
[Cancer Research 60, 5522-5528, October 1, 2000]
© 2000 American Association for Cancer Research
Prostate Stem Cell Antigen Is a Promising Candidate for Immunotherapy of Advanced Prostate Cancer1
Jens Dannull,
Pierre-André Diener,
Ladislav Prikler,
Gregor Fürstenberger,
Thomas Cerny,
Ulrico Schmid,
Daniel K. Ackermann and
Marcus Groettrup2
Departments of Laboratory Research [J. D., M. G.], Urology [L. P., D. K. A.], Oncology [G. F., T. C.], and Pathology [P. A. D., U. S.], Cantonal Hospital St. Gall, 9007 St. Gallen, Switzerland
 |
ABSTRACT
|
|---|
Immunotherapy of prostate cancer (CaP) may be a promising novel
treatment option for the management of advanced CaP. However, the lack
of suitable tumor antigens remains a major obstacle for the rational
design of vaccines. To characterize potential CaP antigens, we
determined the mRNA expression of the prostate-specific genes
C1, C2, C5, PAGE-1, and prostate stem cell
antigen (PSCA) in hormone-refractory CaP, benign
prostatic hyperplasia, CaP cell lines, and CaP specimens. Among these
gene products, only expression of PSCA appears to be retained in the
majority of advanced CaP samples, as shown by reverse transcription-PCR
analyses. Peptide fragments of PSCA presented in the context of major
histocompatibility molecules could serve as recognition targets for CD8
T cells, provided these lymphocytes were not clonally deleted or
peripherally tolerized. Our goal was to determine whether the human
T-cell repertoire could recognize PSCA-derived peptide epitopes in the
context of a common class I allele, HLA-A0201. Of nine
peptides that, according to HLA-A0201 binding motifs,
were candidate ligands of A0201 class I molecules, three peptides were
able to stabilize HLA-A0201 molecules on the cell
surface. One of the latter peptides, encompassing amino acid residues
1422, was capable of generating a PSCA-specific T-cell response in a
human lymphocyte culture from a patient with metastatic CaP.
PSCA-specific CTLs recognized peptide-pulsed targets as well as three
prostate carcinoma lines in cytotoxicity assays, indicating that this
peptide could be endogenously processed. In conclusion, our findings
establish PSCA as a potential target for antigen-specific, T cell-based
immunotherapy of prostate carcinoma.
 |
INTRODUCTION
|
|---|
CaP3
is the most common cancer diagnosis and the second leading cause of
cancer-related deaths in men. Despite recent advances in detection of
CaP and treatment of localized disease, significant challenges unique
to CaP remain to be overcome. In particular, there is no effective
treatment for patients who develop recurrent disease after surgery or
radiation therapy or those who have metastatic disease at the time of
diagnosis. Although hormone ablation therapy may palliate patients with
advanced disease temporarily, the progression to incurable
hormone-refractory CaP is almost inevitable (1)
.
Therefore, the development of novel therapeutic modalities for the
treatment of hormone-refractory CaP is of paramount importance. Several
new CaP treatment approaches aim to eradicate CaP cells by inducing
systemic immunity to antigens expressed by CaP cells as well as normal
prostate (2, 3, 4, 5, 6)
. However, the identification of target
tumor antigens that are capable of overcoming immune tolerance against
proteins expressed in normal prostate remains a major obstacle for
developing rational strategies in CaP immunotherapy. Over the past
years, several prostate-specific gene products have been reported.
These include PSA (7)
, PSMA (8)
, PAP
(9)
, prostate carcinoma tumor antigen 1 (10)
,
PAGE-4 (11)
, PSP 94 (12)
, six-transmembrane
epithelial antigen of the prostate (13)
, differential
display 3 (14)
, and prostate androgen-regulated transcript
1 (15)
. The rationale of using prostate-specific
genes as target antigens for immunotherapy is based on a decade of
intensive research in the melanoma field, leading to the insight that
prominent antigens of melanoma-specific CTLs were expressed in
melanocytes in a tissue-specific manner (16)
. Apparently,
the presumed tolerance of peripheral T cells against these self
antigens can be overcome if aberrant expression in tumors occurs.
Moreover, this antitumor response could be successfully enhanced by
several vaccination procedures using melanocyte antigens
(17, 18, 19)
. The consequence of this type of antitumor
response was on the one hand regression of melanoma lesions but on the
other hand vitiligo as a result of CTL-mediated melanocyte destruction.
Because many of the so-called "cancer testis" antigens, which are
expressed in testis and in several different malignancies, are not
prevalent in the majority of CaP specimens, organ-specific gene
products were considered as target antigens in CaP. This approach seems
reasonable because in organ-confined CaP, the prostate is surgically
removed and because the life of vaccinated patients would not be
endangered if healthy prostate tissue was damaged by CTLs.
Unfortunately, the majority of defined prostate-specific gene products
display properties that limit their utilization as antigens in specific
immunotherapy of CaP. PSA, PSMA, PAP, PSP 94, and prostate carcinoma
tumor antigen 1 are secretory proteins that are found in considerable
concentrations in the serum and hence are likely to induce peripheral
tolerance. The expression of PSA and PAP in tissue is reduced in
neoplastic cells of poorly differentiated tumors compared with normal
prostatic tissue and well-differentiated adenocarcinomas
(20)
. In addition, PSA has a high degree of homology with
members of the kallikrein family, and PSMA has been found to be
expressed in various human tissues (21)
, thus bearing the
risk of generating autoimmune disease upon protein-based vaccination.
PSP 94 (22)
and PAGE-4 (11)
seem to be
down-regulated in tumor tissue, and expression of six-transmembrane
epithelial antigen of the prostate appears to be expressed at low
levels in several other tissues (13)
. Prostate
androgen-regulated transcript 1 expression is regulated by androgens
(15)
, which is a drawback for strategies aiming to
eliminate hormone-refractory tumors. Lastly, the mRNA of differential
display 3 does not contain extensive open reading frames and has,
therefore, been suggested to function as a noncoding RNA
(14)
.
However, there are new and partially characterized
prostatespecific genes that warrant further investigation
regarding their potential as CaP antigens. Little is known about the
CaP expression status of C1, C2, and C5, which are prostate-specific
mRNAs identified from expressed sequence tag libraries
(23)
. On the other hand, PAGE-1 (24)
and PSCA
(25, 26, 27)
have been identified as gene products
specifically overexpressed in hormone-independent CaP cell lines or
tumor tissue, respectively. PAGE-1 was identified by differential
display PCR as an mRNA that is up-regulated in androgen-insensitive
metastatic sublines of the CaP cell line LNCaP. The PAGE-1 protein
shares 45% homology with antigens of the "cancer-testis" family,
and its expression was found to be restricted to LNCaP sublines,
testes, and placenta (24)
. PSCA was isolated by
representational difference analysis in the LAPC-4 xenograft model and
was found to be up-regulated in tumor xenografts when compared with
normal prostate (25)
. The PSCA gene codes for a
123-amino acid glycoprotein that is not homologous to other genes
except for a 30% identity to stem cell antigen 2. Topologically, PSCA
was characterized as a glycosylphosphatidylinositol-anchored cell
surface antigen (25)
. Interestingly, PSCA was not
differentially expressed between androgen-dependent and -independent
LAPC-4 tumors, which would make it an attractive target for vaccination
against hormone-refractory CaP.
In this study, we asked whether PAGE-1, PSCA, C1, C2, and C5 are
suitable as target antigens for immunotherapy of hormone-refractory CaP
in terms of gene expression in tumor specimens and, furthermore, if
antigen-specific cytotoxic T cells recognizing these antigens can be
found in vivo. Although C1, C2, C5, and PAGE-1 were not
expressed in the majority of CaP specimens, PSCA was found in all
samples analyzed. Using a "reverse immunology" approach, we
identified an HLA-A0201-restricted T-cell epitope from PSCA. CTLs
against this epitope could be generated from peripheral blood of a CaP
patient that recognized and killed CaP cell lines, suggesting that PSCA
protein as well as this peptide epitope may be valuable antigens for
tumor vaccination against CaP.
 |
MATERIALS AND METHODS
|
|---|
Cell Lines and Antibodies.
For HLA-A0201 typing, donors and cell lines were prescreened with the
HLA-A2-specific antibody BB7.2 (American Type Culture Collection,
Manassas, VA) by flow cytometry. HLA-A2-positive cells were subtyped by
PCR as described previously (28)
. The cell lines K562
(chronic myelogenous leukemia), HepG2 (hepatocellular carcinoma), Hep-2
(carcinoma of larynx), T89G (glioblastoma), MCF-7 (breast carcinoma),
SW620 (colon carcinoma), T2 (B and T lymphoblast hybrid), LNCaP1740,
LNCaP10990, DU-145, and PC-3 (all CaP) cell lines were obtained from
American Type Culture Collection. Lymphokine-activated killer-sensitive
Daudi cells (Burkitts lymphoma) were kindly provided by Maries
van den Broek (ETH, Zürich, Switzerland), and Tsu-pr1 (CaP) were
obtained from Maries Verkaik (Erasmus University Rotterdam, the
Netherlands). Cell lines were maintained in complete RPMI 1640 (RPMI
1640, 10% heat-inactivated FCS, 2 mM glutamine, and 100
units/ml penicillin/streptomycin). The androgen-independent sublines of
LNCaP were generated by maintaining cells in RPMI 1640 with 10%
charcoal-stripped FCS (29)
. Briefly, 0.625 g of charcoal
was coated with 12.5 mg of dextran sulfate (Sigma, Buchs, Switzerland)
in 50 ml of PBS for 5 min at room temperature. The charcoal was then
washed once with 500 ml of PBS before being mixed with 500 ml of FCS.
After 30 min of shaking at room temperature, the charcoal was removed
from the serum by centrifugation (1500 x g),
followed by 0.4-µm filtration. For stimulation with IFN-
, cell
lines were plated in complete RPMI 1640 in six-well plates at
105 cells/well. Cells were stimulated with 200
units/ml of recombinant human IFN-
(Roche, Rotkreuz, Switzerland)
for 2 days with daily exchanges of medium.
Peptide Synthesis.
Peptides were synthesized by ECHAZ microcollections (Tübingen,
Germany) using standard f-moc technology:
PSCA513, LLALLMAGL;
PSCA716, ALLMAGLAL;
PSCA1422, ALQPGTALL;
PSCA2028, ALLCYSCKA;
PSCA4351, QLGEQCWTA;
PSCA105113, AILALLPAL;
PSCA108116, ALLPALGLL;
PSCA109117, LLPALGLLL; and
PSCA115123, LLLWGPGQL. As positive controls,
the PSMA peptide, LLHETDSAV (30)
, and the influenza matrix
protein-derived peptide 5866, GILGFVFTL, were used. Peptides were
dissolved to a final concentration of 10 mM in DMSO and
stored at -20°C.
T2 Binding Assays.
Each peptide was tested for concentration-dependent binding to T2 cells
in HLA-A0201 stabilization assays. T2 (TAP-deficient) cells were
incubated at room temperature overnight with the indicated PSCA
peptides over a range of peptide concentrations from 0.5 to 10
µM in the presence of 1 µg/ml
ß2-microglobulin (Sigma). Stability of
HLA-A0201 was assayed by flow cytometry (FACScan; Becton Dickinson)
after staining the cells with antibody BB7.2 (5 µg/ml) and goat
antimouse-FITC (AMRAD, Melbourne, Australia). The peptide GILGFVFTL of
influenza matrix protein, residues 5866, was used as a positive
control. Alternatively, in "off-assays," T2 cells were incubated
overnight at room temperature in the presence of 10 µM
peptide, followed by an incubation at 37°C in the presence of
10-4 M emetine (Sigma). The loss of
HLA-A0201 molecules from the cell surface was monitored by flow
cytometry after 1, 2, 3, 4, and 6 h, respectively.
Oligodeoxynucleotides and PCR.
Oligodeoxynucleotide primers for PCR reactions were purchased from the
Microsynth Company (Balgach, Switzerland):
PSCAsense, 5'-CTTGCCCTGTTGATGGCAGGC;
PSCAantisense, 5'-CCAGAGCAGCAGGCCGAGTGC
(25)
; ß-actinsense,
5'-CACTGTGTTGGCGTACAGGT; ß-actinantisense,
TCATCACCATTGGCAATGAG; PAGEsense,
5'-CTAGAATTCAGCGGCCGTG; PAGEantisense,
5'-CTGTAAAGCTTTATTGGGAG; C1sense,
5'-GGCTTATTTAAAAGACATGAC; C1antisense,
5'-GAAGAAAGCTTATCTGGAGTG; C2sense,
5'-CGACCTACGTCTCAACCCTC; C2antisense,
5'-CTCCCATGGCCTCCCACAGG; C5sense,
5'-ACCAAAGATCTGCTTTTATC; C5antisense,
5'-GAATCCAGAGCTCCAACACC; PSAsense,
5'-GAGGTCCACACACTGAAGTT; and PSAantisense,
5'-CCTCCTGAAGAATCGATTCCT.
Synthesis of cDNA and RT-PCR.
Total RNA was isolated from tissues and cell lines by conventional acid
guanidinium thiocyanate-phenol-chloroform extraction and, subsequently,
treated with DNase I (Roche). Two µg of total RNA were used for
synthesis of first-strand cDNA using Moloney Murine Leukemia virus
reverse transcriptase (Promega Corp., Wallisellen, Switzerland)
following the manufacturers recommendations. One-twenty-fifth (1
µl) of the resulting cDNA was amplified by PCR. Thermal cycling of
PSCA-RNA was performed for 35 cycles at 94°C for 1 min, 58°C for 1
min, and 72°C for 1 min, followed by extension at 72°C for 10 min.
Annealing temperatures for different gene products were as follows: C1,
55°C; C2, 60°C; C5, 55°C; PAGE, 60°C; PSA, 54°C; and
ß-actin, 54°C. PCR reactions were carried out in the presence of 50
mM KCl, 10 mM Tris-HCl (pH 9.0), 0.01% Triton
X-100, 0.25 mM of each of the deoxynucleotides, 1 unit of
Taq DNA polymerase, and 2 mM MgCl2
(except for PSCA, where 3 mM MgCl2
was used).
Cytolytic Assay.
Target cells were harvested, washed, counted, and labeled with 100
µCi of
Na251CrO4
(EGT Chemie, Tageri, Switzerland) in 0.5 ml complete RPMI 1640 at
37°C for 1.5 h. Exogenous loading of cells with 10
µM synthetic peptide was performed simultaneously with
labeling reactions. Infection of target cells with recombinant vaccinia
viruses was performed 10 h before labeling at an multiplicity of
infection of 5. CTLs were washed, counted, and diluted to the desired
density in complete RPMI 1640 and plated in duplicate wells in a
round-bottomed, 96-well plate. Target cells were washed three times,
diluted to 104 cells/ml, and plated with CTLs. To
control for nonspecific lysis by natural killer cells or
lymphokine-activated killer cells, respectively, K562 and Daudi cells
were included as targets in our assays. The plates were spun briefly at
800 x g and incubated for 45 h at 37°C.
Supernatants were harvested and counted in a gamma counter. Duplicate
wells were averaged, and the percentage of specific lysis was
calculated as:
 |
CTL Generation from Peptide-pulsed PBMCs.
Peptide-specific, short-term CTL cultures were generated to the PSCA
peptides. HLA-A0201-positive PBMCs from a patient with metastatic
prostate cancer were pulsed with 10 µM peptide for 2 h at 37°C in serum-free media (X-VIVO 15; BioWhittaker, Verviers,
Belgium), washed, and cultured in the presence of 10 units/ml IL-2 in
complete RPMI 1640 at 105 cells/200 µl per
well. IL-2 (Sigma) was added twice weekly at 10 units/ml. Cells were
restimulated every 2 weeks by addition of autologous, peptide-pulsed,
washed, and irradiated (80 Gy) PBMCs at a 1:1 ratio. After 8 weeks in
culture, cells were tested for cytotoxicity.
Patients.
All clinical material was obtained by prostatectomy, transurethral
resection of prostate, or autopsy, after informed consent from patients
according to an Institutional Review Board-approved protocol.
Surgically harvested specimens were examined by a pathologist and
frozen at -70°C within 30 min. The material was classified as BPH,
locally confined CaP, locally advanced CaP, or metastatic disease as
detailed in Table 1
. Autopsies were performed within 2 h after death.
 |
RESULTS
|
|---|
RT-PCR Analysis of CaP Cell Lines, BPH, and CaP Tissue.
The qualification of a prostate-specific protein as a target antigen
for vaccination of CaP relies on a maintained expression in the
majority of CaP specimens. To determine the mRNA expression levels of
the candidate genes C1, C2, C5, PAGE-1, and PSCA,
we performed RT-PCR analysis on a panel of CaP cell lines, one BPH
sample, and seven tumor specimens (two hormone-refractory metastases,
three hormone-refractory primary tumors, and two hormone-dependent
primary tumors; Fig. 1
). As positive controls for the quality of our cDNA, we performed
amplifications of ß-actin (data not shown) and PSA (Fig. 1
, top
panel) mRNA. As expected, PSA mRNA can be detected in LNCaP 1740
(Lane 1), LNCaP 10990 (Lane 3), BPH tissue
(Lane 8), and all CaP specimens, although to varying
degrees. Consistently, PSA expression is absent in androgen
receptor-negative cell lines DU-145, PC-3, and Tsu-pr1 (Lanes 5,
6, and 7). An androgen-independent (ai) subline of
LNCaP 1740 (Lane 2), which we have generated by androgen
deprivation of the parental line, reveals a similar PSA signal as the
parental line, whereas expression of PSA is down-regulated in LNCaP
10990-ai (Lane 4). PSCA mRNA can be found in all CaP cell
lines at similar levels, except for lower expression in LNCaP 1740-ai
and Tsu-pr (Lanes 2 and 7). Furthermore, PSCA
mRNA could be detected in BPH and at different levels, but
consistently, in most specimens examined (see also Fig. 4
). PAGE-1 mRNA
could not be detected in any of the samples analyzed. However, in
agreement with published data (24)
, PAGE-1 expression
could be found in testis, which demonstrates that the former result is
not attributable to inappropriate amplification conditions in our PCR
reactions (data not shown). Chen et al. (24)
could detect expression of PAGE-1 only in androgen-independent,
metastatic sublines of LNCaP that had been isolated from castrated nude
mice but not in parental LNCaP cells, PC-3 cells, DU-145 cells, or even
normal prostate. Additionally, a recent publication suggests that
PAGE-1 is most likely an unknown member of the GAGE family,
i.e., a shared cancer-testis antigen, rather than a
prostate-specific gene product (31)
.

View larger version (72K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 1. RT-PCR analysis of mRNA expression of PSA, PSCA, PAGE-1,
C1, C2, and C5 in CaP cell lines, BPH, and CaP specimens. LNCaP 1740
(Lane 1), LNCaP 1740-androgen-independent (ai;
Lane 2), LNCaP 10990 (Lane 3), LNCaP
10990-ai (Lane 4), DU-145 (Lane 5), PC-3
(Lane 6), Tsu-pr1 (Lane 7), BPH
(Lane 8), hormone-refractory metastases (Lanes
9 and 15), hormone-refractory primary tumors
(Lanes 10, 11, and 13), hormone-dependent
primary tumors (Lanes 12 and 14).
Ethidium bromide-stained agarose gels are shown.
|
|

View larger version (49K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 4. RT-PCR analysis of mRNA expression of PSCA in 2 BPH,
6 hormone-refractory metastases (Lanes 16), 10
hormone-refractory primary CaP samples (Lanes 716),
and 10 hormone-dependent primary CaP specimens (Lanes
1726). A, RT-PCR analysis of PSCA mRNA.
B, integrity of RNA preparations was controlled by
RT-PCR analyses of ß-actin mRNA. The numbering of Lanes
126 corresponds to sample numbers listed in Table 1
.
|
|
C1 mRNA could only be detected in one CaP specimen as well as in BPH at
a very low level, C2 expression was evident only in BPH as well as in
one CaP specimen, and expression of C5 could be found in PC-3 cells as
well as in LNCaP cell lines, at low levels. These data clearly
demonstrate that among the gene products analyzed, only PSCA exhibited
consistent expression in both androgen-dependent and
androgen-independent samples, although at varying levels. Therefore, we
decided to further characterize PSCA as a candidate gene for
CaP vaccination.
Tissue Specificity of PSCA Expression.
To determine the tissue specificity of PSCA expression, we harvested
nonprostatic tissues during the autopsy of a patient who died from
metastatic prostate cancer and subjected isolated RNA to RT-PCR
analyses. This patient had metastatic lesions in os sacrum, os ileum,
lumbal spine, and liver. Bone marrow was harvested from the femur.
Among the tissues analyzed, PSCA expression was only found in bone
marrow (Fig. 2
, Lane 6). This result is unexpected, and we asked if the
PSCA signal was attributable to the presence of CaP cells in the bone
marrow or if our PCR picked up a gene product expressed in
hematopoietic tissue. Therefore, we harvested three additional bone
marrow samples, one from a healthy donor, one from a leukemia patient,
and one during autopsy of a female patient who died from nonmalignant
disease.

View larger version (52K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 2. Tissue specificity of PSCA expression. RNA was isolated
from various nonprostatic tissues, and expression of PSCA-mRNA was
determined by RT-PCR. Top, as positive controls, cDNA
derived from LNCaP 1740 (Lane 1) or BPH tissue
(Lane 2) were included in RT-PCR analyses. Tissues
analyzed were: Lane 3, testis; Lane 4,
spleen; Lane 5, liver; Lane 6, bone
marrow derived from patient with metastatic CaP; Lane 7,
kidney; Lane 8, lymph node; Lane 9, lung;
Lane 10, bladder; Lane 11, cerebellum;
and Lane 12, colon. Bottom, RT-PCR for
ß-actin was performed to ensure integrity of isolated RNAs.
|
|
As can be seen in Fig. 3
, PSCA could only be detected in the bone marrow derived from the
patient with metastatic CaP (Fig. 3
, Lane 1). Amplification
of ß-actin RNA (Fig. 3
, bottom) demonstrates that equal
amounts of cDNA have been included in our RT-PCR. These results suggest
that PSCA expression in the bone marrow of the patient with metastatic
CaP was attributable to the presence of CaP cells in his bone marrow.
It is interesting to note that the PSCA signal in this bone marrow
sample is exceptionally high, because PSCA expression in primary tumor
and a liver metastasis (>90% CaP tissue) derived from the same
patient is significantly lower (Fig. 1
, Lane 15).

View larger version (58K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 3. Expression of PSCA mRNA in bone marrow. RNA was isolated
from four different bone marrow samples and subjected to RT-PCR
analysis. Top, RT-PCR for PSCA. M, DNA
molecular weight marker. Lane 1, bone marrow derived
from patient with metastatic CaP; Lane 2, bone marrow
derived from healthy male donor; Lane 3, bone marrow of
male leukemia patient; Lane 4, bone marrow of female
patient who died from nonmalignant disease. Bottom,
RT-PCR analysis for ß-actin mRNA was performed for the same samples
to control for the quality of RNA isolations.
|
|
Semiquantitative RT-PCR of CaP Specimens and BPH Samples.
Given that PSCA appeared to be a promising candidate for CaP tumor
vaccination, we decided to investigate the PSCA expression at the mRNA
level by semiquantitative RT-PCR for a larger panel of 10
hormone-dependent primary CaP samples, 10 hormone-independent primary
CaP samples, 6 hormone-refractory CaP metastases, and 2 samples of BPH.
As shown in Fig. 4
A, PSCA was expressed in all samples examined, and no
evidence for complete down-regulation of PSCA expression, either in
hormone-dependent or -refractory primary CaP or in CaP metastases,
could be obtained. Most of the hormone-dependent CaP samples displayed
a higher level of PSCA expression compared with BPH specimens, whereas
some of the metastases and hormone-refractory primary CaP samples
appeared to express slightly reduced levels of PSCA mRNA. Although we
used an amplification of ß-actin mRNA to control for the integrity
and amount of mRNA in the preparations (Fig. 4B)
, the
determination of PSCA mRNA levels by RT-PCR is at best
semiquantitative. Taking these limitations into consideration, we
conclude from our analysis that, compared with BPH, there is no
evidence for either a selective loss or for a general up-regulation of
PSCA expression in metastases or hormone-refractory CaP samples.
Identification of HLA-A0201-binding PSCA Peptides.
We next sought to identify potential HLA-A0201-restricted PSCA peptide
epitopes that may be recognized by PSCA-specific T cells.
Computer-based analysis (32
, 33)
of the published human
PSCA sequence (25)
was performed to identify 9-mer
peptides whose sequences conformed to the well-characterized binding
motif for HLA-A0201. Table 2
presents the HLA-A0201 binding properties of PSCA peptide epitopes and
those of the immunodominant HLA-A0201-restricted influenza matrix
peptide M15866 and of the PSMA peptide
LLHETDSAV, which is currently being used for dendritic cell-based
vaccination of patients with metastatic CaP (30)
. All
peptides analyzed bound strongly to HLA-A0201 and stabilized MHC
molecules at peptide concentrations <0.5 µM, except for
PSCA2028 (4 µM) and
PSCA4351 (1 µM), which contain
only one HLA-anchor (leucine) residue at position 2. However,
significant differences between peptide epitopes could be detected when
analyzing the duration of HLA-A0201 stabilization on the cell surface
of peptide-pulsed cells. Only peptides PSCA716,
PSCA1422, and
PSCA115123 were capable of stabilizing MHC
molecules for up to 6 h. For these peptides, we determined whether
they were capable of stimulating human PSCA-specific T cells in
vitro.
Generation and Characterization of CTLs Specific for an
HLA-A0201-restricted PSCA Epitope.
The peptides PSCA716,
PSCA1422, and
PSCA115123 were used to stimulate human T cells
in vitro. Bulk T-cell cultures were generated from PBMCs
obtained from a patient with hormone-refractory metastatic CaP by
pulsing the cells with the respective synthetic peptides in the
presence of IL-2. After 8 weeks of expansion, the T-cell culture was
assayed for the ability to lyse HLA-A0201+ T2
lymphoblastoid cells, which were pulsed with the respective peptides in
a chromium release assay. Only CTL cultures that were restimulated with
the PSCA1422 peptide were able to specifically
lyse target cells presenting the respective epitope (Fig. 5)
, and it was also this T-cell culture that proliferated most vigorously
upon restimulation. At the time of specificity analysis, 70% of the
CTL culture consisted of
CD3+8+ cells, whereas there
were still some 30% CD3+4+
cells present, as determined by flow cytometry (data not shown).

View larger version (39K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 5. PSCA specificity of human lymphocyte culture pulsed with
PCSA1422. After 8 weeks of expansion, PBMCs were assayed
for cytotoxicity in a chromium release assay at an E:T ratio of 50:1.
Cytotoxicity was assayed against T2 cells,
PCSA1422-loaded T2 cells, natural killer-sensitive K562
cells, lymphokine-activated killer-sensitive Daudi cells, LNCaP cells,
and LNCaP cells that had been stimulated with IFN- . Values represent
means of triplicates with SE <5%.
|
|
To test whether the PSCA1422 epitope could be
intracellularly processed in CaP cells that endogenously express the
PSCA protein, we tested in a multistep PCR whether the
HLA-A0201 allele would be present in the CaP cell lines
LNCAP1740, DU-145, PC-3, and Tsu-pr1. Only LNCAP 1740 was positive for
HLA-A0201 and expressed the HLA-A0201 molecule on
the cell surface at low levels, which did not significantly increase
when the cells were treated with IFN-
for 2 days (data not shown).
When LNCaP cells were used as targets in a cytolytic assay, they were
lysed by PSCA1422-specific CTLs in the presence
but not in the absence of IFN-
, indicating that the
PSCA1422 epitope could be endogenously
processed and presented by IFN-
-stimulated CaP cells (Fig. 5)
. To
test whether the lysis by the PSCA1422-reactive
CTLs was specific for PSCA, other tumor cell lines, which we determined
to be HLA-A0201+, were used as targets
simultaneously with IFN-
-treated LNCAP cells at the highest E:T
ratio (Fig. 6A)
. In contrast to LNCaP cells that were lysed at E:T target
ratios ranging from 12.5 to 100 (Fig. 6
, Lanes 1215), the
tumor cell lines HepG2 (hepatocarcinoma, Lane 6), MCF-7
(mamma carcinoma, Lane 7), SW620 (colon carcinoma,
Lane 8), and T98G (glioblastoma, Lane 9) were not
lysed to a significant extent at an E:T ratio of 100. Moreover, the
cell lines K562 (chronic myelogenous leukemia, Lane 10) and
Daudi (Burkitts lymphoma, Lane 11), which are sensitive to
lysis by natural killer cells and lymphokine-activated killer cells,
respectively, were not lysed by the
PSCA1422-reactive CTLs. The relatively low
lysis of LNCaP cells was not attributable to a poor ability of these
cells to present peptides on HLA-A0201 in general because
the specific lysis could be enhanced by exogenously pulsing LNCaP cells
with the PSCA1422 peptide (Fig. 6B)
.
Most likely, the moderate specific lysis of LNCaP cells is attributable
to a relatively low level of endogenous PSCA expression, as we have
determined by RT-PCR (Fig. 1)
and a quantitative real time PCR analysis
(data not shown). The presentation of the
PSCA1422 peptide was not confined to LNCaP
cells but occurred also in the PSCA-expressing but
HLA-A0201-deficient prostate carcinoma lines PC-3 and DU-145
when these were infected with a recombinant vaccinia virus expressing
the HLA-A0201 molecule (34)
but not when they
were infected with a control recombinant vaccinia virus expressing the
influenza matrix protein (Ref. 35
; Fig. 6B
).
Taken together, our data indicate that the generated CTLs are specific
for the peptide ALQPGTALL encompassing residues 1422 of PSCA. Because
CTLs reactive to this epitope lyse three independent
PSCA+ prostate carcinoma cell lines, PSCA and
this epitope should be promising target antigens for vaccination
against CaP.

View larger version (25K):
[in this window]
[in a new window]
[Download PPT slide]
|
Fig. 6. Cytolytic assay for recognition of
PCSA1422/HLA-A0201 in prostate cancer and control cell
lines. A, IFN- -treated LNCaP cells and
PSCA1422 peptide loaded T2 cells were lysed at E:T ratios
ranging from 12.5 to 100; HLA-A0201+ control cell lines
were lysed at E:T = 100, as indicated. T2 cells
(lymphoblastoid, Lane 1), T2 cells pulsed with
PCSA1422 and lysed at E:T ratios of 12.5, 25, 50, and 100
(Lanes 25), IFN -stimulated
HLA-A0201+ control cell lines HepG2 (hepatoma, Lane
6), MCF-7 (breast carcinoma, Lane 7), SW620
(colon carcinoma, Lane 8), and T98G (glioblastoma,
Lane 9), K562 (chronic myelogenous leukemia, Lane
10), Daudi (Burkitts lymphoma, Lane 11),
IFN- stimulated LNCaP cells lysed at E:T = 12.5
(Lane 12), E:T = 25 (Lane
13), E:T = 50 (Lane 14), and
E:T = 100 (Lane 15). B,
comparison of HLA-A0201/PSCA1422-specific lysis of T2
cells, PSCA1422-loaded T2 cells, IFN- -treated LNCaP,
PSCA1422-loaded LNCaP cells, HLA-A0201-deficient prostate
carcinoma lines DU145 and PC3 infected with recombinant vaccinia
virus-HLA-A0201 (rVV-HLA-A0201) and
recombinant vaccinia virus control (rVVcontrol) as
indicated. The cytolytic assays were performed at an E:T ratio of 50.
Values represent means of triplicates with SE <10%.
|
|
 |
DISCUSSION
|
|---|
In the present study, we analyzed a number of prostate-specific
genes for their suitability as antigens for specific vaccination
against CaP. Although PAGE-1 and the expressed sequence tags C1, C2,
and C5 were not expressed in the majority of CaP samples, PSCA
fulfilled the criteria for serving as an antigen in CaP tumor
vaccination: (a) PSCA was expressed in the majority of CaP
samples and appeared not to be down-regulated in advanced stage
disease; (b) according to RT-PCR analysis, PSCA appeared not
to be expressed in human tissues other than the prostate and CaP; and
(c) CTLs could be raised from the blood of a CaP patient
that specifically recognized a PSCA peptide and lysed a PSCA-expressing
CaP cell line, indicating that tolerization or exhaustion of
PSCA-reactive CTLs in patients with progressing metastatic CaP does not
prevail.
The CTLs that we could raise against PSCA were directed against the
HLA-A0201-restricted peptide ALQPGTALL covering residues
1422 of the PSCA sequence. This peptide could stabilize
HLA-A0201-ß2-microglobulin complexes on the cell surface of
TAP-deficient lymphoblastoid T2 cells. The fact that two additional
peptides (PSCA716 and
PSCA115123), which stabilized HLA-A0201 cell
surface expression with similar off-rates as
PSCA1422, did not give rise to peptide-specific
T cells in parallel cultures may indicate that the T-cell precursor
frequency of PSCA1422-specific peptides was
enhanced in this patient, or alternatively, that there were no T cells
in the repertoire reacting to the other two epitopes. More importantly,
our PSCA1422-specific CTLs were able to lyse
three independent CaP cell lines, suggesting that this epitope can be
processed in CaP cells from endogenously expressed PSCA proteins. The
finding that IFN-
stimulation of LNCAP target cells was required for
recognition by CTLs may be attributable to an insufficient expression
of HLA-A0201 molecules in unstimulated LNCAP cells, although our flow
cytometric analyses revealed only a minor up-regulation of HLA-A0201
cell surface expression in some of the experiments. A more likely
explanation is that the intracellular production and transport of the
PSCA1422 epitope may be limiting and that
factors that are induced by IFN-
, e.g., the two subunits
of the TAP or the proteasome subunits LMP2, LMP7, and MECL-1 as well as
PA28
/ß, are required to achieve T-cell recognition
(36)
. We have not yet determined whether the intracellular
production of the PSCA1422 epitope can be
inhibited by specific inhibitors of proteasome activity. Nevertheless,
it is important that IFN-
stimulation does not abrogate PSCA
presentation because it has been shown recently for a number of tumor
epitopes that they could be processed by constitutively expressed
proteasomes of unstimulated tumor cells but not by immunoproteasomes in
mature dendritic cells or after induction of tumor cells with IFN-
(37)
.
To avoid autoimmune destruction of tissues upon vaccination, it would
be ideal if the expression of a target antigen for CaP immunotherapy
was strictly confined to CaP and/or the prostate. We analyzed PSCA
expression by RT-PCR and found no expression in testis, spleen, liver,
bone marrow, kidney, lymph node, lung, bladder, cerebellum, or colon.
Principally, this finding is consistent with the original Northern
analyses by Reiter et al. (25)
, who found PSCA to be
predominantly expressed in prostate and in placenta. However, a minor
PSCA expression was reported in this study for kidney and small
intestine, which was
100-fold lower compared with expression levels
in the prostate. Recently, an immunohistochemical analysis by Gu
et al. (27)
revealed that within these organs
the PSCA protein expression is confined to the renal collecting ducts
and neuroendocrine cells of the stomach and the colon. Because these
cells constitute only a small fraction of the respective organs, this
may explain why we did not find PSCA expression in colon and kidney by
RT-PCR. Although the expression level of PSCA in these cells appeared
to be lower than in CaP and epithelial cells of the prostate, it will
be necessary to quantify the amounts of PSCA in isolated neuroendocrine
cells and in prostate epithelial cells by real time PCR or Western
analysis for a direct comparison. Moreover, it would be important to
test whether the PSCA expression in cell lines of colonic or gastric
neuroendocrine origin is high enough to be recognized and lysed by our
PSCA-specific CTL line.
Our quantification of PSCA mRNA levels in BPH tissue and CaP specimens
revealed that PSCA was consistently expressed in BPH, primary CaP, and
metastases, but at least according to semiquantitative RT-PCR analyses,
we obtained no evidence for a correlation between up-regulation of PSCA
and tumor grade. Furthermore, we did not detect higher levels of PSCA
mRNA in tumor tissue as compared with BPH specimens. At first glance,
these data appear to contradict recent observations by Gu et
al. (27)
, who found that the level of PSCA expression
increased with higher Gleason score, higher tumor stage, and
progression to androgen independence. However, Reiter and colleagues
used different techniques in their analyses, such as in situ
hybridizations (26)
and immunohistochemical analyses using
PSCA-specific monoclonal antibodies (27)
. Both methods can
distinguish CaP tissue from surrounding nonneoplastic prostatic tissue,
which is not possible when isolating total RNA for RT-PCR analysis from
heterogeneous tissues. Because the content of CaP cells in our samples
could only be roughly estimated and varied between 30 and 90%, it may
be possible that our results underestimate the level of PSCA expression
in CaP cells. Unfortunately, we could not obtain nonhyperplastic
prostatic tissue for this study which would have allowed us to compare
PSCA expression of normal prostate, BPH, and CaP samples. Therefore, it
cannot be ruled out that a stimulation of PSCA-specific CTLs may lead
to a destruction of hyperplastic as well as normal prostatic tissue.
Nevertheless, it is evident from our analysis that PSCA is at least
maintained in expression from BPH through all stages of CaP in the vast
majority of cases, which would make it a promising target for
immunotherapy of CaP.
Interestingly, we observed in a single CaP patient that PSCA
expression in a bone metastasis was considerably higher than in the
primary tumor and in a liver metastasis, suggesting that PSCA
expression might be up-regulated in bone metastases. A very similar
finding was reported by Gu et al. (27)
in three
cases where it was possible to compare PSCA expression in metastases
from bone and primary tumors. A potential explanation for these
observations may be that factors are produced in bone marrow that
either lead to an up-regulation of PSCA expression or to a selective
expansion of PSCA-expressing CaP cells. Because CaP preferentially
metastasizes to the bone, the up-regulation of PSCA in bone tissue
would be a strong argument for using this protein as an antigen for CaP
immunotherapy.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Elke Scandella for help with flow cytometric analysis
and Hans Schiefer and Wolfhart Seelentag for the irradiation of cells.
Maries van den Broek and Maries Verkaik are acknowledged for the
contribution of cell lines, Jonathan Yewdell and Vincenzo Cerundolo for
the contribution of recombinant vaccinia viruses, and Patricia Wahl for
critical reading of the manuscript.
 |
FOOTNOTES
|
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1 This work was supported by Cancer League St.
Gallen-Appenzell, Swiss Cancer League, Foundation Propter Homines,
Cancer Research Institute, CaPCURE Foundation, R. and A. Dietschweiler
Foundation, W. and V. Spühl-Foundation, and AstraZeneca AG. 
2 To whom requests for reprints should be
addressed, at Kantonsspital St. Gallen, Laborforschungsabteilung, Haus
09, CH-9007 St. Gallen, Switzerland. Phone: 44-71-494-1069; Fax:
44-71-494-6321; E-mail: lfal{at}ms1.kssg.ch 
3 The abbreviations used are: CaP, carcinoma of
prostate; PSA, prostate-specific antigen; PSMA, prostate-specific
membrane antigen; PAP, prostatic acid phosphatase; PAGE, prostate
antigen encoded gene; PSP, prostate secretory protein; BPH, benign
prostatic hyperplasia; IL, interleukin; PBMC, peripheral blood
mononuclear cell; PSCA, prostate stem cell antigen; RT-PCR, reverse
transcription-PCR; TAP, transporter associated with antigen
processing. 
Received 4/28/00.
Accepted 8/ 4/00.
 |
REFERENCES
|
|---|
-
Lalaniel N., Laniado M. E., Abel P. D. Molecular and cellular biology of prostate cancer. Cancer Metastasis Rev., 16: 29-66, 1997.[Medline]
-
Harris D. T., Matyas G. R., Gomella L. G., Talor E., Winship M. D., Spitler L. E., Mastrangelo M. J. Immunologic approaches to the treatment of prostate cancer. Semin. Oncol., 26: 439-447, 1999.[Medline]
-
Tjoa B. A., Simmons S. J., Elgamal A., Rogers M., Ragde H., Kenny G. M., Troychak M. J., Boynton A. L., Murphy G. P. Follow-up evaluation of a Phase II prostate cancer vaccine trial. Prostate, 40: 125-129, 1999.[Medline]
-
Simons J. W., Mikhak B., Chang J. F., DeMarzo A. M., Carducci M. A., Lim M., Weber C. E., Baccala A. A., Goemann M. A., Clift S. M., Ando D. G., Levitsky H. I., Cohen L. K., Sanda M. G., Mulligan R. C., Partin A. W., Carter H. B., Piantadosi S., Marshall F. F., Nelson W. G. Induction of immunity to prostate cancer antigens: results of a clinical trial of vaccination with irradiated autologous prostate tumor cells engineered to secrete granulocyte-macrophage colony-stimulating factor using ex vivo gene transfer. Cancer Res., 59: 5160-5168, 1999.[Abstract/Free Full Text]
-
Peshwa M. V., Shi J. D., Ruegg C., Laus R., van Schooten W. C. A. Induction of prostate tumor-specific CD8+ cytotoxic T-lymphocytes in vitro using antigen-presenting cells pulsed with prostatic acid phosphatase peptide. Prostate, 36: 129-138, 1998.[Medline]
-
Xue B., Zhang Y., Sosman J. A., Peace D. J. Induction of human cytotoxic T lymphocytes specific for prostate-specific antigen. Prostate, 30: 73-78, 1997.[Medline]
-
Wang M. C., Valenzuela L. A., Murphy G. P., Chu T. M. Purification of a human prostate specific antigen. Investig. Urol., 17: 159-163, 1979.[Medline]
-
Israeli R. S., Powell C. T., Fair W. R., Heston W. D. W. Molecular cloning of complementary DNA encoding a prostate-specific membrane antigen. Cancer Res., 53: 227-230, 1993.[Abstract/Free Full Text]
-
Vihko P., Virkkunen P., Henttu P., Roiko K., Solin T., Huhtala M. L. Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase. FEBS Lett., 236: 275-281, 1988.[Medline]
-
Su Z., Lin J., Shen R., Fisher P. E., Goldstein N. I., Fisher P. B. Surface-epitope masking and expression cloning identifies the human prostate carcinoma tumor antigen gene PCTA-1 a member of the galectin gene family. Proc. Natl. Acad. Sci. USA, 93: 7252-7257, 1996.[Abstract/Free Full Text]
-
Brinkmann U., Vasmatzis G., Lee B., Pastan I. Novel genes in the PAGE and GAGE family of tumor antigens found by homology walking in the dbEST database. Cancer Res., 59: 1445-1448, 1999.[Abstract/Free Full Text]
-
Dube J. Y., Frenette G., Paquin R., Chapdelaine P., Tremblay J., Tremblay R. R., Lazure C., Seidah N., Chretien M. Isolation from human seminal plasma of an abundant 16-kDa protein originating from the prostate, its identification with a 94-residue peptide originally described as ß-inhibin. J. Androl., 8: 182-189, 1987.[Abstract/Free Full Text]
-
Hubert R. S., Vivanco I., Chen E., Rastegar S., Leong K., Mitchell S. C., Madraswala R., Zhou Y., Kuo J., Raitano A. B., Jakobovits A., Saffran D. C., Afar D. E. STEAP: a prostate-specific cell-surface antigen highly expressed in human prostate tumors. Proc. Natl. Acad. Sci. USA, 96: 14523-14528, 1999.[Abstract/Free Full Text]
-
Bussemakers M. J., van Bokhoven A., Verhaegh G. W., Smit F. P., Karthaus H. F., Schalken J. A., Debruyne F. M., Ru N., Isaacs W. B. DD3: a new prostate-specific gene, highly overexpressed in prostate cancer. Cancer Res., 59: 5975-5979, 1999.[Abstract/Free Full Text]
-
Lin B., White J. T., Ferguson C., Bumgarner R., Friedman C., Trask B., Ellis W., Lange P., Hood L., Nelson P. S. PART-1: a novel human prostate-specific, androgen-regulated gene that maps to chromosome 5q12. Cancer Res., 60: 858-863, 2000.[Abstract/Free Full Text]
-
Romero P. Cytolytic T lymphocyte responses of cancer patients to tumor-associated antigens. Springer Seminars Immunopathol., 18: 185-198, 1996.[Medline]
-
Nestle F. O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med., 4: 328-332, 1998.[Medline]
-
Rosenberg S. A., Yang J. C., Schwartzentruber D. J., Hwu P., Marincola F. M., Topalian S. L., Restifo N. P., Dudley M. E., Schwarz S. L., Spiess P. J., Wunderlich J. R., Parkhurst M. R., Kawakami Y., Seipp C. A., Einhorn J. H., White D. E. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat. Med., 4: 321-327, 1998.[Medline]
-
Thurner B., Haendle I., Roder C., Dieckmann D., Keikavoussi P., Jonuleit H., Bender A., Maczek C., Schreiner D., von den Driesch, P., Brocker E. B., Steinman R. M., Enk A., Kampgen E., Schuler G. Vaccination with mage-3A1 peptide-pulsed mature, monocyte-derived dendritic cells expands specific cytotoxic T cells and induces regression of some metastases in advanced stage IV melanoma. J. Exp. Med., 190: 1669-1678, 1999.[Abstract/Free Full Text]
-
Keillor J. S., Aterman K. The response of poorly differentiated prostatic tumors to staining for prostate specific antigen and prostatic acid phosphatase: a comparative study. J. Urol., 137: 894-896, 1987.[Medline]
-
Renneberg H., Friedetzky A., Konrad L., Kurek R., Weingartner K., Wennemuth G., Tunn U. W., Aumuller G. Prostate specific membrane antigen (PSM) is expressed in various human tissues: implication for the use of PSM reverse transcription polymerase chain reaction to detect hematogenous prostate cancer spread. Urol. Res., 27: 23-27, 1999.[Medline]
-
Chan P. S., Chan L. W., Xuan J. W., Chin J. L., Choi H. L., Chan F. L. In situ hybridization study of PSP94 (prostatic secretory protein of 94 amino acids) expression in human prostates. Prostate, 41: 99-109, 1999.[Medline]
-
Vasmatzis G., Essand M., Brinkmann U., Lee B., Pastan I. Discovery of three genes specifically expressed in human prostate by expressed sequence tag database analysis. Proc. Natl. Acad. Sci. USA, 95: 300-304, 1998.[Abstract/Free Full Text]
-
Chen M. E., Lin S. H., Chung L. W., Sikes R. A. Isolation and characterization of PAGE-1 and GAGE-7. New genes expressed in the LNCaP prostate cancer progression model that share homology with melanoma-associated antigens. J. Biol. Chem., 273: 17618-17625, 1998.[Abstract/Free Full Text]
-
Reiter R. E., Gu Z., Watabe T., Thomas G., Szigeti K., Davis E., Wahl M., Nisitani S., Yamashiro J., Le Beau M. M., Loda M., Witte O. N. Prostate stem cell antigen: a cell surface marker overexpressed in prostate cancer. Proc. Natl. Acad. Sci. USA, 95: 1735-1740, 1998.[Abstract/Free Full Text]
-
Reiter R. E., Sato I., Thomas G., Qian J., Gu Z., Watabe T., Loda M., Jenkins R. B. Coamplification of prostate stem cell antigen (PSCA) and MYC in locally advanced prostate cancer. Genes Chromosomes Cancer, 27: 95-103, 2000.[Medline]
-
Gu Z., Thomas G., Yamashiro J., Shintaku I. P., Dorey F., Raitano A., Witte O. N., Said J. W., Loda M., Reiter R. E. Prostate stem cell antigen (PSCA) expression increases with high Gleason score, advanced stage and bone metastasis in prostate cancer. Oncogene, 19: 1288-1296, 2000.[Medline]
-
Krausa P., Brywka M., III,, Savage D., Hui K. M., Bunce M., Ngai J. L. F., Leo D. L. T., Ong Y. W., Barouch D., Allsop C. E. M., Hill A. V. S., McMichael A. J., Bodmer J. G., Browning M. J. Genetic polymorphism within HLA-A*02: significant allelic variation revealed in different populations. Tissue Antigens, 45: 223-231, 1995.[Medline]
-
Pang S., Taneja S., Dardashti K., Cohan P., Kaboo R., Sokoloff M., Tso C. L., Dekernion J. B., Belldegrun A. S. Prostate tissue specificity of the prostate-specific antigen promoter isolated from a patient with prostate cancer. Hum. Gene Ther., 6: 1417-1426, 1995.[Medline]
-
Salgaller M. L., Lodge P., McLean J. G., Tjoa B. A., Loftus D. J., Ragde H., Kenny G. M., Rogers M., Boynton A. L., Murphy G. P. Report of immune monitoring of prostate cancer patients undergoing T-cell therapy using dendritic cells pulsed with HLA-A2-specific peptides from prostate-specific membrane antigen (PSMA). Prostate, 35: 144-151, 1998.[Medline]
-
De Backer O., Arden K. C., Boretti M., Vantomme V., De Smet C., Czekay S., Viars C. S., De Plaen E., Brasseur F., Chomez P., Van den Eynde B., Boon T., van der Bruggen P. Characterization of the GAGE genes that are expressed in various human cancers and in normal testis. Cancer Res., 59: 3157-3165, 1999.[Abstract/Free Full Text]
-
Rammensee H. G., Bachmann J., Emmerich N. P. N., Bachor O. A., Stevanovic S. SYFPEITHI: database for MHC ligands and peptide motifs. Immunogenetics, 50: 213-219, 1999.[Medline]
-
Parker K. C., Bednarek M. A., Coligan J. E. Scheme for ranking potential HLA-A2 binding peptides based on independent binding of individual peptide side-chains. J. Immunol., 152: 163-175, 1994.[Abstract]
-
ONeil B. H., Kawakami Y., Restifo N. P., Bennink J. R., Yewdell J. W., Rosenberg S. A. Detection of shared MHC-restricted human melanoma antigens after vaccinia virus-mediated transduction of genes coding for HLA. J. Immunol., 151: 1410-1418, 1993.[Abstract]
-
Gileadi U. , Moins Teisserenc, H. T., Correa,I.,Booth,B.L.,Dunbar,P.R.,Sewell,A.K.,Trowsdale,J.,Phillips,R.E.,andCerundolo,V.GenerationofanimmunodominantCTLepitopeisaffectedbyproteasomesubunitcompositionandstabilityoftheantigenicprotein.J.Immunol.,163: 6045-6052, 1999.
-
Groettrup M., Soza A., Kuckelkorn U., Kloetzel P. M. Peptide antigen production by the proteasome: complexity provides efficiency. Immunol. Today, 17: 429-435, 1996.[Medline]
-
Morel, S., Levy, F., Burlet Schiltz, O., Brasseur, F., Probst Kepper, M., Peitrequin, A. L., Monsarrat, B., Van Velthoven, R., Cerottini, J. C., Boon, T., Gairin, J. E., and Van den Eynde, B. J. Processing of some antigens by the standard proteasome but not by the immunoproteasome results in poor presentation by dendritic cells. Immunity, 12: 107117, 2000.
This article has been cited by other articles:

|
 |

|
 |
 
H. Kobayashi, T. Nagato, K. Oikawa, K. Sato, S. Kimura, N. Aoki, R. Omiya, M. Tateno, and E. Celis
Recognition of Prostate and Breast Tumor Cells by Helper T Lymphocytes Specific for a Prostate and Breast Tumor-Associated Antigen, TARP
Clin. Cancer Res.,
May 15, 2005;
11(10):
3869 - 3878.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. S. Lam, J. Yamashiro, I. P. Shintaku, R. L. Vessella, R. B. Jenkins, S. Horvath, J. W. Said, and R. E. Reiter
Prostate Stem Cell Antigen Is Overexpressed in Prostate Cancer Metastases
Clin. Cancer Res.,
April 1, 2005;
11(7):
2591 - 2596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lu and E. Celis
Recognition of Prostate Tumor Cells by Cytotoxic T Lymphocytes Specific for Prostate-specific Membrane Antigen
Cancer Res.,
October 15, 2002;
62(20):
5807 - 5812.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Yang, G. E. Holt, M. P. Velders, E. D. Kwon, and W. M. Kast
Murine Six-Transmembrane Epithelial Antigen of the Prostate, Prostate Stem Cell Antigen, and Prostate-specific Membrane Antigen: Prostate-specific Cell-Surface Antigens Highly Expressed in Prostate Cancer of Transgenic Adenocarcinoma Mouse Prostate Mice
Cancer Res.,
August 1, 2001;
61(15):
5857 - 5860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Argani, C. Rosty, R. E. Reiter, R. E. Wilentz, S. R. Murugesan, S. D. Leach, B. Ryu, H. G. Skinner, M. Goggins, E. M. Jaffee, et al.
Discovery of New Markers of Cancer through Serial Analysis of Gene Expression: Prostate Stem Cell Antigen Is Overexpressed in Pancreatic Adenocarcinoma
Cancer Res.,
June 1, 2001;
61(11):
4320 - 4324.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Amara, G. S. Palapattu, M. Schrage, Z. Gu, G. V. Thomas, F. Dorey, J. Said, and R. E. Reiter
Prostate Stem Cell Antigen Is Overexpressed in Human Transitional Cell Carcinoma
Cancer Res.,
June 1, 2001;
61(12):
4660 - 4665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Saffran, A. B. Raitano, R. S. Hubert, O. N. Witte, R. E. Reiter, and A. Jakobovits
Anti-PSCA mAbs inhibit tumor growth and metastasis formation and prolong the survival of mice bearing human prostate cancer xenografts
PNAS,
February 8, 2001;
(2001)
51624698.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
A. K. Sharma, J. J. Kuhns, S. Yan, R. H. Friedline, B. Long, R. Tisch, and E. J. Collins
Class I Major Histocompatibility Complex Anchor Substitutions Alter the Conformation of T Cell Receptor Contacts
J. Biol. Chem.,
June 8, 2001;
276(24):
21443 - 21449.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. C. Saffran, A. B. Raitano, R. S. Hubert, O. N. Witte, R. E. Reiter, and A. Jakobovits
Anti-PSCA mAbs inhibit tumor growth and metastasis formation and prolong the survival of mice bearing human prostate cancer xenografts
PNAS,
February 27, 2001;
98(5):
2658 - 2663.
[Abstract]
[Full Text]
[PDF]
|
 |
|