 58: 3727-3731, 1998.[Abstract/Free Full Text]
  16. Lee L. G., Connell C. R., Bloch W. Allelic discrimination by nick-translation PCR with fluorogenic probes. Nucleic Acids Res., 21: 3761-3766, 1993.[Abstract/Free Full Text]
  17. Heid C. A., Stevens J., Livak K. J., Williams P. M. Real time quantitative PCR. Genome Res., 6: 986-994, 1996.[Abstract/Free Full Text]
  18. Liotta L., Kleinerman J., Saidel G. M. Quantitative relationships of intravascular tumor cells, tumor vessels, and pulmonary metastases following tumor implantation. Cancer Res., 34: 997-1004, 1974.[Abstract/Free Full Text]
  19. Weidner N., Semple J. P., Welch W. R., Folkman J. Tumor angiogenesis and metastasis: correlation in invasive breast carcinoma. N. Eng. J. Med., 324: 1-8, 1991.[Abstract]
  20. Horak E. R., Leek R., Klenk N., LeJeune S., Smith K., Stuart N., Greenall M., Stepniewska K., Harris A. L. Angiogeneis, assessed by platelet/endothelial cell adhesion molecular antibodies, as an indicator of node metastases and survival in breast cancer. Lancet, 340: 1120-1124, 1992.[Medline]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
H. Lu, R. S. Klein, and E. L. Schwartz
Antiangiogenic and Antitumor Activity of 6-(2-Aminoethyl)Amino-5-Chlorouracil, a Novel Small-Molecule Inhibitor of Thymidine Phosphorylase, in Combination with the Vascular Endothelial Growth Factor-Trap
Clin. Cancer Res., August 15, 2009; 15(16): 5136 - 5144.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
E. J. Yu, Y. Lee, S. Y. Rha, T. S. Kim, H. C. Chung, B. K. Oh, W. I. Yang, S. H. Noh, and H.-C. Jeung
Angiogenic Factor Thymidine Phosphorylase Increases Cancer Cell Invasion Activity in Patients with Gastric Adenocarcinoma
Mol. Cancer Res., October 1, 2008; 6(10): 1554 - 1566.
[Abstract] [Full Text] [PDF]


Home page
Jpn J Clin OncolHome page
T. Takayama, S. Mugiya, T. Sugiyama, T. Aoki, H. Furuse, H. Liu, Y. Hirano, F. Kai, T. Ushiyama, and S. Ozono
High Levels of Thymidine Phosphorylase as an Independent Prognostic Factor in Renal Cell Carcinoma
Jpn. J. Clin. Oncol., September 1, 2006; 36(9): 564 - 569.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Kikuno, N. Moriyama-Gonda, T. Yoshino, T. Yoneda, S. Urakami, M. Terashima, M. Yoshida, H. Kishi, K. Shigeno, H. Shiina, et al.
Blockade of Paclitaxel-Induced Thymidine Phosphorylase Expression Can Accelerate Apoptosis in Human Prostate Cancer Cells
Cancer Res., October 15, 2004; 64(20): 7526 - 7532.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Nakajima, T. Gotanda, H. Uchimiya, T. Furukawa, M. Haraguchi, R. Ikeda, T. Sumizawa, H. Yoshida, and S.-i. Akiyama
Inhibition of Metastasis of Tumor Cells Overexpressing Thymidine Phosphorylase by 2-Deoxy-L-Ribose
Cancer Res., March 1, 2004; 64(5): 1794 - 1801.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
H. Seeliger, M. Guba, G. E. Koehl, A. Doenecke, M. Steinbauer, C. J. Bruns, C. Wagner, E. Frank, K.-W. Jauch, and E. K. Geissler
Blockage of 2-Deoxy-D-Ribose-Induced Angiogenesis with Rapamycin Counteracts a Thymidine Phosphorylase-Based Escape Mechanism Available for Colon Cancer under 5-Fluorouracil Therapy
Clin. Cancer Res., March 1, 2004; 10(5): 1843 - 1852.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Uchimiya, T. Furukawa, M. Okamoto, Y. Nakajima, S. Matsushita, R. Ikeda, T. Gotanda, M. Haraguchi, T. Sumizawa, M. Ono, et al.
Suppression of Thymidine Phosphorylase-mediated Angiogenesis and Tumor Growth by 2-Deoxy-L-ribose
Cancer Res., May 1, 2002; 62(10): 2834 - 2839.
[Abstract] [Full Text] [PDF]


Home page
INT J SURG PATHOLHome page
S.-i. Aishima, K.-i. Taguchi, K. Sugimachi, Y. Asayama, H. Nishi, M. Shimada, K. Sugimachi, and M. Tsuneyoshi
The Role of Thymidine Phosphorylase and Thrombospondin-1 in Angiogenesis and Progression of Intrahepatic Cholangiocarcinoma
International Journal of Surgical Pathology, January 1, 2002; 10(1): 47 - 56.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Takao, S.
Right arrow Articles by Aikou, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takao, S.
Right arrow Articles by Aikou, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online