Cancer Research AACR Membership  Advances in Breast Cancer Research
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, G.-J.
Right arrow Articles by Couch, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, G.-J.
Right arrow Articles by Couch, F. J.
[Cancer Research 60, 5371-5375, October 1, 2000]
© 2000 American Association for Cancer Research


Advances in Brief

17q23 Amplifications in Breast Cancer Involve the PAT1, RAD51C, PS6K, and SIGMA1B Genes1

Guo-Jun Wu, Colleen S. Sinclair, John Paape, James N. Ingle, Patrick C. Roche, C. David James and Fergus J. Couch2

Departments of Laboratory Medicine and Pathology [G-J. W., C. S. S., J. P., P. C. R., C. D. J., F. J. C.], Biochemistry and Molecular Biology [F. J. C.], and Oncology [J. N. I.], Mayo Clinic and Foundation, Rochester, Minnesota 55905


    ABSTRACT
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Amplification of the 17q23 region occurs frequently in breast tumors. To characterize the structure of 17q23 amplicons and to identify oncogene targets associated with this alteration, we performed a copy number analysis of 87 17q23 localized expressed sequence tags in seven breast cancer cell lines. Three major regions of amplification were detected in the MCF7 and BT474 cell lines. Amplification of at least one of four known genes (PAT1, PS6K, RAD51C, and SIGMA1B) was detected in the cell lines and in 28% of 94 breast tumors. In most cases, these four genes were overexpressed when amplified, but there was a particularly good association between amplification of the SIGMA1B gene and elevated expression in tumors, which suggested a possible role for this gene in tumor progression. Our data show that this region contains at least four independent targets of amplification, which suggests that there is considerable variability in the structure of the 17q23 amplicon.


    Introduction
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Gene amplification is a mechanism allowing for increased expression of critical genes involved in initiation and progression of cancer. This is particularly important in breast tumors, in which a number of is oncogenes are activated by amplification. These include the HER-2 (17q12), c-MYC (8q24), PRAD1/CYCLIN D (11q13), FGFR-1 (8p12), and FGFR-2 (10q24) oncogenes. Furthermore, the results of comparative genome hybridization studies suggest that several additional amplification targets are yet to be identified in breast cancer (1 , 2) . Among regions implicated by comparative genome hybridization, chromosome 17q23 has been shown to be amplified in up to 20% of primary breast tumors (1) , in 87% of breast tumors containing BRCA2 mutations, and in 50% of tumors containing BRCA1 mutations (3) . Increased copy number of 17q23 has also been found in pancreatic adenocarcinoma (4) , bladder carcinoma (5) , neuroblastoma (6) , and hepatocellular carcinoma (7) , which suggests that the overexpression of a target gene or genes in this region contributes to the development of several cancers. Recently, the PS6K (p70 S6 kinase) gene was identified as a target of amplification in this region (8) in both breast cancer cell lines and primary breast tumors. However, fluorescence in situ hybridization studies suggest that at least two separate regions of 17q23 undergo amplification in breast cancer (9) . To characterize the structure of the 17q23 amplicon and to identify other candidate oncogenes from the region, we performed a systematic copy number analysis of 87 17q23 localized ESTs3 in seven breast cancer cell lines. We identified three regions of amplification, two in the MCF7 cell line, and one in the BT474 cell line. Four known genes, PAT1 (microtubule interacting protein that interacts with amyloid precursor protein tail gene) (10 ), PS6K (p70 S6 ribosomal kinase gene) (11 ), RAD51C (human homologue of the Saccharomyces cerevisiae Rad55/57 DNA repair genes) (12 ), and SIGMA1B (AP-2 clathrin adaptor protein complex small subunit gene) (13 ) were amplified and overexpressed in breast cancer cell lines. These loci were also examined for the level and frequency of amplification as well as overexpression in 94 primary breast tumors. Our data suggest that 17q23 amplicons have a variable structure and may contain several gene targets the overexpression of which contributes to tumor progression.


    Materials and Methods
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Cell Lines and Tumors.
The breast cancer cell lines examined—MDA-MB157, MDA-MB361, MDA-MB468, MCF7, BT474, UACC812, UACC893—were obtained from American Type Culture Collection. A total of 94 primary infiltrating ductal adenocarcinomas of the breast were obtained from patients undergoing surgical treatment for breast cancer at the Mayo Clinic (Rochester, MN) between the years 1992–1997. Each tumor used in this study was determined to contain greater than 70% tumor cells by H&E staining. Among these specimens, 63 were stage 2, 28 were stage 3, and 3 were diagnosed as stage 4. All of the tumors were high grade.

Hybridization Probes.
A total of 87 ESTs covering the 17q23 region were selected from the GeneMap ’99 database.4 PCR primers for each EST were designed using the sequences of the ESTs and the PRIMER 3 software. PCR was carried out on genomic DNA or cDNA synthesized from human brain and testis RNA (Clontech) by standard conditions. All of the PCR conditions are available from the authors on request. PCR products were purified, labeled with [{alpha}-32P]dCTP by random primer labeling (Life Technologies). Primers for amplification of cDNA fragments from the four known genes are as follows: PS6KF, aat tga ttc ctc gcg aca tc; PS6KR, ttg gga tgt ttt tca taa tga gc; RAD51CF, gaa ttc gag cca cca tgc gcg gga aga cg; RAD51CR, gga tcc tta taa ttc ttc ctc tgg gtc; PAT1F, tgt cca taa atc tca gga atg; PAT1R, tat cac aat gct ggt tac aaa; SIGMA1B F, ctgc aaa aat ggt atg tcc c; SIGMA1B R, tcc caa aag aaa ctc atc ca.

Southern and Northern Blotting.
Genomic DNA from the seven breast cancer cell lines and 94 primary breast tumors was extracted as described previously (8) . A total of 5 µg of DNA for each sample was digested with EcoRI, electrophoresced on an agarose gel and transferred to nylon membrane with 10x SSC. Southern hybridization was carried out under standard conditions using a formamide-based hybridization solution at 42°C. GAPDH was used as a control probe to assess loading differences on the blots. Total RNA from cell lines was extracted by Trizol separation (Life Technologies). A total of 15 µg of each RNA sample was electrophoresced and transferred to a positively charged nylon membrane (Boehringer Mannheim). Northern hybridization was carried out in Quick Hybridization Solution according to the manufacturer’s instructions (Clontech). GAPDH was again used as a control probe to assess loading differences on the blots. Signals from Southern and Northern blots were measured using a Molecular Dynamics PhosphorImager. Amplification levels were quantitated by adjusting for background in the same lane, followed by normalizing a ratio of the gene-specific signal:GAPDH signal for each sample with the same ratio from a normal DNA control on the same blot.

Semiquantitative RT-PCR.
PCR primers were designed using cDNA sequence for each of the PS6K, RAD51C, PAT1, and SIGMA1B genes as follows: PS6KF, gacaatgagtggttaagcat; PS6KR, tcttgtttcaccttgcagga; RAD51CF, cctccgagcttagcaaagaa; RAD51CR, ccacccccaagaatatcatc; SIGMA1BF, agaccgttttagcacggaaa; SIGMA1BR, gttcacagacactgccgaaa; PAT1F, tatttggcacgggatcattt; PAT1R, tgccaaatcttcatgagctg. RNA was prepared from each of 94 frozen breast tumors as follows: each tumor was mounted in O.C.T. compound (Sakura Finetechnical) and 20 10-µm sections were cut on a cryostat. Sections were placed in 1 ml of Trizol reagent, and RNA was extracted by standard protocol. The RNA was treated with RNase-free DNase to remove contaminating genomic DNA and was purified on a RNeasy Mini kit (Qiagen). A total of 1 µg of total RNA from each sample was used to generate single-stranded cDNA with random hexamer primers using the Superscript II cDNA Preparation kit (Life Technologies). The cDNA products were diluted to 100 µl in DEPC water. A total of 4 µl of cDNA was used as template for amplification with both gene-specific primers and GAPDH primers in a single PCR reaction. PCR of the 94 tumor cDNAs and the control cDNA from HMECs (Clonetics) were performed in parallel. PCR products were electrophoresced on an 8% nondenaturing polyacrylamide gel, stained with Sybr green, and scanned on a Molecular Dynamics PhosphorImager. Quantitation was performed as described for Southern blots by normalizing with a gene-specific:GAPDH ratio from HMEC cells.


    Results
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
Seven breast cancer cell lines previously determined to have one or more regions of 17q amplification were examined by Southern analysis with 87 EST probes from the chromosome 17q23 region. These 87 EST probes were selected so that only 1 EST from each known or novel gene located in the 368- to 432-cR interval on the GeneMap ‘99 radiation hybrid map of chromosome 17 was used in these studies. Following sequence analysis of Unigene sequences containing the ESTs, a single EST from each Unigene was selected. In addition, ESTs were excluded when two or more ESTs identified similarly sized mRNAs by Northern blot analysis, suggesting that the ESTs were derived from the same gene. Amplification of ESTs in cell lines was assessed by comparison with a normal genomic DNA control. ESTs with an average of at least five copies per cell (2.5-fold increase) were considered amplified. A total of 70 expressed sequences were found to have five or more copies in at least one of the seven cell lines. Of these, 45 had high-level amplification of 10 or more copies per cell, in at least one cell line. The great majority of these amplification events occurred in the MCF7 and BT474 cell lines, with 31 highly amplified ESTs in MCF7 and 24 highly amplified ESTs in BT474. Both of the cell lines show distinctive amplification patterns in comparison to the other cell lines. Two amplification regions were detected in MCF7 cell lines, with maximum levels of amplification of 30 and 50 gene copies (Fig. 1A)Citation . As previously reported, the ERBB2 gene on 17q12 is not amplified in MCF7 cells, which suggests that the 17q23 region can be amplified independently of the ERBB2 amplicon (8) . A single region of amplification was identified in BT474 cells (maximal amplification level of 29 gene copies; Fig. 1ACitation ), and this amplicon was located between the two regions of amplification in MCF7 cells. Several small regions of amplification were detected in the MDA-MB157, MDA-MB361, UACC812, and UACC893 cell lines, although none of these were elevated by more than 7.5-fold (data not shown).



View larger version (75K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 1. Amplification of ESTs from the 17q23 region in breast cancer cell lines. A, structure of the 17q23 amplicon; graphical representation of the amplification level of 72 ESTs from the 17q23 region in the MCF7 and BT474 cell lines. ESTs were chosen from the GeneMap ’99 database and are positioned accordingly in the profiles. Y axis, fold amplification relative to copy number in a normal DNA control; letters A, B, C, and D above line graphs: the RAD51C, PS6K, SIGMA1B, and PAT1 genes, respectively; numbers on the X axis, centi-ray (cR) positions from the GeneMap 1999 radiation hybrid map. B, Southern blots of the RAD51C, PS6K, SIGMA1B, and PAT1 genes on genomic DNA from seven breast cancer cell lines and normal peripheral blood lymphocytes. GAPDH, normalization control for each blot. C, Northern blot analysis of RAD51C, PS6K, SIGMA1B, and PAT1 gene expression levels using total RNA from seven breast cancer cell lines and normal HMECs. GAPDH, normalization control for each blot; numbers on right, sizes (kb) of mRNA species.

 
BLAST sequence analysis of the amplified ESTs from the amplicon resulted in identification of four known genes (PS6K, RAD51C, SIGMA1B, and PAT1) that were substantially amplified in at least one of the cell lines. As shown in Fig. 1BCitation and Table 1Citation , these genes have at least 20 copies in MCF7 cells. However, each gene has less than 10 copies in BT474 cells (Fig. 1, A and B)Citation and is not amplified in the UACC812 and UACC893 cell lines (Table 1)Citation .


View this table:
[in this window]
[in a new window]

 
Table 1 Amplification levels of four 17q23 genes in breast cancer cell lines

 
To determine whether gene amplification is consistently associated with increased expression, we examined transcript levels for PS6K, PAT1, RAD51C, and SIGMA1B in the breast cancer cell lines. The overexpression patterns of PS6K and PAT1 were consistent with their amplification patterns. Both of the genes were highly expressed in MCF7 but had relatively low levels of expression in BT474 and MDA-MB361 (Fig. 1C)Citation . RAD51C was highly expressed in MDA-MB361, MCF7, and BT474, although there was no evidence for gene amplification in BT474 cells (Fig. 1, B and C)Citation . SIGMA1B also showed relatively high expression in MDA-MB361 and BT474 cell lines, whereas low levels of expression were detected in the MCF7 cell line although it contains 20 gene copies (Fig. 1C)Citation .

To determine the incidence of amplification of these genes in primary tumors, we analyzed 94 infiltrating ductal adenocarcinomas of the breast for copy number increases. Representative Southern blots for each of the four genes on the tumor DNAs are shown in Fig. 2ACitation . Amplification (five or more gene copies) of at least one of the four genes was detected in 26 (28%) of 94 tumors. The PAT1 gene was amplified in 18 (19%) of 94 of the primary tumors, PS6K was amplified in 7 (7.5%) of the 93 informative tumors RAD51C was amplified in 7 (8%) of 86 informative tumors, and SIGMA1B was amplified in 11 (12%) of 92 primary tumors. High-level amplification (10 gene copies) was detected in 1 tumor for RAD51C, in 3 tumors for PAT1, in 3 tumors for SIGMA1B, and not in any tumors for PS6K (Fig. 2C)Citation . Of the 26 tumors with amplification, only 2 (2%) were amplified for all of the four genes, whereas 14 (54%) of 26 tumors were amplified for only one of the genes. The amplification status of each of the four genes in the 26 tumors that have amplification of at least one of the genes is shown in Fig. 2CCitation . Southern blot analysis with an ERBB2 probe revealed that only 24 (25%) of 94 tumors were amplified for ERBB2. Only 7 of these 24 were also amplified for one of the four genes in the 17q23 region. High levels of amplification for ERBB2 was detected in 6 (6%) of 94 of tumors, whereas only 2 of these 6 were coamplified with 17q23 genes.



View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Fig. 2. Amplification and overexpression of the RAD51C, PS6K, SIGMA1B, and PAT1 genes in primary breast tumors. A, Southern blots of the RAD51C, PS6K, SIGMA1B, and PAT1 genes on genomic DNA from a selection of 7 of 94 primary tumors and from normal HMECs (N). GAPDH, controls; *, tumors with amplification (5 or more gene copies). B, semiquantitative RT-PCR studies of the RAD51C, PS6K, SIGMA1B, and PAT1 genes using total RNA from 7 of 94 primary breast tumors, and from normal HMEC cells (N). A GAPDH control was coamplified with the specific genes in each PCR reaction; *, each tumor that contains an overexpressed gene. C, chart showing the 26 tumors that were amplified for at least one of the RAD51C, PS6K, SIGMA1B, and PAT1 genes.

 
As previously undertaken with the breast cancer cell lines, we evaluated the expression levels of the four genes in the 94 tumors to determine whether amplification resulted in overexpression. Representative RT-PCR products from tumors for each of the four genes are shown in Fig. 2BCitation . The PS6K gene was overexpressed (2.5-fold increase relative to control) in 28 (38%) of 74 informative tumors, RAD51C was overexpressed in 6 (9%) of 67 informative tumors, PAT1 was overexpressed in 10 (14%) of 71, and SIGMA1B was overexpressed in 56 (72%) of 72 informative tumors (Table 2)Citation . For each gene, there were instances of amplification in the absence of overexpression, and, conversely, overexpression was observed in the absence of amplification. Amplification did not result in overexpression of the RAD51C and PAT1 genes (Table 2)Citation . The SIGMA1B and PS6K genes were frequently overexpressed in the tumors in comparison to normal cells. In fact, high levels of expression (5-fold increase) for PS6K and SIGMA1B were detected in 9 and 36 tumors, respectively (data not shown). No correlations were observed between amplification or overexpression and stage of tumor for any of the genes, other than an apparent association between PS6K overexpression and increasing stage of tumor.


View this table:
[in this window]
[in a new window]

 
Table 2 Frequency of amplification and overexpression of four genes in breast tumors

 

    Discussion
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 
In this study, we have used Southern blotting of ESTs to examine the structural variability of an amplicon on chromosome 17q23 in breast tumors. We have localized the amplicon to the 370- to 405-cR interval of the GeneMap ’99 radiation hybrid database, a region of approximately 3 Mb. The results from our study indicate that there are multiple independent regions of amplification in both breast cancer cell lines and tumors. Thus, 17q23 amplicons appear to be large and complex, with multiple independently amplified gene targets that may contribute to tumor development and progression. Our results bare some similarity to previously published data from fluorescence in situ hybridization and DNA microarray analyses of these breast cancer cell lines (9 , 14) , although a third independent peak of amplification in the BT474 cell line was not detected using these other methods. Although these other studies were also based on GeneMap ’99 markers, the resolution of the data from these studies may be limited because only a subset of the available EST probes from the region were used.

The structure of the amplicon in MCF7 and BT474 cell lines as depicted in Fig. 1Citation does not necessarily represent an accurate map of the 17q23 region, because the positions of the ESTs in the region are based on radiation hybrid mapping, which cannot determine the relative position of adjacent markers or ESTs. Consequently, the number as well as the position of the amplification peaks identified here may change as this region is sequenced or physically mapped. However, the amplification data for the PAT1, PS6K, RAD51C, and SIGMA1B genes in breast tumors suggest that at least four independent amplification peaks exist on 17q23.

The data derived from this study support previous observations that 17q23 amplification is one of the most common genomic alterations in breast cancer. A total of 28% of the tumors that were studied here showed amplification of at least one of the four genes in the region. This high correlation between amplification of 17q23 and breast cancer suggests that gene targets in this region contribute to tumor development and progression when amplified. In addition, 17q23 amplification may not be a late event in breast tumor development, inasmuch as amplification was detected in stage 2 tumors and did not increase in frequency with increasing tumor stage. Unfortunately, the tumor specimens used in the study were all high-grade; therefore, we were unable to evaluate a correlation between grade of tumor and amplification frequency.

The 17q23 region contains several known genes including SUPT4H, PNUTL2, LPO, MPO, ZNF147, AKAP149, PSMC5, ICAM2, and GH1. Amplification of these genes was not detected in the seven breast cancer cell lines. However, amplification was observed for PS6K, PAT1, RAD51C, and SIGMA1B. PS6K is a serine-threonine kinase that is thought to regulate a wide array of cellular processes involved in mitogenic response including protein synthesis, translation of specific mRNA species, and cell cycle progression from G1 to S phase (11 , 15) . In a previous study, we reported that PS6K was amplified and overexpressed in breast cancer (8) , and we suggested PS6K as a candidate oncogene that is activated by amplification. In this study, we demonstrate that amplification often does not result in overexpression of PS6K in tumors, which suggests that amplified genes need not necessarily be transcriptionally active. However, because PS6K is frequently overexpressed in tumors, it cannot be eliminated as a candidate oncogene, although its activation does not necessarily occur through amplification. PAT1 is a microtubule-interacting protein that recognizes the basolateral sorting signal of amyloid precursor protein (10) . Our analysis of the PAT1 gene in breast tumors showed that this gene is frequently amplified, but that the amplification is rarely associated with overexpression. Thus, PAT1 is unlikely to be an oncogene that is activated by amplification of the 17q23 region. SIGMA1B protein has been shown to interact with clathrin adaptor-related proteins and to localize to paranuclear vesicles involved in intracellular transport (13) . In this study, we showed that SIGMA1B amplification in breast tumors is frequently associated with overexpression. In addition, SIGMA1B overexpression independent of amplification is commonly detected in breast tumors. Thus, SIGMA1B may be induced and activated by amplification and by transcriptional mechanisms and may contribute to tumor progression. RAD51C is a member of the RAD51 gene family, which encode strand-transfer proteins that are thought to be involved in both recombinational repair of DNA damage and meiotic recombination (12) . In this study, RAD51C was found to be amplified infrequently in breast tumors, and its amplification was not associated with elevated expression. Thus, RAD51C does not function as an amplification-activated oncogene in breast cancer.

In summary, we have delineated a large complex amplicon on chromosome 17q23 in breast cancer cell lines. In addition, the level and frequency of amplification of four known genes (RAD51C, PS6K, PAT1, and SIGMA1B) was determined in 94 breast tumors, and instances of independent amplification were identified. The data suggest that the region contains at least four independent targets of amplification. Continued study of the structure of 17q23 amplicons, as well as functional studies of the amplification target sequences will be necessary to elucidate the role of this genomic alteration in breast tumor development.


    FOOTNOTES
 
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 This work has been supported by Grant DAMD17-1-9282 (to F. J. C. and C. D. J.) from the U.S. Army Medical Research and Materiel Command and by the Breast Cancer Research Foundation (to J. N. I. and F. J. C.). Back

2 To whom requests for reprints should be addressed, at Mayo Clinic and Foundation, 1001A Guggenheim, 200 First Sreet S.W., Rochester, MN 55905. Phone: (507) 284-3623; Fax: (507) 266-0824; E-mail: couch.fergus{at}mayo.edu Back

3 The abbreviations used are: EST, expressed sequence tag; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RT-PCR, reverse transcription-PCR; HMEC, human mammary epithelial cell; cR, centi-ray. Back

4 Internet address: http://www.ncbi.nlm.nih.gov/genemap. Back

Received 3/31/00. Accepted 8/11/00.


    REFERENCES
 Top
 ABSTRACT
 Introduction
 Materials and Methods
 Results
 Discussion
 REFERENCES
 

  1. Kallioniemi A., Kallioniemi O. P., Piper J., Tanner M., Stokke T., Chen L., Smith H. S., Pinkel D., Gray J. W., Waldman F. M. Detection and mapping of amplified DNA sequences in breast cancer by comparative genomic hybridization. Proc. Natl. Acad. Sci. USA, 91: 2156-2160, 1994.[Abstract/Free Full Text]
  2. Isola J. J., Kallioniemi O. P., Chu L. W., Fuqua S. A., Hilsenbeck S. G., Osborne C. K., Waldman F. M. Genetic aberrations detected by comparative genomic hybridization predict outcome in node-negative breast cancer. Am. J. Pathol., 147: 905-911, 1995.[Abstract]
  3. Tirkkonen M., Johannson O., Agnarsson B. A., Olsson H., Ingvarsson S., Karhu R., Tanner M., Isola J., Barkardottir R. B., Brag A., Kallioniemi O. P. Distinct somatic genetic changes associated with tumor progression in carriers of BRCA1 and BRCA2 germ-line mutations. Cancer Res., 57: 1222-1227, 1997.[Abstract/Free Full Text]
  4. Solinas-Toldo S., Wallrapp C., Muller-Pillasch F., Bentz M., Gress T., Lichter P. Mapping of chromosomal imbalances in pancreatic carcinoma by comparative genomic hybridization. Cancer Res., 56: 3803-3807, 1996.[Abstract/Free Full Text]
  5. Koo S. H., Kwon K. C., Ihm C. H., Jeon Y. M., Park J. W., Sul C. K. Detection of genetic alterations in bladder tumors by comparative genomic hybridization and cytogenetic analysis. Cancer Genet. Cytogenet., 110: 87-93, 1999.[Medline]
  6. Lastowska M., Nacheva E., McGuckin A., Curtis A., Grace C., Pearson A., Bown N. Comparative genomic hybridization study of primary neuroblastoma tumors. United Kingdom Children’s Cancer Study Group. Genes Chromosomes Cancer, 18: 162-169, 1997.[Medline]
  7. Wong N., Lai P., Lee S. W., Fan S., Pang E., Liew C. T., Sheng Z., Lau J. W., Johnson P. J. Assessment of genetic changes in hepatocellular carcinoma by comparative genomic hybridization analysis: relationship to disease stage, tumor size, and cirrhosis. Am. J. Pathol., 154: 37-43, 1999.[Abstract/Free Full Text]
  8. Couch F. J., Wang X. Y., Wu G-J., Qian J. Q., Jenkins R. B., James C. D. Localization of PS6K to chromosomal region 17q23 and determination of its amplification in breast cancer. Cancer Res., 59: 1408-1411, 1999.[Abstract/Free Full Text]
  9. Barlund M., Tirkkonen M., Forozen F., Tanner M. M., Kallioniemi O., Kallionienmi A. Increased copy number at 17q22–q24 by CGH in breast cancer is due to high-level amplification of two separate regions. Genes Chromosomes Cancer, 20: 372-376, 1997.[Medline]
  10. Zheng P. Z., Eastman J., Pol S. V., Pimplikar S. W. PAT1, a microtubule-interacting protein, recognizes the basolateral sorting signal of amyloid precursor protein. Proc. Natl. Acad. Sci. USA, 95: 14745-14750, 1998.[Abstract/Free Full Text]
  11. Grove J. R., Banerjee P., Balasubramanyam A., Coffer P. J., Price D. J., Avruch J., Woodgett J. R. Cloning and expression of two human p70 S6 kinase polypeptides differing only at their amino termini. Mol. Cell. Biol., 11: 5541-5550, 1991.[Abstract/Free Full Text]
  12. Dosanjh M. K., Collins D. W., Fan W., Lennon G. G., Albala J. S., Shen Z., Schild D. Isolation and characterization of RAD51C, a new human member of the RAD51 family of related genes. Nucleic Acids Res., 26: 1179-1184, 1998.[Abstract/Free Full Text]
  13. Keen J. H. Clathrin and associated assembly and disassembly proteins. Annu. Rev. Biochem., 59: 415-438, 1990.[Medline]
  14. Pollack J. R., Perou C. M., Alizadeh A. A., Eisen M. B., Pergamenschikov A., Willians C. F., Jeffrey S. S., Botstein D., Brown P. O. Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat. Genet., 23: 41-46, 1999.[Medline]
  15. Seufferlein T., Rozengurt E. Rapamycin inhibits constitutive p70s6k phosphorylation, cell proliferation, and colony formation in small cell lung cancer cells. Cancer Res., 56: 3895-3897, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. Katsura, T. Tsuruga, O. Date, T. Yoshihara, M. Ishida, Y. Tomoda, M. Okajima, M. Takaku, H. Kurumizaka, A. Kinomura, et al.
The ATR-Chk1 pathway plays a role in the generation of centrosome aberrations induced by Rad51C dysfunction
Nucleic Acids Res., July 1, 2009; 37(12): 3959 - 3968.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. L. Yamnik, A. Digilova, D. C. Davis, Z. N. Brodt, C. J. Murphy, and M. K. Holz
S6 Kinase 1 Regulates Estrogen Receptor {alpha} in Control of Breast Cancer Cell Proliferation
J. Biol. Chem., March 6, 2009; 284(10): 6361 - 6369.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Nagaraju, S. Odate, A. Xie, and R. Scully
Differential Regulation of Short- and Long-Tract Gene Conversion between Sister Chromatids by Rad51C
Mol. Cell. Biol., November 1, 2006; 26(21): 8075 - 8086.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Wu, Z. Guo, A. Chatterjee, X. Huang, E. Rubin, F. Wu, E. Mambo, X. Chang, M. Osada, M. Sook Kim, et al.
Overexpression of Glycosylphosphatidylinositol (GPI) Transamidase Subunits Phosphatidylinositol Glycan Class T and/or GPI Anchor Attachment 1 Induces Tumorigenesis and Contributes to Invasion in Human Breast Cancer.
Cancer Res., October 15, 2006; 66(20): 9829 - 9836.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
L. Melchor, S. Alvarez, E. Honrado, J. Palacios, A. Barroso, O. Diez, A. Osorio, and J. Benitez
The Accumulation of Specific Amplifications Characterizes Two Different Genomic Pathways of Evolution of Familial Breast Tumors
Clin. Cancer Res., December 15, 2005; 11(24): 8577 - 8584.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Holz and J. Blenis
Identification of S6 Kinase 1 as a Novel Mammalian Target of Rapamycin (mTOR)-phosphorylating Kinase
J. Biol. Chem., July 15, 2005; 280(28): 26089 - 26093.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Nessling, K. Richter, C. Schwaenen, P. Roerig, G. Wrobel, S. Wessendorf, B. Fritz, M. Bentz, H.-P. Sinn, B. Radlwimmer, et al.
Candidate Genes in Breast Cancer Revealed by Microarray-Based Comparative Genomic Hybridization of Archived Tissue
Cancer Res., January 15, 2005; 65(2): 439 - 447.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
B. Orsetti, M. Nugoli, N. Cervera, L. Lasorsa, P. Chuchana, L. Ursule, C. Nguyen, R. Redon, S. du Manoir, C. Rodriguez, et al.
Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes
Cancer Res., September 15, 2004; 64(18): 6453 - 6460.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
W.-C. Noh, W. H. Mondesire, J. Peng, W. Jian, H. Zhang, J. Dong, G. B. Mills, M.-C. Hung, and F. Meric-Bernstam
Determinants of Rapamycin Sensitivity in Breast Cancer Cells
Clin. Cancer Res., February 1, 2004; 10(3): 1013 - 1023.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. Hirasawa, F. Saito-Ohara, J. Inoue, D. Aoki, N. Susumu, T. Yokoyama, S. Nozawa, J. Inazawa, and I. Imoto
Association of 17q21-q24 Gain in Ovarian Clear Cell Adenocarcinomas with Poor Prognosis and Identification of PPM1D and APPBP2 as Likely Amplification Targets
Clin. Cancer Res., June 1, 2003; 9(6): 1995 - 2004.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G. Wu, S. Nomoto, M. O. Hoque, T. Dracheva, M. Osada, C.-C. R. Lee, S. M. Dong, Z. Guo, N. Benoit, Y. Cohen, et al.
{Delta}Np63{alpha} and TAp63{alpha} Regulate Transcription of Genes with Distinct Biological Functions in Cancer and Development
Cancer Res., May 15, 2003; 63(10): 2351 - 2357.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F. Saito-Ohara, I. Imoto, J. Inoue, H. Hosoi, A. Nakagawara, T. Sugimoto, and J. Inazawa
PPM1D Is a Potential Target for 17q Gain in Neuroblastoma
Cancer Res., April 15, 2003; 63(8): 1876 - 1883.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. S. Sinclair, C. Adem, A. Naderi, C. L. Soderberg, M. Johnson, L. Wadum, V. L. Couch, T. A. Sellers, D. Schaid, J. Slezak, et al.
TBX2 Is Preferentially Amplified in BRCA1- and BRCA2-related Breast Tumors
Cancer Res., July 1, 2002; 62(13): 3587 - 3591.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
C. L. Andersen, O. Monni, U. Wagner, J. Kononen, M. Barlund, C. Bucher, P. Haas, A. Nocito, H. Bissig, G. Sauter, et al.
High-Throughput Copy Number Analysis of 17q23 in 3520 Tissue Specimens by Fluorescence in Situ Hybridization to Tissue Microarrays
Am. J. Pathol., July 1, 2002; 161(1): 73 - 79.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. C. Godthelp, W. W. Wiegant, A. van Duijn-Goedhart, O. D. Scharer, P. P. W. van Buul, R. Kanaar, and M. Z. Zdzienicka
Mammalian Rad51C contributes to DNA cross-link resistance, sister chromatid cohesion and genomic stability
Nucleic Acids Res., May 15, 2002; 30(10): 2172 - 2182.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J.-Y. Masson, A. Z. Stasiak, A. Stasiak, F. E. Benson, and S. C. West
Complex formation by the human RAD51C and XRCC3 recombination repair proteins
PNAS, July 17, 2001; 98(15): 8440 - 8446.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
G.-j. Wu, C. Sinclair, S. Hinson, J. N. Ingle, P. C. Roche, and F. J. Couch
Structural Analysis of the 17q22-23 Amplicon Identifies Several Independent Targets of Amplification in Breast Cancer Cell Lines and Tumors
Cancer Res., July 1, 2001; 61(13): 4951 - 4955.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Monni, M. Bärlund, S. Mousses, J. Kononen, G. Sauter, M. Heiskanen, P. Paavola, K. Avela, Y. Chen, M. L. Bittner, et al.
Comprehensive copy number and gene expression profiling of the 17q23 amplicon in human breast cancer
PNAS, April 25, 2001; (2001) 91582298.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
O. Monni, M. Barlund, S. Mousses, J. Kononen, G. Sauter, M. Heiskanen, P. Paavola, K. Avela, Y. Chen, M. L. Bittner, et al.
Comprehensive copy number and gene expression profiling of the 17q23 amplicon in human breast cancer
PNAS, May 8, 2001; 98(10): 5711 - 5716.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, G.-J.
Right arrow Articles by Couch, F. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, G.-J.
Right arrow Articles by Couch, F. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Cancer Research Clinical Cancer Research
Cancer Epidemiology Biomarkers & Prevention Molecular Cancer Therapeutics
Molecular Cancer Research Cancer Prevention Research
Cancer Prevention Journals Portal Cancer Reviews Online
Annual Meeting Education Book Meeting Abstracts Online