| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Immunology |
Departments of Laboratory Research [J. D., M. G.], Urology [L. P., D. K. A.], Oncology [G. F., T. C.], and Pathology [P. A. D., U. S.], Cantonal Hospital St. Gall, 9007 St. Gallen, Switzerland
 |
ABSTRACT |
|---|
 Top ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
|
INTRODUCTION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Because many of the so-called "cancer testis" antigens, which are expressed in testis and in several different malignancies, are not prevalent in the majority of CaP specimens, organ-specific gene products were considered as target antigens in CaP. This approach seems reasonable because in organ-confined CaP, the prostate is surgically removed and because the life of vaccinated patients would not be endangered if healthy prostate tissue was damaged by CTLs. Unfortunately, the majority of defined prostate-specific gene products display properties that limit their utilization as antigens in specific immunotherapy of CaP. PSA, PSMA, PAP, PSP 94, and prostate carcinoma tumor antigen 1 are secretory proteins that are found in considerable concentrations in the serum and hence are likely to induce peripheral tolerance. The expression of PSA and PAP in tissue is reduced in neoplastic cells of poorly differentiated tumors compared with normal prostatic tissue and well-differentiated adenocarcinomas (20) . In addition, PSA has a high degree of homology with members of the kallikrein family, and PSMA has been found to be expressed in various human tissues (21) , thus bearing the risk of generating autoimmune disease upon protein-based vaccination. PSP 94 (22) and PAGE-4 (11) seem to be down-regulated in tumor tissue, and expression of six-transmembrane epithelial antigen of the prostate appears to be expressed at low levels in several other tissues (13) . Prostate androgen-regulated transcript 1 expression is regulated by androgens (15) , which is a drawback for strategies aiming to eliminate hormone-refractory tumors. Lastly, the mRNA of differential display 3 does not contain extensive open reading frames and has, therefore, been suggested to function as a noncoding RNA (14) .
However, there are new and partially characterized prostatespecific genes that warrant further investigation regarding their potential as CaP antigens. Little is known about the CaP expression status of C1, C2, and C5, which are prostate-specific mRNAs identified from expressed sequence tag libraries (23) . On the other hand, PAGE-1 (24) and PSCA (25, 26, 27) have been identified as gene products specifically overexpressed in hormone-independent CaP cell lines or tumor tissue, respectively. PAGE-1 was identified by differential display PCR as an mRNA that is up-regulated in androgen-insensitive metastatic sublines of the CaP cell line LNCaP. The PAGE-1 protein shares 45% homology with antigens of the "cancer-testis" family, and its expression was found to be restricted to LNCaP sublines, testes, and placenta (24) . PSCA was isolated by representational difference analysis in the LAPC-4 xenograft model and was found to be up-regulated in tumor xenografts when compared with normal prostate (25) . The PSCA gene codes for a 123-amino acid glycoprotein that is not homologous to other genes except for a 30% identity to stem cell antigen 2. Topologically, PSCA was characterized as a glycosylphosphatidylinositol-anchored cell surface antigen (25) . Interestingly, PSCA was not differentially expressed between androgen-dependent and -independent LAPC-4 tumors, which would make it an attractive target for vaccination against hormone-refractory CaP.
In this study, we asked whether PAGE-1, PSCA, C1, C2, and C5 are suitable as target antigens for immunotherapy of hormone-refractory CaP in terms of gene expression in tumor specimens and, furthermore, if antigen-specific cytotoxic T cells recognizing these antigens can be found in vivo. Although C1, C2, C5, and PAGE-1 were not expressed in the majority of CaP specimens, PSCA was found in all samples analyzed. Using a "reverse immunology" approach, we identified an HLA-A0201-restricted T-cell epitope from PSCA. CTLs against this epitope could be generated from peripheral blood of a CaP patient that recognized and killed CaP cell lines, suggesting that PSCA protein as well as this peptide epitope may be valuable antigens for tumor vaccination against CaP.
|
MATERIALS AND METHODS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, cell
lines were plated in complete RPMI 1640 in six-well plates at
105 cells/well. Cells were stimulated with 200
units/ml of recombinant human IFN- (Roche, Rotkreuz, Switzerland)
for 2 days with daily exchanges of medium.
Peptide Synthesis.
Peptides were synthesized by ECHAZ microcollections (Tübingen,
Germany) using standard f-moc technology:
PSCA5–13, LLALLMAGL;
PSCA7–16, ALLMAGLAL;
PSCA14–22, ALQPGTALL;
PSCA20–28, ALLCYSCKA;
PSCA43–51, QLGEQCWTA;
PSCA105–113, AILALLPAL;
PSCA108–116, ALLPALGLL;
PSCA109–117, LLPALGLLL; and
PSCA115–123, LLLWGPGQL. As positive controls,
the PSMA peptide, LLHETDSAV (30)
, and the influenza matrix
protein-derived peptide 58–66, GILGFVFTL, were used. Peptides were
dissolved to a final concentration of 10 mM in DMSO and
stored at -20°C.
T2 Binding Assays.
Each peptide was tested for concentration-dependent binding to T2 cells
in HLA-A0201 stabilization assays. T2 (TAP-deficient) cells were
incubated at room temperature overnight with the indicated PSCA
peptides over a range of peptide concentrations from 0.5 to 10
µM in the presence of 1 µg/ml
ß2-microglobulin (Sigma). Stability of
HLA-A0201 was assayed by flow cytometry (FACScan; Becton Dickinson)
after staining the cells with antibody BB7.2 (5 µg/ml) and goat
antimouse-FITC (AMRAD, Melbourne, Australia). The peptide GILGFVFTL of
influenza matrix protein, residues 58–66, was used as a positive
control. Alternatively, in "off-assays," T2 cells were incubated
overnight at room temperature in the presence of 10 µM
peptide, followed by an incubation at 37°C in the presence of
10-4 M emetine (Sigma). The loss of
HLA-A0201 molecules from the cell surface was monitored by flow
cytometry after 1, 2, 3, 4, and 6 h, respectively.
Oligodeoxynucleotides and PCR.
Oligodeoxynucleotide primers for PCR reactions were purchased from the
Microsynth Company (Balgach, Switzerland):
PSCAsense, 5'-CTTGCCCTGTTGATGGCAGGC;
PSCAantisense, 5'-CCAGAGCAGCAGGCCGAGTGC
(25)
; ß-actinsense,
5'-CACTGTGTTGGCGTACAGGT; ß-actinantisense,
TCATCACCATTGGCAATGAG; PAGEsense,
5'-CTAGAATTCAGCGGCCGTG; PAGEantisense,
5'-CTGTAAAGCTTTATTGGGAG; C1sense,
5'-GGCTTATTTAAAAGACATGAC; C1antisense,
5'-GAAGAAAGCTTATCTGGAGTG; C2sense,
5'-CGACCTACGTCTCAACCCTC; C2antisense,
5'-CTCCCATGGCCTCCCACAGG; C5sense,
5'-ACCAAAGATCTGCTTTTATC; C5antisense,
5'-GAATCCAGAGCTCCAACACC; PSAsense,
5'-GAGGTCCACACACTGAAGTT; and PSAantisense,
5'-CCTCCTGAAGAATCGATTCCT.
Synthesis of cDNA and RT-PCR.
Total RNA was isolated from tissues and cell lines by conventional acid
guanidinium thiocyanate-phenol-chloroform extraction and, subsequently,
treated with DNase I (Roche). Two µg of total RNA were used for
synthesis of first-strand cDNA using Moloney Murine Leukemia virus
reverse transcriptase (Promega Corp., Wallisellen, Switzerland)
following the manufacturer’s recommendations. One-twenty-fifth (1
µl) of the resulting cDNA was amplified by PCR. Thermal cycling of
PSCA-RNA was performed for 35 cycles at 94°C for 1 min, 58°C for 1
min, and 72°C for 1 min, followed by extension at 72°C for 10 min.
Annealing temperatures for different gene products were as follows: C1,
55°C; C2, 60°C; C5, 55°C; PAGE, 60°C; PSA, 54°C; and
ß-actin, 54°C. PCR reactions were carried out in the presence of 50
mM KCl, 10 mM Tris-HCl (pH 9.0), 0.01% Triton
X-100, 0.25 mM of each of the deoxynucleotides, 1 unit of
Taq DNA polymerase, and 2 mM MgCl2
(except for PSCA, where 3 mM MgCl2
was used).
Cytolytic Assay.
Target cells were harvested, washed, counted, and labeled with 100
µCi of
Na251CrO4
(EGT Chemie, Tageri, Switzerland) in 0.5 ml complete RPMI 1640 at
37°C for 1.5 h. Exogenous loading of cells with 10
µM synthetic peptide was performed simultaneously with
labeling reactions. Infection of target cells with recombinant vaccinia
viruses was performed 10 h before labeling at an multiplicity of
infection of 5. CTLs were washed, counted, and diluted to the desired
density in complete RPMI 1640 and plated in duplicate wells in a
round-bottomed, 96-well plate. Target cells were washed three times,
diluted to 104 cells/ml, and plated with CTLs. To
control for nonspecific lysis by natural killer cells or
lymphokine-activated killer cells, respectively, K562 and Daudi cells
were included as targets in our assays. The plates were spun briefly at
800 x g and incubated for 4–5 h at 37°C.
Supernatants were harvested and counted in a gamma counter. Duplicate
wells were averaged, and the percentage of specific lysis was
calculated as:
 |
CTL Generation from Peptide-pulsed PBMCs.
Peptide-specific, short-term CTL cultures were generated to the PSCA
peptides. HLA-A0201-positive PBMCs from a patient with metastatic
prostate cancer were pulsed with 10 µM peptide for 2 h at 37°C in serum-free media (X-VIVO 15; BioWhittaker, Verviers,
Belgium), washed, and cultured in the presence of 10 units/ml IL-2 in
complete RPMI 1640 at 105 cells/200 µl per
well. IL-2 (Sigma) was added twice weekly at 10 units/ml. Cells were
restimulated every 2 weeks by addition of autologous, peptide-pulsed,
washed, and irradiated (80 Gy) PBMCs at a 1:1 ratio. After 8 weeks in
culture, cells were tested for cytotoxicity.
Patients.
All clinical material was obtained by prostatectomy, transurethral
resection of prostate, or autopsy, after informed consent from patients
according to an Institutional Review Board-approved protocol.
Surgically harvested specimens were examined by a pathologist and
frozen at -70°C within 30 min. The material was classified as BPH,
locally confined CaP, locally advanced CaP, or metastatic disease as
detailed in Table 1
. Autopsies were performed within 2 h after death.
|
|
RESULTS |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). As positive controls for the quality of our cDNA, we performed
amplifications of ß-actin (data not shown) and PSA (Fig. 1
, top
panel) mRNA. As expected, PSA mRNA can be detected in LNCaP 1740
(Lane 1), LNCaP 10990 (Lane 3), BPH tissue
(Lane 8), and all CaP specimens, although to varying
degrees. Consistently, PSA expression is absent in androgen
receptor-negative cell lines DU-145, PC-3, and Tsu-pr1 (Lanes 5,
6, and 7). An androgen-independent (ai) subline of
LNCaP 1740 (Lane 2), which we have generated by androgen
deprivation of the parental line, reveals a similar PSA signal as the
parental line, whereas expression of PSA is down-regulated in LNCaP
10990-ai (Lane 4). PSCA mRNA can be found in all CaP cell
lines at similar levels, except for lower expression in LNCaP 1740-ai
and Tsu-pr (Lanes 2 and 7). Furthermore, PSCA
mRNA could be detected in BPH and at different levels, but
consistently, in most specimens examined (see also Fig. 4
). PAGE-1 mRNA
could not be detected in any of the samples analyzed. However, in
agreement with published data (24)
, PAGE-1 expression
could be found in testis, which demonstrates that the former result is
not attributable to inappropriate amplification conditions in our PCR
reactions (data not shown). Chen et al. (24)
could detect expression of PAGE-1 only in androgen-independent,
metastatic sublines of LNCaP that had been isolated from castrated nude
mice but not in parental LNCaP cells, PC-3 cells, DU-145 cells, or even
normal prostate. Additionally, a recent publication suggests that
PAGE-1 is most likely an unknown member of the GAGE family,
i.e., a shared cancer-testis antigen, rather than a
prostate-specific gene product (31)
.
|
|
Tissue Specificity of PSCA Expression.
To determine the tissue specificity of PSCA expression, we harvested
nonprostatic tissues during the autopsy of a patient who died from
metastatic prostate cancer and subjected isolated RNA to RT-PCR
analyses. This patient had metastatic lesions in os sacrum, os ileum,
lumbal spine, and liver. Bone marrow was harvested from the femur.
Among the tissues analyzed, PSCA expression was only found in bone
marrow (Fig. 2
, Lane 6). This result is unexpected, and we asked if the
PSCA signal was attributable to the presence of CaP cells in the bone
marrow or if our PCR picked up a gene product expressed in
hematopoietic tissue. Therefore, we harvested three additional bone
marrow samples, one from a healthy donor, one from a leukemia patient,
and one during autopsy of a female patient who died from nonmalignant
disease.
|
, PSCA could only be detected in the bone marrow derived from the
patient with metastatic CaP (Fig. 3
, Lane 1). Amplification
of ß-actin RNA (Fig. 3
, bottom) demonstrates that equal
amounts of cDNA have been included in our RT-PCR. These results suggest
that PSCA expression in the bone marrow of the patient with metastatic
CaP was attributable to the presence of CaP cells in his bone marrow.
It is interesting to note that the PSCA signal in this bone marrow
sample is exceptionally high, because PSCA expression in primary tumor
and a liver metastasis (>90% CaP tissue) derived from the same
patient is significantly lower (Fig. 1
, Lane 15).
|
A, PSCA was expressed in all samples examined, and no
evidence for complete down-regulation of PSCA expression, either in
hormone-dependent or -refractory primary CaP or in CaP metastases,
could be obtained. Most of the hormone-dependent CaP samples displayed
a higher level of PSCA expression compared with BPH specimens, whereas
some of the metastases and hormone-refractory primary CaP samples
appeared to express slightly reduced levels of PSCA mRNA. Although we
used an amplification of ß-actin mRNA to control for the integrity
and amount of mRNA in the preparations (Fig. 4B)
, the
determination of PSCA mRNA levels by RT-PCR is at best
semiquantitative. Taking these limitations into consideration, we
conclude from our analysis that, compared with BPH, there is no
evidence for either a selective loss or for a general up-regulation of
PSCA expression in metastases or hormone-refractory CaP samples.
Identification of HLA-A0201-binding PSCA Peptides.
We next sought to identify potential HLA-A0201-restricted PSCA peptide
epitopes that may be recognized by PSCA-specific T cells.
Computer-based analysis (32
, 33)
of the published human
PSCA sequence (25)
was performed to identify 9-mer
peptides whose sequences conformed to the well-characterized binding
motif for HLA-A0201. Table 2
presents the HLA-A0201 binding properties of PSCA peptide epitopes and
those of the immunodominant HLA-A0201-restricted influenza matrix
peptide M158–66 and of the PSMA peptide
LLHETDSAV, which is currently being used for dendritic cell-based
vaccination of patients with metastatic CaP (30)
. All
peptides analyzed bound strongly to HLA-A0201 and stabilized MHC
molecules at peptide concentrations <0.5 µM, except for
PSCA20–28 (4 µM) and
PSCA43–51 (1 µM), which contain
only one HLA-anchor (leucine) residue at position 2. However,
significant differences between peptide epitopes could be detected when
analyzing the duration of HLA-A0201 stabilization on the cell surface
of peptide-pulsed cells. Only peptides PSCA7–16,
PSCA14–22, and
PSCA115–123 were capable of stabilizing MHC
molecules for up to 6 h. For these peptides, we determined whether
they were capable of stimulating human PSCA-specific T cells in
vitro.
|
, and it was also this T-cell culture that proliferated most vigorously
upon restimulation. At the time of specificity analysis, 70% of the
CTL culture consisted of
CD3+8+ cells, whereas there
were still some 30% CD3+4+
cells present, as determined by flow cytometry (data not shown).
|
for 2 days (data not shown).
When LNCaP cells were used as targets in a cytolytic assay, they were
lysed by PSCA14–22-specific CTLs in the presence
but not in the absence of IFN-, indicating that the
PSCA14–22 epitope could be endogenously
processed and presented by IFN--stimulated CaP cells (Fig. 5)
. To
test whether the lysis by the PSCA14–22-reactive
CTLs was specific for PSCA, other tumor cell lines, which we determined
to be HLA-A0201+, were used as targets
simultaneously with IFN--treated LNCAP cells at the highest E:T
ratio (Fig. 6A)
. In contrast to LNCaP cells that were lysed at E:T target
ratios ranging from 12.5 to 100 (Fig. 6
, Lanes 12–15), the
tumor cell lines HepG2 (hepatocarcinoma, Lane 6), MCF-7
(mamma carcinoma, Lane 7), SW620 (colon carcinoma,
Lane 8), and T98G (glioblastoma, Lane 9) were not
lysed to a significant extent at an E:T ratio of 100. Moreover, the
cell lines K562 (chronic myelogenous leukemia, Lane 10) and
Daudi (Burkitt’s lymphoma, Lane 11), which are sensitive to
lysis by natural killer cells and lymphokine-activated killer cells,
respectively, were not lysed by the
PSCA14–22-reactive CTLs. The relatively low
lysis of LNCaP cells was not attributable to a poor ability of these
cells to present peptides on HLA-A0201 in general because
the specific lysis could be enhanced by exogenously pulsing LNCaP cells
with the PSCA14–22 peptide (Fig. 6B)
.
Most likely, the moderate specific lysis of LNCaP cells is attributable
to a relatively low level of endogenous PSCA expression, as we have
determined by RT-PCR (Fig. 1)
and a quantitative real time PCR analysis
(data not shown). The presentation of the
PSCA14–22 peptide was not confined to LNCaP
cells but occurred also in the PSCA-expressing but
HLA-A0201-deficient prostate carcinoma lines PC-3 and DU-145
when these were infected with a recombinant vaccinia virus expressing
the HLA-A0201 molecule (34)
but not when they
were infected with a control recombinant vaccinia virus expressing the
influenza matrix protein (Ref. 35
; Fig. 6B
).
Taken together, our data indicate that the generated CTLs are specific
for the peptide ALQPGTALL encompassing residues 14–22 of PSCA. Because
CTLs reactive to this epitope lyse three independent
PSCA+ prostate carcinoma cell lines, PSCA and
this epitope should be promising target antigens for vaccination
against CaP.
|
|
DISCUSSION |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The CTLs that we could raise against PSCA were directed against the
HLA-A0201-restricted peptide ALQPGTALL covering residues
14–22 of the PSCA sequence. This peptide could stabilize
HLA-A0201-ß2-microglobulin complexes on the cell surface of
TAP-deficient lymphoblastoid T2 cells. The fact that two additional
peptides (PSCA7–16 and
PSCA115–123), which stabilized HLA-A0201 cell
surface expression with similar off-rates as
PSCA14–22, did not give rise to peptide-specific
T cells in parallel cultures may indicate that the T-cell precursor
frequency of PSCA14–22-specific peptides was
enhanced in this patient, or alternatively, that there were no T cells
in the repertoire reacting to the other two epitopes. More importantly,
our PSCA14–22-specific CTLs were able to lyse
three independent CaP cell lines, suggesting that this epitope can be
processed in CaP cells from endogenously expressed PSCA proteins. The
finding that IFN- stimulation of LNCAP target cells was required for
recognition by CTLs may be attributable to an insufficient expression
of HLA-A0201 molecules in unstimulated LNCAP cells, although our flow
cytometric analyses revealed only a minor up-regulation of HLA-A0201
cell surface expression in some of the experiments. A more likely
explanation is that the intracellular production and transport of the
PSCA14–22 epitope may be limiting and that
factors that are induced by IFN-, e.g., the two subunits
of the TAP or the proteasome subunits LMP2, LMP7, and MECL-1 as well as
PA28
/ß, are required to achieve T-cell recognition
(36)
. We have not yet determined whether the intracellular
production of the PSCA14–22 epitope can be
inhibited by specific inhibitors of proteasome activity. Nevertheless,
it is important that IFN- stimulation does not abrogate PSCA
presentation because it has been shown recently for a number of tumor
epitopes that they could be processed by constitutively expressed
proteasomes of unstimulated tumor cells but not by immunoproteasomes in
mature dendritic cells or after induction of tumor cells with IFN-
(37)
.
To avoid autoimmune destruction of tissues upon vaccination, it would
be ideal if the expression of a target antigen for CaP immunotherapy
was strictly confined to CaP and/or the prostate. We analyzed PSCA
expression by RT-PCR and found no expression in testis, spleen, liver,
bone marrow, kidney, lymph node, lung, bladder, cerebellum, or colon.
Principally, this finding is consistent with the original Northern
analyses by Reiter et al. (25)
, who found PSCA to be
predominantly expressed in prostate and in placenta. However, a minor
PSCA expression was reported in this study for kidney and small
intestine, which was 
100-fold lower compared with expression levels
in the prostate. Recently, an immunohistochemical analysis by Gu
et al. (27)
revealed that within these organs
the PSCA protein expression is confined to the renal collecting ducts
and neuroendocrine cells of the stomach and the colon. Because these
cells constitute only a small fraction of the respective organs, this
may explain why we did not find PSCA expression in colon and kidney by
RT-PCR. Although the expression level of PSCA in these cells appeared
to be lower than in CaP and epithelial cells of the prostate, it will
be necessary to quantify the amounts of PSCA in isolated neuroendocrine
cells and in prostate epithelial cells by real time PCR or Western
analysis for a direct comparison. Moreover, it would be important to
test whether the PSCA expression in cell lines of colonic or gastric
neuroendocrine origin is high enough to be recognized and lysed by our
PSCA-specific CTL line.
Our quantification of PSCA mRNA levels in BPH tissue and CaP specimens revealed that PSCA was consistently expressed in BPH, primary CaP, and metastases, but at least according to semiquantitative RT-PCR analyses, we obtained no evidence for a correlation between up-regulation of PSCA and tumor grade. Furthermore, we did not detect higher levels of PSCA mRNA in tumor tissue as compared with BPH specimens. At first glance, these data appear to contradict recent observations by Gu et al. (27) , who found that the level of PSCA expression increased with higher Gleason score, higher tumor stage, and progression to androgen independence. However, Reiter and colleagues used different techniques in their analyses, such as in situ hybridizations (26) and immunohistochemical analyses using PSCA-specific monoclonal antibodies (27) . Both methods can distinguish CaP tissue from surrounding nonneoplastic prostatic tissue, which is not possible when isolating total RNA for RT-PCR analysis from heterogeneous tissues. Because the content of CaP cells in our samples could only be roughly estimated and varied between 30 and 90%, it may be possible that our results underestimate the level of PSCA expression in CaP cells. Unfortunately, we could not obtain nonhyperplastic prostatic tissue for this study which would have allowed us to compare PSCA expression of normal prostate, BPH, and CaP samples. Therefore, it cannot be ruled out that a stimulation of PSCA-specific CTLs may lead to a destruction of hyperplastic as well as normal prostatic tissue. Nevertheless, it is evident from our analysis that PSCA is at least maintained in expression from BPH through all stages of CaP in the vast majority of cases, which would make it a promising target for immunotherapy of CaP.
Interestingly, we observed in a single CaP patient that PSCA expression in a bone metastasis was considerably higher than in the primary tumor and in a liver metastasis, suggesting that PSCA expression might be up-regulated in bone metastases. A very similar finding was reported by Gu et al. (27) in three cases where it was possible to compare PSCA expression in metastases from bone and primary tumors. A potential explanation for these observations may be that factors are produced in bone marrow that either lead to an up-regulation of PSCA expression or to a selective expansion of PSCA-expressing CaP cells. Because CaP preferentially metastasizes to the bone, the up-regulation of PSCA in bone tissue would be a strong argument for using this protein as an antigen for CaP immunotherapy.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
1 This work was supported by Cancer League St.
Gallen-Appenzell, Swiss Cancer League, Foundation Propter Homines,
Cancer Research Institute, CaPCURE Foundation, R. and A. Dietschweiler
Foundation, W. and V. Spühl-Foundation, and AstraZeneca AG. 
2 To whom requests for reprints should be
addressed, at Kantonsspital St. Gallen, Laborforschungsabteilung, Haus
09, CH-9007 St. Gallen, Switzerland. Phone: 44-71-494-1069; Fax:
44-71-494-6321; E-mail: lfal{at}ms1.kssg.ch
3 The abbreviations used are: CaP, carcinoma of
prostate; PSA, prostate-specific antigen; PSMA, prostate-specific
membrane antigen; PAP, prostatic acid phosphatase; PAGE, prostate
antigen encoded gene; PSP, prostate secretory protein; BPH, benign
prostatic hyperplasia; IL, interleukin; PBMC, peripheral blood
mononuclear cell; PSCA, prostate stem cell antigen; RT-PCR, reverse
transcription-PCR; TAP, transporter associated with antigen
processing.
Received 4/28/00. Accepted 8/ 4/00.
|
REFERENCES |
|---|
|
TopABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  H. Kobayashi, T. Nagato, K. Oikawa, K. Sato, S. Kimura, N. Aoki, R. Omiya, M. Tateno, and E. Celis Recognition of Prostate and Breast Tumor Cells by Helper T Lymphocytes Specific for a Prostate and Breast Tumor-Associated Antigen, TARP Clin. Cancer Res., May 15, 2005; 11(10): 3869 - 3878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Lam, J. Yamashiro, I. P. Shintaku, R. L. Vessella, R. B. Jenkins, S. Horvath, J. W. Said, and R. E. Reiter Prostate Stem Cell Antigen Is Overexpressed in Prostate Cancer Metastases Clin. Cancer Res., April 1, 2005; 11(7): 2591 - 2596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. Tricoli, M. Schoenfeldt, and B. A. Conley Detection of Prostate Cancer and Predicting Progression: Current and Future Diagnostic Markers Clin. Cancer Res., June 15, 2004; 10(12): 3943 - 3953. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. S. NELSON Identifying Immunotherapeutic Targets for Prostate Carcinoma through the Analysis of Gene Expression Profiles Ann. N.Y. Acad. Sci., December 1, 2002; 975(1): 232 - 246. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Lu and E. Celis Recognition of Prostate Tumor Cells by Cytotoxic T Lymphocytes Specific for Prostate-specific Membrane Antigen Cancer Res., October 15, 2002; 62(20): 5807 - 5812. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Yang, G. E. Holt, M. P. Velders, E. D. Kwon, and W. M. Kast Murine Six-Transmembrane Epithelial Antigen of the Prostate, Prostate Stem Cell Antigen, and Prostate-specific Membrane Antigen: Prostate-specific Cell-Surface Antigens Highly Expressed in Prostate Cancer of Transgenic Adenocarcinoma Mouse Prostate Mice Cancer Res., August 1, 2001; 61(15): 5857 - 5860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Argani, C. Rosty, R. E. Reiter, R. E. Wilentz, S. R. Murugesan, S. D. Leach, B. Ryu, H. G. Skinner, M. Goggins, E. M. Jaffee, et al. Discovery of New Markers of Cancer through Serial Analysis of Gene Expression: Prostate Stem Cell Antigen Is Overexpressed in Pancreatic Adenocarcinoma Cancer Res., June 1, 2001; 61(11): 4320 - 4324. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Amara, G. S. Palapattu, M. Schrage, Z. Gu, G. V. Thomas, F. Dorey, J. Said, and R. E. Reiter Prostate Stem Cell Antigen Is Overexpressed in Human Transitional Cell Carcinoma Cancer Res., June 1, 2001; 61(12): 4660 - 4665. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. C. Saffran, A. B. Raitano, R. S. Hubert, O. N. Witte, R. E. Reiter, and A. Jakobovits Anti-PSCA mAbs inhibit tumor growth and metastasis formation and prolong the survival of mice bearing human prostate cancer xenografts PNAS, February 8, 2001; (2001) 51624698. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. K. Sharma, J. J. Kuhns, S. Yan, R. H. Friedline, B. Long, R. Tisch, and E. J. Collins Class I Major Histocompatibility Complex Anchor Substitutions Alter the Conformation of T Cell Receptor Contacts J. Biol. Chem., June 8, 2001; 276(24): 21443 - 21449. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Saffran, A. B. Raitano, R. S. Hubert, O. N. Witte, R. E. Reiter, and A. Jakobovits Anti-PSCA mAbs inhibit tumor growth and metastasis formation and prolong the survival of mice bearing human prostate cancer xenografts PNAS, February 27, 2001; 98(5): 2658 - 2663. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||
