| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Advances in Brief |
Departments of Laboratory Medicine and Pathology [G-J. W., C. S. S., J. P., P. C. R., C. D. J., F. J. C.], Biochemistry and Molecular Biology [F. J. C.], and Oncology [J. N. I.], Mayo Clinic and Foundation, Rochester, Minnesota 55905
| ABSTRACT |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Hybridization Probes.
A total of 87 ESTs covering the 17q23 region were selected from
the GeneMap 99
database.4
PCR primers for each EST were designed using the sequences of the ESTs
and the PRIMER 3 software. PCR was carried out on genomic DNA or cDNA
synthesized from human brain and testis RNA (Clontech) by standard
conditions. All of the PCR conditions are available from the authors on
request. PCR products were purified, labeled with
[
-32P]dCTP by random primer labeling (Life
Technologies). Primers for amplification of cDNA fragments from the
four known genes are as follows: PS6KF, aat tga ttc ctc gcg
aca tc; PS6KR, ttg gga tgt ttt tca taa tga gc;
RAD51CF, gaa ttc gag cca cca tgc gcg gga aga cg;
RAD51CR, gga tcc tta taa ttc ttc ctc tgg gtc;
PAT1F, tgt cca taa atc tca gga atg; PAT1R, tat
cac aat gct ggt tac aaa; SIGMA1B F, ctgc aaa aat ggt atg tcc
c; SIGMA1B R, tcc caa aag aaa ctc atc ca.
Southern and Northern Blotting.
Genomic DNA from the seven breast cancer cell lines and 94 primary
breast tumors was extracted as described previously (8)
. A
total of 5 µg of DNA for each sample was digested with
EcoRI, electrophoresced on an agarose gel and transferred to
nylon membrane with 10x SSC. Southern hybridization was carried out
under standard conditions using a formamide-based hybridization
solution at 42°C. GAPDH was used as a control probe to
assess loading differences on the blots. Total RNA from cell lines was
extracted by Trizol separation (Life Technologies). A total of 15 µg
of each RNA sample was electrophoresced and transferred to a positively
charged nylon membrane (Boehringer Mannheim). Northern hybridization
was carried out in Quick Hybridization Solution according to the
manufacturers instructions (Clontech). GAPDH was again
used as a control probe to assess loading differences on the blots.
Signals from Southern and Northern blots were measured using a
Molecular Dynamics PhosphorImager. Amplification levels were
quantitated by adjusting for background in the same lane, followed by
normalizing a ratio of the gene-specific signal:GAPDH signal for each
sample with the same ratio from a normal DNA control on the same blot.
Semiquantitative RT-PCR.
PCR primers were designed using cDNA sequence for each of the
PS6K, RAD51C, PAT1, and
SIGMA1B genes as follows: PS6KF,
gacaatgagtggttaagcat; PS6KR, tcttgtttcaccttgcagga;
RAD51CF, cctccgagcttagcaaagaa; RAD51CR,
ccacccccaagaatatcatc; SIGMA1BF, agaccgttttagcacggaaa;
SIGMA1BR, gttcacagacactgccgaaa; PAT1F,
tatttggcacgggatcattt; PAT1R, tgccaaatcttcatgagctg. RNA was
prepared from each of 94 frozen breast tumors as follows: each tumor
was mounted in O.C.T. compound (Sakura Finetechnical) and 20
10-µm sections were cut on a cryostat. Sections were placed in 1 ml
of Trizol reagent, and RNA was extracted by standard protocol. The RNA
was treated with RNase-free DNase to remove contaminating genomic DNA
and was purified on a RNeasy Mini kit (Qiagen). A total of 1 µg of
total RNA from each sample was used to generate single-stranded cDNA
with random hexamer primers using the Superscript II cDNA Preparation
kit (Life Technologies). The cDNA products were diluted to 100 µl in
DEPC water. A total of 4 µl of cDNA was used as template for
amplification with both gene-specific primers and GAPDH
primers in a single PCR reaction. PCR of the 94 tumor cDNAs and the
control cDNA from HMECs (Clonetics) were performed in parallel.
PCR products were electrophoresced on an 8% nondenaturing
polyacrylamide gel, stained with Sybr green, and scanned on a
Molecular Dynamics PhosphorImager. Quantitation was performed as
described for Southern blots by normalizing with a
gene-specific:GAPDH ratio from HMEC cells.
| Results |
|---|
|
|
|---|
|
|
To determine the incidence of amplification of these genes in primary
tumors, we analyzed 94 infiltrating ductal adenocarcinomas of the
breast for copy number increases. Representative Southern blots for
each of the four genes on the tumor DNAs are shown in Fig. 2A
. Amplification (five or more gene copies) of at least one
of the four genes was detected in 26 (28%) of 94 tumors. The
PAT1 gene was amplified in 18 (19%) of 94 of the primary
tumors, PS6K was amplified in 7 (7.5%) of the 93
informative tumors RAD51C was amplified in 7 (8%)
of 86 informative tumors, and SIGMA1B was amplified in 11
(12%) of 92 primary tumors. High-level amplification (10 gene copies)
was detected in 1 tumor for RAD51C, in 3 tumors for
PAT1, in 3 tumors for SIGMA1B, and not in any
tumors for PS6K (Fig. 2C)
. Of the 26 tumors with
amplification, only 2 (2%) were amplified for all of the four genes,
whereas 14 (54%) of 26 tumors were amplified for only one of the
genes. The amplification status of each of the four genes in the 26
tumors that have amplification of at least one of the genes is shown in
Fig. 2C
. Southern blot analysis with an ERBB2
probe revealed that only 24 (25%) of 94 tumors were amplified for
ERBB2. Only 7 of these 24 were also amplified for one of the
four genes in the 17q23 region. High levels of amplification for
ERBB2 was detected in 6 (6%) of 94 of tumors, whereas only
2 of these 6 were coamplified with 17q23 genes.
|
|
| Discussion |
|---|
|
|
|---|
The structure of the amplicon in MCF7 and BT474 cell lines as depicted
in Fig. 1
does not necessarily represent an accurate map of the 17q23
region, because the positions of the ESTs in the region are based on
radiation hybrid mapping, which cannot determine the relative position
of adjacent markers or ESTs. Consequently, the number as well as the
position of the amplification peaks identified here may change as this
region is sequenced or physically mapped. However, the amplification
data for the PAT1, PS6K, RAD51C, and
SIGMA1B genes in breast tumors suggest that at least four
independent amplification peaks exist on 17q23.
The data derived from this study support previous observations that 17q23 amplification is one of the most common genomic alterations in breast cancer. A total of 28% of the tumors that were studied here showed amplification of at least one of the four genes in the region. This high correlation between amplification of 17q23 and breast cancer suggests that gene targets in this region contribute to tumor development and progression when amplified. In addition, 17q23 amplification may not be a late event in breast tumor development, inasmuch as amplification was detected in stage 2 tumors and did not increase in frequency with increasing tumor stage. Unfortunately, the tumor specimens used in the study were all high-grade; therefore, we were unable to evaluate a correlation between grade of tumor and amplification frequency.
The 17q23 region contains several known genes including SUPT4H, PNUTL2, LPO, MPO, ZNF147, AKAP149, PSMC5, ICAM2, and GH1. Amplification of these genes was not detected in the seven breast cancer cell lines. However, amplification was observed for PS6K, PAT1, RAD51C, and SIGMA1B. PS6K is a serine-threonine kinase that is thought to regulate a wide array of cellular processes involved in mitogenic response including protein synthesis, translation of specific mRNA species, and cell cycle progression from G1 to S phase (11 , 15) . In a previous study, we reported that PS6K was amplified and overexpressed in breast cancer (8) , and we suggested PS6K as a candidate oncogene that is activated by amplification. In this study, we demonstrate that amplification often does not result in overexpression of PS6K in tumors, which suggests that amplified genes need not necessarily be transcriptionally active. However, because PS6K is frequently overexpressed in tumors, it cannot be eliminated as a candidate oncogene, although its activation does not necessarily occur through amplification. PAT1 is a microtubule-interacting protein that recognizes the basolateral sorting signal of amyloid precursor protein (10) . Our analysis of the PAT1 gene in breast tumors showed that this gene is frequently amplified, but that the amplification is rarely associated with overexpression. Thus, PAT1 is unlikely to be an oncogene that is activated by amplification of the 17q23 region. SIGMA1B protein has been shown to interact with clathrin adaptor-related proteins and to localize to paranuclear vesicles involved in intracellular transport (13) . In this study, we showed that SIGMA1B amplification in breast tumors is frequently associated with overexpression. In addition, SIGMA1B overexpression independent of amplification is commonly detected in breast tumors. Thus, SIGMA1B may be induced and activated by amplification and by transcriptional mechanisms and may contribute to tumor progression. RAD51C is a member of the RAD51 gene family, which encode strand-transfer proteins that are thought to be involved in both recombinational repair of DNA damage and meiotic recombination (12) . In this study, RAD51C was found to be amplified infrequently in breast tumors, and its amplification was not associated with elevated expression. Thus, RAD51C does not function as an amplification-activated oncogene in breast cancer.
In summary, we have delineated a large complex amplicon on chromosome 17q23 in breast cancer cell lines. In addition, the level and frequency of amplification of four known genes (RAD51C, PS6K, PAT1, and SIGMA1B) was determined in 94 breast tumors, and instances of independent amplification were identified. The data suggest that the region contains at least four independent targets of amplification. Continued study of the structure of 17q23 amplicons, as well as functional studies of the amplification target sequences will be necessary to elucidate the role of this genomic alteration in breast tumor development.
| FOOTNOTES |
|---|
1 This work has been supported by Grant
DAMD17-1-9282 (to F. J. C. and C. D. J.) from the U.S. Army Medical
Research and Materiel Command and by the Breast Cancer Research
Foundation (to J. N. I. and F. J. C.). ![]()
2 To whom requests for reprints should be
addressed, at Mayo Clinic and Foundation, 1001A Guggenheim, 200 First
Sreet S.W., Rochester, MN 55905. Phone: (507) 284-3623; Fax: (507)
266-0824; E-mail: couch.fergus{at}mayo.edu ![]()
3 The abbreviations used are: EST,
expressed sequence tag; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase; RT-PCR, reverse transcription-PCR; HMEC, human mammary
epithelial cell; cR, centi-ray. ![]()
4 Internet address:
http://www.ncbi.nlm.nih.gov/genemap. ![]()
Received 3/31/00. Accepted 8/11/00.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Katsura, T. Tsuruga, O. Date, T. Yoshihara, M. Ishida, Y. Tomoda, M. Okajima, M. Takaku, H. Kurumizaka, A. Kinomura, et al. The ATR-Chk1 pathway plays a role in the generation of centrosome aberrations induced by Rad51C dysfunction Nucleic Acids Res., July 1, 2009; 37(12): 3959 - 3968. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Yamnik, A. Digilova, D. C. Davis, Z. N. Brodt, C. J. Murphy, and M. K. Holz S6 Kinase 1 Regulates Estrogen Receptor {alpha} in Control of Breast Cancer Cell Proliferation J. Biol. Chem., March 6, 2009; 284(10): 6361 - 6369. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Nagaraju, S. Odate, A. Xie, and R. Scully Differential Regulation of Short- and Long-Tract Gene Conversion between Sister Chromatids by Rad51C Mol. Cell. Biol., November 1, 2006; 26(21): 8075 - 8086. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wu, Z. Guo, A. Chatterjee, X. Huang, E. Rubin, F. Wu, E. Mambo, X. Chang, M. Osada, M. Sook Kim, et al. Overexpression of Glycosylphosphatidylinositol (GPI) Transamidase Subunits Phosphatidylinositol Glycan Class T and/or GPI Anchor Attachment 1 Induces Tumorigenesis and Contributes to Invasion in Human Breast Cancer. Cancer Res., October 15, 2006; 66(20): 9829 - 9836. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Melchor, S. Alvarez, E. Honrado, J. Palacios, A. Barroso, O. Diez, A. Osorio, and J. Benitez The Accumulation of Specific Amplifications Characterizes Two Different Genomic Pathways of Evolution of Familial Breast Tumors Clin. Cancer Res., December 15, 2005; 11(24): 8577 - 8584. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Holz and J. Blenis Identification of S6 Kinase 1 as a Novel Mammalian Target of Rapamycin (mTOR)-phosphorylating Kinase J. Biol. Chem., July 15, 2005; 280(28): 26089 - 26093. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nessling, K. Richter, C. Schwaenen, P. Roerig, G. Wrobel, S. Wessendorf, B. Fritz, M. Bentz, H.-P. Sinn, B. Radlwimmer, et al. Candidate Genes in Breast Cancer Revealed by Microarray-Based Comparative Genomic Hybridization of Archived Tissue Cancer Res., January 15, 2005; 65(2): 439 - 447. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Orsetti, M. Nugoli, N. Cervera, L. Lasorsa, P. Chuchana, L. Ursule, C. Nguyen, R. Redon, S. du Manoir, C. Rodriguez, et al. Genomic and Expression Profiling of Chromosome 17 in Breast Cancer Reveals Complex Patterns of Alterations and Novel Candidate Genes Cancer Res., September 15, 2004; 64(18): 6453 - 6460. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-C. Noh, W. H. Mondesire, J. Peng, W. Jian, H. Zhang, J. Dong, G. B. Mills, M.-C. Hung, and F. Meric-Bernstam Determinants of Rapamycin Sensitivity in Breast Cancer Cells Clin. Cancer Res., February 1, 2004; 10(3): 1013 - 1023. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hirasawa, F. Saito-Ohara, J. Inoue, D. Aoki, N. Susumu, T. Yokoyama, S. Nozawa, J. Inazawa, and I. Imoto Association of 17q21-q24 Gain in Ovarian Clear Cell Adenocarcinomas with Poor Prognosis and Identification of PPM1D and APPBP2 as Likely Amplification Targets Clin. Cancer Res., June 1, 2003; 9(6): 1995 - 2004. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wu, S. Nomoto, M. O. Hoque, T. Dracheva, M. Osada, C.-C. R. Lee, S. M. Dong, Z. Guo, N. Benoit, Y. Cohen, et al. {Delta}Np63{alpha} and TAp63{alpha} Regulate Transcription of Genes with Distinct Biological Functions in Cancer and Development Cancer Res., May 15, 2003; 63(10): 2351 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Saito-Ohara, I. Imoto, J. Inoue, H. Hosoi, A. Nakagawara, T. Sugimoto, and J. Inazawa PPM1D Is a Potential Target for 17q Gain in Neuroblastoma Cancer Res., April 15, 2003; 63(8): 1876 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Sinclair, C. Adem, A. Naderi, C. L. Soderberg, M. Johnson, L. Wadum, V. L. Couch, T. A. Sellers, D. Schaid, J. Slezak, et al. TBX2 Is Preferentially Amplified in BRCA1- and BRCA2-related Breast Tumors Cancer Res., July 1, 2002; 62(13): 3587 - 3591. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Andersen, O. Monni, U. Wagner, J. Kononen, M. Barlund, C. Bucher, P. Haas, A. Nocito, H. Bissig, G. Sauter, et al. High-Throughput Copy Number Analysis of 17q23 in 3520 Tissue Specimens by Fluorescence in Situ Hybridization to Tissue Microarrays Am. J. Pathol., July 1, 2002; 161(1): 73 - 79. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Godthelp, W. W. Wiegant, A. van Duijn-Goedhart, O. D. Scharer, P. P. W. van Buul, R. Kanaar, and M. Z. Zdzienicka Mammalian Rad51C contributes to DNA cross-link resistance, sister chromatid cohesion and genomic stability Nucleic Acids Res., May 15, 2002; 30(10): 2172 - 2182. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Masson, A. Z. Stasiak, A. Stasiak, F. E. Benson, and S. C. West Complex formation by the human RAD51C and XRCC3 recombination repair proteins PNAS, July 17, 2001; 98(15): 8440 - 8446. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-j. Wu, C. Sinclair, S. Hinson, J. N. Ingle, P. C. Roche, and F. J. Couch Structural Analysis of the 17q22-23 Amplicon Identifies Several Independent Targets of Amplification in Breast Cancer Cell Lines and Tumors Cancer Res., July 1, 2001; 61(13): 4951 - 4955. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Monni, M. Bärlund, S. Mousses, J. Kononen, G. Sauter, M. Heiskanen, P. Paavola, K. Avela, Y. Chen, M. L. Bittner, et al. Comprehensive copy number and gene expression profiling of the 17q23 amplicon in human breast cancer PNAS, April 25, 2001; (2001) 91582298. [Abstract] [Full Text] |
||||
![]() |
O. Monni, M. Barlund, S. Mousses, J. Kononen, G. Sauter, M. Heiskanen, P. Paavola, K. Avela, Y. Chen, M. L. Bittner, et al. Comprehensive copy number and gene expression profiling of the 17q23 amplicon in human breast cancer PNAS, May 8, 2001; 98(10): 5711 - 5716. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Cancer Research | Clinical Cancer Research |
| Cancer Epidemiology Biomarkers & Prevention | Molecular Cancer Therapeutics |
| Molecular Cancer Research | Cancer Prevention Research |
| Cancer Prevention Journals Portal | Cancer Reviews Online |
| Annual Meeting Education Book | Meeting Abstracts Online |